Orii et al. 10.1073/pnas.0602436103. |
Supporting Figure 6
Supporting Materials and Methods
Fig. 6. Generation and characterization of an Xrcc2-/- mouse. (A) Xrcc2 was deleted in ES cells via Cre excision of LoxP flanked exon 3 to generate a mutant allele missing both exon 3 and the Neotk selection marker. Southern blot analysis showed a single 1.5-kb mutant allele is present in the knockout after EcoRI digestion. (B) Xrcc2-/- mice are not viable and usually died around embryonic days 10-12 (E10–E12). Analysis of Xrcc2 mRNA expression using RT-PCR showed an absence of Xrcc2 in Xrcc2-/- mouse embryonic fibroblasts (MEFs) but normal Gapdh expression. (C) MEFs derived from surviving Xrcc2-/- E13.5 embryos underwent premature senescence (growth), and MEFs derived from Xrcc2-/-p53-/- embryos, although not prematurely senescent, were very sensitive to DNA double-strand break (DSB)-inducing agents (IR and mitomycin C) but were not differentially sensitive to UV. (D) Compared with WT and Xrcc2+/-, Xrcc2-/- MEFs showed pronounced chromosomal instability with a spectrum of different chromosomal defects including chromatid gaps (ctg), chromatid breaks (ctb), chromosomal breaks (csb), and chromosomal fusions and radials. An example of a single metaphase cell harboring a variety of chromosomal defects is shown together with spectral karyotyping of selected chromosomal rearrangements. Numbers assigned to chromosomal abnormalities indicate the chromosome of origin of the fusions.
Supporting Materials and Methods
Generation of Mice Deficient for Xrcc2. The murine Xrcc2 gene contains three exons within a 13.8-kb region of genomic DNA. We screened a mouse BAC DNA library (Invitrogen), and then identified exon 3 that includes 714 base pairs (bp) of the coding region and the 3'-untranslated region of the Xrcc2 gene. To generate the targeting construct (pXrcc2KO-Neotk), we inserted a 11-kb BamHI genomic fragment containing 3' flanking sequence and 714 base pairs of the Xrcc2 coding sequence into a BamHI site of the pBluescript II vector (Stratagene). A LoxP-flanked Neo-tk cassette (containing a Neomycin (Neo)-resistant gene for positive selection and thymidine kinase (tk) gene for negative selection) was inserted into an XhoI site of BamHI fragment of pXrcc2KO-Neotk. A 60-bp oligomer containing one loxp site and SpeI site was inserted into BstBI site of BamHI fragment of pXrcc2KO-Neotk. W9.5 embryonic stem (ES) cells were electroporated with NotI-linearized pXrcc2KO-Neotk and selected for resistance to G418. Targeted ES cells were identified by Southern blot analysis of EcoRI-digested ES genomic DNA by using an amplified genomic fragment 5' of exon 3. The probe, 306 base pairs in length, was generated by PCR by using mouse genomic DNA as a template with the following primers: forward, 5' ATT GTT CAT GGG AAT TCT GCT TGG C and reverse, 5' GGC TGT GGT TGC CTA GGG CTG ACC. EcoRI digestion of genomic DNA from G418-registant ES cells identified a 1.5-kb fragment in targeted clones due to generate a new EcoRI site in the mutant allele that was readily distinguishable from the endogenous 4.9-kb Xrcc2 genomic EcoRI fragment. Isolated targeted clones were electroporated with pMC-Cre, and selected in ES medium containing gancyclovir. Removal of the LoxP-flanked Neo-tk cassette and exon 3 was confirmed by Southern blot analysis of SpeI-digested ES genomic DNA by using an amplified genomic fragment 3' of exon 3. The probe, 520 base pairs in length, was generated by PCR by using mouse genomic DNA as a template with the following primers: forward, 5' GTA GCT GAG ACT GGT CCA GGC TTG C and reverse, 5' CCC ACA CCT TCT GAA CCC CGT TC. SpeI digestion of genomic DNA from tk resistant ES cells identified a 6.6-kb fragment in targeted clones due to generate a new SpeI site in the mutant allele that was readily distinguishable from the endogenous 11.8-kb Xrcc2 genomic SpeI fragment. Male chimeras were mated to C57BL/6 females to obtain germ line transmission. The presence of the mutated allele was confirmed by Southern blot analysis or PCR, and heterozygous F1 males and females were interbred to generate F2 animals for subsequent studies.
Genotyping.
Genotype determination of Xrcc2 was performed on cell lysates prepared by digestion of either tail, embryonic tissues, or yolk sacs in lysis buffer (100 mM Tris∙HCl, pH 8.0/200 mM NaCl/5 mM EDTA/0.2% SDS/0.1 mg/ml proteinase K) for overnight at 55°C. For detection of knockout allele, a 5' forward primer to the Xrcc2 intron upstream of exon 3 (5' CTGATGGGAAAAGCATGTTGC) and 3' reverse primer to the Xrcc2 intron downstream of exon 3 (5' TCACAGTGCTTGGTCATGACAACAG) were used. For detection of wild-type allele, 5' forward primer (5' GTGCTCTCAGCTCCTAGAGCGGCTTGTCAC) and 3' reverse primer (5' GGACTTTTAAAGACTTGCCTTAGTGCACC) to the Xrcc2 exon 3 were used. Amplification for 30-35 cycles at 94°C for 30 s, 58°C for 30 s, and 72°C for 45 s gave fragments of 373-bp (wild type) and 352-bp (knockout) by electrophoresis through a 2.0% agarose gel. Wild-type mouse genomic DNA (C57BL/6) and Xrcc2-/- mouse genomic DNA from mouse embryonic fibroblasts (MEFs), identified by Southern blot analysis, were used as control. Mice are on an out-bred 129/SvImJ x C57BL/6 background. Genotyping of Lig4, p53, and Atm were done by PCR.Analysis of MEFs.
Growth assays. MEFs were isolated from embryonic day 13.5 (E13.5) embryos from an Xrcc2+/- intercross. Embryo tissue was mechanically disrupted in 100 ml of 0.25% trypsin and placed into individual 6-cm dishes in DMEM with 10% FBS, 2-mercaptoethanol (100 mM), and penicillin/streptomycin antibiotics. Growth kinetics and proliferative capacity were measured using the 3T9 assay; we seeded 9 × 105 cells in triplicate on a 6-cm dish and passaged every third day. Population doublings for each passage were obtained by log2 (cells split per cells seeded).Radiation-sensitivity assays.
MEFs were used at passage 3 and treated with 3 Gy of ionizing radiation (IR) from a 137Cs source at a dose rate of ≈120 cGy/min, plated 0.6 × 105 cells per 6-cm dishes and counted every 48 h. All experiments were done at least twice, and each experiment consisted of at least two separate lines per genotypes with three plates per line.MMC assay.
MEFs were treated with mitomycin C (MMC) (0-2.5 mM) for 2 h in DMEM without FBS at 37°C. Cells were then washed twice with PBS, trypsinized, and counted before dilution and plating. Cells were counted after 6 days incubation, and survival was expressed relative to untreated control populations.UV radiation.
MEFs at passage 3 were plated at 0.6 × 105 cells per plates onto dishes 6 cm in diameter. After the cells attached, the media were replaced with 3 ml PBS, and the cells were irradiated with 0, 6, 13, or 27 J/m2 of shortwave UV from a 23-watt, shortwave UV light source (254 nm). After 6 days, the cells were trypsinized and counted.Cytogenetic analysis.
MEFs were exposed to colcemid (0.05 mg/ml) for 2 h, trypsinized, and incubated in hypotonic solution (1:1, 0.075 M KCl:0.034 M trisodium citrate) for 15 min at 37°C. Cells were fixed in 3:1 ethanol:acetic acid and dropped onto slide, before staining with Giemsa for cytogenetic analysis. Numbers of chromosome breaks, chromosome gaps, chromatid breaks, chromatid gaps, fusions, and radial forms were counted. Spectral karyotyping (SKY) procedures were according to the SkyPaint hybridization and detection protocol (Applied Spectral Imaging). Pretreatment consisted of RNase A (100 mg/ml) for 1 h at 37°C and pepsin for 2 min at 20°C (50 mg/ml in 10 mM HCl; Sigma), with counterstaining by DAPI.RT-PCR.
Total RNA was extracted from mouse embryonic fibroblasts using Trizol reagent (Life Technologies). The mRNA in 5 mg total RNA was reverse transcribed using oligo(dT)12-18 primers and Superscript II reverse transcriptase (Life Technologies), according to the supplier’s protocol. PCR to determine the presence of Xrcc2 mRNA was performed using a 5' forward, exon 2-specific primer (5' CTCCTTGCCCGACTTGAAGGCAG) and 3' reverse primer to exon 3 (5' ATGGGTGCTTGGAGGAAGAAGGCCCG). PCR conditions were 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min, for 30 cycles. As a control for reverse transcription, the following primers were used for amplification of glyceraldehydes-3-phosphate dehydrogenase (Gapdh) cDNA: 5' forward primer, 5' ATCATCCCTGCATCCACTGGTGCTG; 3' reverse primer, 5' TGATGGTATTCAAGAGAGTAGGGAG. The products of amplification, 607 and 553 bp for Xrcc2 and Gapdh cDNAs, respectively, were separated by electrophoresis on a 1.5% agarose gel.