pEGAD. pEGAD was constructed in several steps as a derivative of a GFP gene containing the Cormack chromophore and Seed/Sheen codon optimization (acquired from Clonetech, pEGFP-C1). An (Ala)10 "flexi-linker" and multiple cloning site locus was added to the carboxy terminus of GFP to facilitate construction of cDNA libraries. The modified GFP gene was inserted into pBasta, a derivative we created of the plant transformation vector pBI121 that allows for selection of transgenic plants in soil using the herbicide gluphosinate (Basta). Details of the construction are presented in our manuscript. pEGAD is an approximate 12.5 kB, low copy vector. In E. coli it confers resistance to Kanamycin. Sequence diagram of the EGAD Multicloning Site (Ala)10 flexi-linker MCS Stops Present | | in all 3 frames | | | BspEI NotI EcoRI SmaI XhoI HinDIIIBamHI XbaI* XhoI ggacgagctgtacaagTCCGGA GCTGCGGCCGCTGCCGCTGCGGCAGCGGCC GAATTCCCCGGGCTCGAGAAGCTTGGATCCtagataactgatctcgaggagctagctc......nos terminator EGFP...............Gly AlaAlaAlaAlaAlaAlaAlaAlaAlaAla GluPheProGlyLeuGluLysLeuGlySerSTOP *XbaI cleavage blocked by overlapping dam methylation. Must grow in dam-strain to cut. Note, XhoI is not unique.