Supporting information for Brady (2003) Proc. Natl. Acad. Sci. USA, 10.1073/pnas.1137809100
Table 2. Primers used for both PCR amplification and DNA sequencing of gene fragments
Locus/ Primer | Direction | Sequence 5 ' à 3 ' | Position | Source/ References |
COI* | ||||
CI13 | Forward | ATAATTTTTTTTATAGTTATACC | 1986-2005 | 1 |
CI14 | Reverse | ATTTCTTTTTTTCCTCTTTC | 2596-2571 | 1 |
Jerry | Forward | CAACATTTATTTTGATTTTTTGG | 2484-2506 | 2 |
Ben3R | Reverse | GCWACWACRTAATAKGTATCATG | 2914-2892 | 3 |
18S | ||||
rc18A | Forward | TGGTTGATCCTGCCAGTAG | 5-23 | 4 |
18N | Reverse | CACTCTAATTTKTTCAAAG | 847-829 | 4 |
rc18H | Forward | GCTGAAACTTAAAGGAATTGACGGAAGGGCAC | 1215-1246,§ | 4 |
18L | Reverse | CACCTACGGAAACCTTGTTACGACTT | 1975-1950,§ | |
28S | ||||
28SA | Forward | CCCCCTGAATTTAAGCATAT | 3318-3337 | B. Sullender, Rice University, Houston |
28SC | Reverse | CGGTTTCACGTACTCTTGAA | 3692-3673 | B. Sullender |
Bel28S | Forward | AGAGAGAGTTCAAGAGTACGTG | 3665-3686 | 5 |
revBel28S | Reverse | TTGGTCCGTGTTTCAAGACGGG | 4068-4047 | 5 |
wingless | ||||
wg1 | Forward | GARTGYAARTGYCAYGGYATGTC TGG | n/a¶ | 6 |
wg2 | Reverse | ACTICGCRCACCARTGGAATGTRCA | n/a¶ | 6 |
*COI sequences were not obtained for the following taxa in the divergence dating analysis: Amblyopone australis, Liometopum occidentale, Myrmecia fulvipes, Dorylus helvolus, Aenictus rotundatus, Neivamyrmex nigrescens, N. carettei, N. romandii, N. augustinodis, and N. pilosus.
Position denotes coordinates in the Apis mellifera mitochondrion (7).
Position denotes coordinates in Drosophila melanogaster using the numbering of Tautz et al. (8) as corrected by Linares et al. (9).§
Not used in divergence dating analysis.¶
Amplifies total of 436 nucleotide positions.
1. Hasegawa, E., Tinaut, A. & Ruano, F. (2002) Ann.. Zool. Fenn. 39, 267-271.
2. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. & Flook, P. (1994) Ann.. Entomol. Soc. Am. 87, 651-701.
3. Brady, S. G., Gadau, J. & Ward, P. S. (2000) in Hymenoptera. Evolution, Biodiversity, and Biological Control, eds. Austin, A. D. & Dowton, M. (CSIRO Publishing, Collingwood, Victoria, Australia), pp. 131-139.
4. Wiegmann, B. M., Mitter, C., Regier, J. C., Friedlander, T. P., Wagner, D. M. & Nielsen, E. S. (2000) Mol. Phylogenet. Evol. 15, 242-259.
5. Belshaw, R. & Quicke, D. L. J. (1997) Mol. Phylogenet. Evol. 7, 281-293.
6. Brower, A. V. Z. & DeSalle, R. (1998) Insect Mol. Biol. 7, 73-82.
7. Crozier, R. H. & Crozier, Y. C. (1993) Genetics 133, 97-117.
8. Tautz, D., Hancock, J. M., Webb, D. A., Tautz, C. & Dover, G. A. (1988) Mol. Biol. Evol. 5, 366-376.
9. Linares, A. R., Hancock, J. M. & Dover, G. A. (1991) J. Mol. Biol. 219, 381-390.