pEGAD.

pEGAD was constructed in several steps as a derivative of a GFP 
gene containing the Cormack chromophore and Seed/Sheen codon  
optimization (acquired from Clonetech, pEGFP-C1). An (Ala)10 
"flexi-linker" and multiple cloning site locus was added to the 
carboxy terminus of GFP to facilitate construction of cDNA libraries.
The modified GFP gene was inserted into pBasta, a derivative we 
created of the plant transformation vector pBI121 that allows for 
selection of transgenic plants in soil using the herbicide 
gluphosinate (Basta). Details of the construction are presented in
our manuscript.

pEGAD is an approximate 12.5 kB, low copy vector. In E. coli it
confers resistance to Kanamycin.




Sequence diagram of the EGAD Multicloning Site
 

                          (Ala)10 flexi-linker        MCS                           Stops Present
                              |                       |                             in all 3 frames
                              |                       |                             |                                                                                                                    
                BspEI     NotI                        EcoRI SmaI  XhoI  HinDIIIBamHI XbaI*       XhoI                                       
ggacgagctgtacaagTCCGGA GCTGCGGCCGCTGCCGCTGCGGCAGCGGCC GAATTCCCCGGGCTCGAGAAGCTTGGATCCtagataactgatctcgaggagctagctc......nos terminator
EGFP...............Gly AlaAlaAlaAlaAlaAlaAlaAlaAlaAla GluPheProGlyLeuGluLysLeuGlySerSTOP




*XbaI cleavage blocked by overlapping dam methylation. Must grow in dam-strain to cut. Note, XhoI is not unique.