Kim et al. 10.1073/pnas.0601915103. |
Supporting Figure 7
Supporting Figure 8
Supporting Figure 9
Supporting Figure 10
Supporting Methods
Fig. 7. There is no functional NRSE motif within 5 kb of the 5' upstream sequence of the phytanoyl-CoA a-hydroxylase-associated protein 1 (PAHX-AP1) gene. (A) PAHX-AP1 promoter reporter constructs with or without putative neuron-restrictive silencer element (NRSE) site (nucleotide sequence: ggCAGCACaggGGAaAGgaaa) compared with the consensus sequence of NRSE, TTCAGCACCACGGACAGCGCC. (B) Increasing doses of NRSF/repressor element 1-silencing transcription factor (REST) were transiently cotransfected with NRSE-containing (open bars) or NRSE-deleted PAHX-AP1 promoter reporter (filled, dotted, and hatched bars) in HEK293T cells. After 48 h, cell extracts were prepared and assayed for luciferase activity. There was no inverse correlation in reporter expression with increasing doses of NRSF/REST between NRSE-containing and NRSE-deleted PAHX-AP1 promoter reporters, which indicates that NRSE is not a specific, functional repressive cis element in the PAHX-AP1 promoter.
Fig. 8. AP4 in nuclear extract binds specifically to WT PAHX-AP1 PRE, but Gem does not. Labeled PAHX-AP1 PRE oligonucleotide was incubated with nuclear extract (NE) from HEK293T cells (lanes 2-9). Lane 1 is probe only. Nuclear extract was incubated with probe alone (lane 2), excess cold probe (lanes 3-6), anti-Gem antibody (lane 7), anti-AP4 antibody (lane 8), or IgG (lane 9). The near absence of band due to inhibition of AP4 binding with PRE by anti-AP4 antibody (thin arrow) is indicated (lane 8). Note that addition of anti-Gem antibody partially affects AP4 binding with PRE through sequestering the AP4–Gem complex (lane 7). Dashed arrow indicates nonspecific bands.
Fig. 9. Schematics and analyses of in vitro translated proteins. (A) Schematics of the AP4 and Gem deletion constructs used to map the interacting domain are shown. (B) Analysis of V5-fusion proteins of AP4 used to map the interacting domain. (C) Analysis of V5-fusion proteins of SMRT RID, mSin3A PAH1-2, and N-CoR ID.
Fig. 10. AP4-Gem complex recruits SMRT. (A) Schematics of the SMRT, mSin3A, and N-CoR constructs used for the pull-down assay. Results of the yeast one-to-one assay between Gem and three corepressors are shown on the right. The indicated corepressor-B42 and LexA-Gem plasmids were transformed into a yeast strain, and at least six separate transformants were tested for tryptophan prototrophy and LacZ activity. (B) V5-fusion proteins of SMRT RID, mSin3A PAH1-2, and N-CoR ID were pulled down by V5 and analyzed by immunoblotting with Gem (Upper) or AP4 (Lower). (C) Full-length SMRT interacts directly with Gem but not with AP4. Mixtures of full-length SMRT and full-length AP4 or full-length Gem were pulled down by anti-SMRT antibody and blotted with Gem or AP4 (Upper) or reciprocally pulled down and probed (Lower). Input is in vitro-translated Gem, AP4, or SMRT.
Supporting Methods
EMSA.
Nuclear extract from HEK293T cells or in vitro transcribed and translated activator protein 4 (AP4)-V5-His and geminin (Gem) (3 ml) were preincubated with or without competitor [28-bp putative repressive element (PRE) oligonucleotide; –258/–225 bp; 5'-AGGTGGCAGAAGCTACAGCTGCTGCCTC-3'] and antibody in a 20-ml reaction containing DNA-binding buffer (10 mM Tris·HCl, pH 8.0/50 mM NaCl/5% glycerol/1 mM EDTA/1 mM DTT) and 1 mg of poly (dI-dC) on ice for 30 min. [g-32P]ATP-labeled wild-type or mutant (GAATGGGGGAAAGGTGGCAGAAGCTACAGC) PRE probe was added, and the samples were incubated for an additional 20 min at room temperature. The samples were resolved on a 5% nondenaturing polyacrylamide gel, dried, and subjected to autoradiography.Repression Assay.
HEK293T cells were plated in 24-well plates and cotransfected with phytanoyl-CoA a-hydroxylase-associated protein 1 (PAHX-AP1) reporter and the indicated amounts of expression plasmids (AP4 or Gem) or were cotransfected with the Gal4-tk-luc reporter together with pCMXGal4N or the indicated amounts of pCMXGal4N-Geminin. The total DNA used in each transfection was adjusted to 300 ng per well by adding an appropriate amount of pcDNA3 empty vector, and 0.1 ng of pCMVb (Clontech, Palo Alto, CA) was cotransfected as an internal control by by using FuGENE 6 (Roche, Indianapolis, IN). Cells were harvested 48 h after transfection, and luciferase and b-gal activities were assayed as described in ref. 1. In the pretreatment experiment, 200 nM trichostatin A (TSA) was added for the indicated time before harvesting. Luciferase activity was normalized to lacZ expression. The transfection experiments were performed at least three times, and the mean and SE of the independent experiments is shown in Results. Experimental differences were tested for statistical significance by using ANOVA and Student’s t test. All statistical tests were two-sided, and P values of <0.05 were considered statistically significant.In Vitro
Translation and Pull-Down Assays. TNT-coupled transcription and translation was done in vitro with rabbit reticulocyte extracts (Promega, Madison, WI). Products, confirmed by immunoblotting, were incubated with appropriate antibodies overnight at 4°C in RIPA buffer (50 mM Tris, pH 7.5/150 mM NaCl/1% Nonidet P-40/0.1% SDS/1% deoxycholic acid) with protease inhibitor mixture (Roche) and 1 mM phenylmethylsulfonyl fluoride. Protein A/G-agarose beads (Pierce, Rockford, IL) were added to the binding reaction for 1 h, and the samples then were washed three times in RIPA. Bound proteins were eluted with sample buffer and fractionated on SDS polyacrylamide gels followed by immunoblotting.Antibodies, Immunoblotting, and Immunoprecipitation.
Mouse anti-V5 (Invitrogen, Carlsbad, CA), mouse anti-myc (Santa Cruz Biotechnology, Santa Cruz, CA), mouse anti-b-gal (Cortex, San Leandro, CA), and rabbit anti-actin (Sigma, St. Louis, MO) were used with appropriate secondary antibodies (Sigma).Cell lysates from HEK293T, HeLa, CT-26, and Raw cells were used either for immunoprecipitation (IP) experiments or boiled for 10 min and loaded directly onto acrylamide (8–12%) gels in denaturing conditions, followed by electrophoretic transfer. Immunoblotting was performed as described in ref. 2.
For sequential IP, HEK293T cells were washed with PBS buffer and cross-linked in 1 mM dithiobis(succinimidylpropionate) (DSP) (Pierce) for 15 min at room temperature, which was stopped with 20 mM glycine. Cells were washed with PBS and then lysed with RIPA buffer. AP4-Gem-SMRT complex was immunoprecipitated from this lysate with anti-AP4 antibody at 4°C for 1 h. The sample was incubated with protein A/G Sepharose beads (Pierce) at 4°C for 1 h and washed with IP buffer (200 mM Hepes, pH 7.7/0.1 mM EDTA/2.5 mM MgCl2/0.005% Nonidet P-40/10% Glycerol). The protein complex was eluted with 0.1 M glycine-acetate (pH 3.0), neutralized with 1 M Tris, and diluted with IP buffer. This eluent was precleared with protein A/G Sepharose beads and immunoprecipitated again with anti-SMRT antibody (Santa Cruz Biotechnology) at 4°C for 1 h. After incubating the sample with protein A/G Sepharose beads at 4°C for 1 h, the beads were washed with IP buffer. The protein complex was eluted again with 0.1 M glycine-acetate, precipitated with 0.2 mg/ml deoxycholic acid and 10% trichloroacetic acid at –20°C for 30 min, and then centrifuged at 4°C for 15 min. The pellet was dissolved with sample buffer, neutralized with 2 M Tris, and processed for Western blot analysis of Gem.
ChIP.
ChIP was performed on HEK293T, CT-26, and Raw cells with the ChIP assay kit (Upstate Biotechnology, Charlottesville, VA). Cells were collected and cross-linked by using 1% formalin for 10 min at room temperature, and the extracts were sonicated until the DNA fragments were 500-800 bp in size. Cell extracts were subsequently incubated with 2 mg IgG or antibody against AP4 or Gem overnight at 4°C. The extracts were incubated with salmon sperm DNA/protein A-Sepharose beads (Upstate Biotechnology) for 1 h. After extensive washing of the beads, proteins were eluted and reversed by heating for 4 h at 65°C. After DNA purification, 30-35 cycles of PCR was performed. Primers were as follows: PAHX-AP1 (400 bp, CT-26 cells), 5'-ATTGTGCGGTGCATCAGTGA-3' (sense, S), 5'-CCAGACCGAATCTGGCTCCA-3' (antisense, AS); PAHX-AP1 (180 bp, Raw cells), 5'-CTGAATTCCAAGTAGGAG-3' (S), 5'-CAAGCAAGCTTGGTCCCT-3' (AS); hDYRK1A-5', 5'-TACTACCTATGA-GCTGAGGG-3' (S), 5'-CCTAAAAACGTAACCTGTGA-3' (AS); hDYRK1A-3', 5'-TGCTATAGCGACCGGGTCGG-3' (S), 5'-TGTCCGCTCTCTGAGGCCGA-3' (AS); mDYRK1A-5', 5'-CATTATAGCTGTCATCAGCC-3' (S), 5'-GATGCTCCTGGG-TTATGTAC-3' (AS); mDYRK1A-3', 5'-ACTGAGAGCTTGTTTGATCC-3' (S), 5'-TGCCATTAGGTACGTCTGTT-3' (AS).For ChIP assay of the temporal window of mouse brain tissues, cerebral cortex was obtained from each developmental stage of ICR mouse (embryonic days 15 and 18 and neonatal days 1, 3, 10, 14, and 1 month). Samples (60 mg) were trypsinized at room temperature for 15 min, pelleted by centrifugation, and cross-linked at room temperature for 10 min in ice-cold 1% formaldehyde/PBS, which was stopped by adding glycine to a final concentration of 0.125 M. Samples were washed in PBS, redissolved in 1 ml of 100 mM Tris/100 mM NaCl/30 mM MgCl2/0.1% Nonidet P-40/ 0.1 mM PMSF, then pelleted and dissolved in 300 ml of lysis buffer containing 1% SDS, 10 mM EDTA, 50 mM Tris (pH 8.0), and 0.1 mM PMSF. Samples were sonicated by applying nine 9-s pulses at 30% amplitude (Vibra Cell; Sonics, Newtown, CT), and centrifuged at 4°C. The supernatant fluid was diluted 10-fold in ChIP dilution buffer (Upstate Biotechnology) and divided into aliquots for input or IP. To reduce nonspecific background, 2 ml of diluted supernatant fluid was precleared with 75 ml of ssDNA/Protein A Agarose slurry for 4 h at 4°C with agitation. Supernatant fluid was collected by brief centrifugation and added with 2 mg of normal rabbit IgG, anti-AP4, or anti-Gem antibody for ChIP.
Primary Neuronal Cell Cultures and Transfection.
For glial cultures, neocortex from 3-day-old ICR mice was dissociated and plated on 24-well plates at a density of 0.5 hemispheres per plate in MEM supplemented with 10% horse serum/10% FBS/21 mM glucose/26.5 mM bicarbonate/0.01 mg/ml EF. The glial plates were then maintained up to 2-6 weeks with 5% CO2 at 37°C. For mixed neuron-glial cultures, dissociated cortical cells obtained from fetal mice (embryonic day 15) were plated onto the preestablished glial monolayer at a density of 3 hemispheres per 24-well plate in MEM supplemented with 5% horse serum. Proliferation of nonneuronal cells was halted by adding 10 mM cytosine arabinoside at 5 days. Ten days after seeding of cortical cells, cells were transfected with AP4 or Gem with a DNA density of 5 mg per well by using FuGENE 6.i.c.v. Injection into Transgenic Mice.
Male PAHX-AP1 promoter-LacZ ICR mice (1) received i.c.v. injection of pcDNA3-Gem plasmid. Injections were performed by using a Hamilton syringe after the mice were anesthetized with ketamine (200 mg/kg) and xylazine (10 mg/kg). For i.c.v. injection, the skull skin was incised sagittally, and a hole was drilled in the skull 1 mm lateral to the sagittal suture and 2 mm rostral to the coronary suture. The needle was inserted perpendicularly 3 mm deep with a stereotaxic surgical instrument (David Kopf Instruments, Dusseldorf, Germany) to reach the lateral ventricle.RT-PCR and Northern Blot Analyses.
Preparation of total RNA and RT-PCR were performed as described in ref. 1. The sequences of the PCR primers were as follows: PAHX-AP1 (300 bp), 5'-CGTATCTCCTGGGCCATGGA-3' (S), 5'-ACAGTGGGTCCTGGCATGCT-3' (AS); DYRK1A (400 bp) 5'-CCATGTCCAAACCCATCTTC-3' (S), 5'-AACCGTCCCTTTCATACAGC-3' (AS). Northern blot analysis was performed as described in ref. 2. The probes used were the 5' portion of AP4 (1-550), a full-length Gem cDNA (1-630), and a partial PAHX-AP1 cDNA (1-145).Yeast One-Hybrid Screening
and Yeast One-to-One Assay. The Matchmaker One-Hybrid System (Clontech, Palo Alto, CA) was used to screen for PRE-binding cDNA clones. A concatenated probe with six copies of the 52-bp PAHX-AP1 PRE (or BAI1-AP4 PRE: -276/-225 bp, 5'-TCTTGCCCTGGAAGAATGGGGGAAAGGTGGCAGAAGCTACA-GCTGCTGCCTC-3') (1) was subcloned into pHISi and pLacZi vectors (Clontech). The constructs were linearized and stably integrated into the genome of YM4271 and plated onto synthetic dropout-His-Ura plates to establish the dual-construct yeast strain YM4271-pLacZi/PRE6-pHISi/PRE6. Subsequent transformation with a human fetal brain cDNA library (>2 ´ 106 clones) fused to GAL4-AD allowed us to select resistant clones, which were tested by β-galactosidase plate assay, verified, and sequenced.Plasmid-encoding B42-AD fused to the corepressor’s domain, such as SMRT RID, mSin3A PAH1-2, or N-CoR ID, was introduced along with plasmid-encoding LexA fused to Gem into the EGY48 yeast strain by small-scale transformation. Double transformants were assayed for tryptophan prototrophy and for β-galactosidase activity by filter assay.
1. Kim, M. Y., Ahn, K. Y., Lee, S. M., Koh, J. T., Chun, B. J., Bae, C. S., Lee, K. S. & Kim, K. K. (2004) FEBS Lett. 566, 87-94.
2. Lee, Z. H., Kim, H, Ahn, K. Y., Seo, K. H., Kim, J. K., Bae, C. S. & Kim, K. K. (2000) Mol. Brain Res. 75, 237-247.