Direct observation of DNA rotation during branch migration of Holliday junction DNA by Escherichia coli RuvA-RuvB protein complex -- Han et al. 103 (31): 11544 Data Supplement - HTML Page - index.htslp -- Proceedings of the National Academy of Sciences

Han et al. 10.1073/pnas.0600753103.

Supporting Information

Files in this Data Supplement:

Supporting Figure 6
Supporting Movie 1
Supporting Movie 2
Supporting Movie 3
Supporting Table 1
Supporting Table 2
Supporting Text
Supporting Figure 7
Supporting Figure 8
Supporting Table 3
Supporting Table 4

Supporting Figure 6

Fig. 6.
Construction of Holliday junction for the tethered particle method described in Supporting Text. D and B indicate digoxigenin and biotin labeled DNA, respectively.

Supporting Figure 7

Fig. 7.
Construction of Holliday junction for biochemical analysis described in Supporting Text. *, ³²P-labeled end.

Supporting Figure 8

Fig. 8.
Biochemical analysis of Holliday junction branch migration under the single-molecule buffer condition. (A) Branch migration rate was measured in the buffer containing 20 mM Hepes-HCl (pH 7.5), 1 mM EDTA, 10 mM MgCl₂, 100 nM RuvA, 300 nM RuvB and 500 mM ATP. (B) Branch migration rate was measured in the buffer described in A plus 300 mM KCl. (C) Branch migration rate was measured in the buffer described in A plus 1 mg/ml a-casein. (D) Branch migration rate was measured in the buffer described in A plus 300 mM KCl and 1 mg/ml a-casein, which corresponds to the buffer of the single-molecule analysis. (E) Time course of dissociated-product appearance during branch migration. Filled circle indicates the result in A. Filled diamond indicates the result in B. Filled triangle indicates the result in C. Filled square indicates the result in D. The lines represent computer-generated simulations of the appearance of the indicated products. (F) Branch migration rates. A-D indicate the results in A-D, respectively. The rates of each buffer conditions were measured three times and indicate average ± standard deviation.

Supporting Movie 1

Movie 1.
Clockwise rotational bead. The rotational bead was observed at an ATP concentration of 50 mM. The rotating white spot is a daughter fluorescent bead. The video rate is real time. The scale is 2.5 mm ´ 2.5 mm.

Supporting Movie 2

Movie 2.
Counterclockwise rotational bead. The rotational bead was observed at an ATP concentration of 50 mM. The rotating white spot is a daughter fluorescent bead. The video rate is real time. The scale is 2.5 mm ´ 2.5 mm.

Supporting Movie 3

Movie 3.
Directional change of the bead after a pause. The movie corresponds to Fig. 3 from 200 to 600 sec. At approximately 70 sec, the clockwise rotational bead pauses and at 345 sec, the bead starts rotating counterclockwise. The rotating white spot is a daughter fluorescent bead. The video rate is real time. The scale is 2.5 mm ´ 2.5 mm.

Table 1. Pausing Time of the beads rotation

ATP concentration	Time (sec)	Number of events
500 mM	120 ± 100	5
250 mM	ND	0
100 mM	98 ± 56	3
50 mM	26*	2
25 mM	140 ± 110	4
10 mM	86 ± 41	6

ND, not determined.

*The number of the observed beads was 2. Therefore, we could not determine the standard deviation

Table 2. Changes of the beads direction

Directional change*	Number of events
CW to CW	3
CW to CCW	9
CCW to CCW	5
CCW to CW	3
Sum	20

* CW and CCW indicate the clockwise and counterclockwise rotations, respectively.

Table 3. Kinetic parameters

ATP (mM)	t _AB (sec)	t _het (sec)
500	230	67
250	210	50
100	370	60
50	300	73
25	220	230
10	540	450

Table 4. Sequences of oligonucleotides used to make long arm Holliday junction

The 4700-bp fragment I and II were obtained by PCR (I, imHJ-1D and imHJ-2; II, imHJ-1B and imHJ-2).
imHJ-1D*	TCACCTCCTAACGTCCATCCACCCGGGGATCCTCTAGAGT
imHJ-1B	TGCCTGATTTAGTTCGGTTAACCCGGGGATCCTCTAGAGT
imHJ-2	GCTCGAATTCGATTACATGGTCATAGCTGT
Primer D1 and B1 were used for the construction of digoxigenin labeled DNA (FIII) and biotin labeled DNA (FIV), respectively.
D1^†	C CTAAAGTATCCTCCTAAAGTCACCTCCTAACGTCCATCC
B1^‡	C CACCAATCTTGATGCTCAAGTGCCTGATTTAGTTCGGTT
The 1000-bp fragment 1 and 2 were obtained by PCR (1, imHJ-1DH and imHJ4; 2, imHJ-1D and imHJ-4H)
imHJ-1DH*	TCAAAGCCTAACGTCCATCCACCCGGGGATCCTCTAGAGT
imHJ-4^§	GCTCGAATTCGCAGCACTGCATAATTCTCTTACTG
imHJ-4H^§	GCTCGAATTCGCAGCACTGCAGCCTTCTCTTACTG
Partial duplex DNA (HJY-12, HJY-1 + HJY-2; HJY-34, HJY-3 + HJY-4)
HJY-1	GTACCATGCTCGAGATTACGAGATATCGATGCATGCG
HJY-2	AATTCGCATGCATCGATATAATACGTGAGGCCTAGGATCGA
HJY-3^\|\|	TCGATCCTAGGCCTCACGTATTATATCGATGCATGCG
HJY-4^\|\|	AATTCGCATGCATCGATATCTCGTAATCTCGAGCATGGTAC

*The underlined regions indicate the heterologous regions between the sequences.

^†The underlined regions indicate the digoxigenin labeled nucleotide. ^‡The underlined regions indicate the biotylated nucleotide. ^§The underlined regions indicate the heterologous regions between the sequences.

The underlined regions are complementary to each other.

^||The underlined regions are complementary to each other.