Dodsworth and Leigh. 10.1073/pnas.0602278103. |
Table 1. Oligonucleotides, plasmids, and strains used in this study
| Description | Reference |
Oligonucleotides WHN coding | 5'-TGCACCACCATCACCATCACATCGAAGGTCGTGGGCC CGCCGGCGGCGCGCCTAGGA; coding strand of N-terminal His-tag linker, anneals to WHN noncoding |
This study |
WHN noncoding | 5'-CTAGAGGATCCGCGCGGCGGCCGCCCGGGTGCTGGA AGCTACACTACCACTACCACCACGTACGT; noncoding strand of N-terminal His-tag linker, anneals to WHN coding | This study |
WHC coding | 5'-TGGGGCGCGCCATCGAAGGTCGTCATCACCATCACCA TCACTGA; coding strand of C-terminal His-tag linker, anneals to WHC noncoding | This study |
WHC noncoding | 5'-CTAGAGTCACTACCACTACCACTACTGCTGGAAGCTA CCGCGCGGGGTACGT; noncoding strand of C-terminal His-tag linker, anneals to WHC coding | This study |
WHN nifI2 for | 5'-GGTGGGCCCATGAAAGAGATAATCGC; forward primer for PCR amplification of nifI2 for cloning into pLW40neo; ApaI site is underlined and the gene start site is in bold | This study |
WHN nifI2 rev | 5'-GTGGCGCGCCTTAAATTGCAGCTTCTCCTC; reverse primer for PCR amplification of nifI2 for cloning into pLW40neo; AscI restriction site is underlined | This study |
nifI 2 ∆T-loop f4 | 5'-GTTGGATCCAAAGAATTGTTAAACCAACCTGGG; forward primer for PCR amplification of the 3' portion of nifI2 in conjunction with WHN nifI2 rev, for construction of the T-loop deletion; BamHI restriction site is underlined | This study |
nifI 2 ∆T-loop r3 | 5'-TTCGGATCCGAGTTCTCCAACAATTGC; reverse primer for PCR amplification of the 5'-portion of nifI2 in conjunction with WHN nifI2 for, for construction of the T-loop deletion; BamHI restriction site is underlined | This study |
nifI 1 His6c 5' | 5'-GCAATGCATGAAAATGATTAGAGCAGTAGTC; forward primer for PCR amplification of nifI1 for cloning into pLCW40neo; NsiI site is underlined and the gene start site is in bold | This study |
nifI 1 His6c 3' | 5'-ATCGGCGCGCCCTAATCCGCATGATCTTGTTC; reverse primer for PCR amplification of nifI1 for cloning into pLCW40neo; AscI restriction site is underlined | This study |
nifI 1?T-loop for2 | 5'-ATTGGATCCGATGAACTTCCAAAAACAATGC; forward primer for PCR amplification of the 3' portion of nifI1 in conjunction with nifI1 His6C 3', for construction of the T-loop deletion; BamHI restriction site is underlined | This study |
nifI 1?T-loop rev | 5'-GTCGGATCCAATTCCTTTTTGTTTTCCTCTTCC; reverse primer for PCR amplification of the 5'-portion of nifI1 in conjunction with nifI1 His6C 5', for construction of the T-loop deletion; BamHI restriction site is underlined | This study |
nifH His6c 5' | 5'-CTAATGCATGGTAAGAAAAATCGCAATTTACGG; forward primer for PCR amplification of nifH for cloning into pLCW40neo; NsiI site is underlined and the gene start site is in bold | This study |
nifH His6c 3' | 5'-TTAGGCGCGCCCATCTAAGAATCCGTATTTTGAAG; reverse primer for PCR amplification of nifH for cloning into pLCW40neo; AscI restriction site is underlined | This study |
∆nifH 5'-for | 5'-AAATCTAGATTTTACGACCGTATTTTGTCG; forward primer for PCR amplification of the 5'-region flanking nifH for construction of the nifH deletion; XbaI restriction site is underlined | This study |
∆nifH 5'-rev | 5'-ATTGGCGCGCCTCTTACCATTTTTTAGGCCTC; reverse primer for PCR amplification of the 5'-region flanking nifH for construction of the nifH deletion; AscI restriction site is underlined | This study |
∆nifH 3' for | 5'-GAAGGCGCGCCTTCAAAATACGGATTCTTAG; forward primer for PCR amplification of the 3' region flanking nifH for construction of the nifH deletion; AscI restriction site is underlined | This study |
∆nifH 3' rev | 5'-AACGGGCCCTTGTTGTCAACTTCAAATCCG; reverse primer for PCR amplification of the 3' region flanking nifH for construction of the nifH deletion; ApaI restriction site is underlined | This study |
Plasmids pWLG40NZ-R | Expression vector for M. maripaludis with hmv promoter and neor cassette | (35) |
pLW40neo | pWLG40NZ-R with N-terminal His-tag linker replacing lacZ | This study |
pLW40neo nifI2 | pLW40neo with nifI2 cloned in between the ApaI and AscI sites | This study |
pLW40neo nifI2 ∆T | pLW40neo nifI2 with F48S and ∆49–52 mutations in nifI2 | This study |
pLCW40neo | pWLG40neo with C-term His-tag linker replacing lacZ | This study |
pLCW40neo nifI1 | pLCW40neo with nifI1 cloned in between the ApaI and AscI sites | This study |
pLCW40neo nifI1?T | pLW40neo nifI1 with K43G, I44S and ∆45–49 mutations in nifI1 | this study |
pLCW40neo nifH | pLCW40neo with nifH cloned in between the ApaI and AscI sites | this study |
pCRPRTNEO | Vector for genetic manipulations in M. maripaludis | (36) |
pCRPRTNEO ∆nifH | pCRPRTNEO with regions flanking nifH cloned in between the XbaI and ApaI sites | This study |
Strains S2 | Wild-type M. maripaludis strain |
(34) |
Mm900 | S2 with a deletion in hpt; 8-azahypoxanthiner | (36) |
Mm55 | Deletion of nifI2; purr | (28) |
Mm1012 | Mm55 with pLW40neo; purr, neor | This study |
Mm711 | Mm55 with pLW40neo nifI2; purr, neor | This study |
Mm1017 | Mm55 with pLW40neo nifI2?T; purr, neor | This study |
Mm56 | Deletion of nifI1; purr | (28) |
Mm1050 | Mm56 with pLCW40neo; purr, neor | This study |
Mm1051 | Mm56 with pLCW40neo nifI1; purr, neor | This study |
Mm1067 | Mm56 with pLCW40neo nifI1?T; purr, neor | This study |
Mm1036 | Mm900 with an in-frame deletion of nifH; 8-azahypoxanthiner | This study |
Mm1046 | Mm1036 with pLCW40neo nifH; neor, 8-azahypoxanthiner | This study |