Supporting Figures

Files in this Data Supplement:

Fig. 6. Alterations of ESET mRNA in postmortem striatal tissues of HD patients and in the striatum of R6/2 mice at 13 weeks of age. (A) RT-PCR analysis of ESET mRNA levels from postmortem caudate tissues of HD patients and age-matched nonneurological control patients. The fold change of ESET mRNA was normalized to 18S RNA. There was a significant increase of ESET mRNA in HD (*, P < 0.05), as compared with the control group. (B) ESET mRNA levels in WT littermate control and R6/2 mice at 13 weeks of age. While there was no significant change in ESET mRNA levels, combined treatment using mithramycin and cystamine (M/C) down regulated ESET expression in R6/2 mice. M/C administration (i.p. injection) started at 6 weeks of age.

Fig. 7. (A) Sp3 protein levels are increased in R6/2 mice. Western blot analysis confirmed the up-regulation of Sp3 protein in R6/2 brain (n = 8) compared with littermate control mice (n = 5). (B) Sp1 (100 nM) and Sp3 (100 nM) siRNAs decrease ESET promoter activity but not control siRNA (100 nM). Mouse ESET promoter activity was determined in the presence of siRNAs for Sp1 and Sp3 using an ESET reporter construct which included Sp binding elements (-130/+80). The ESET promoter activity was normalized to the total protein concentration. The Sp1 binding elements (bold and italic) are described in 5' flanking region of ESET promoter sequence as follows: (-133) 5'-AATAAATTTGGTCCCTTCGGGCTACCGTCGGAGAGGCCGGAAGGACGCTC CCTATTGCTTCCGGACCGTCGGTTTGCTCC-3' (-62).

Fig. 8. Sp1 and Sp3 results in the induction of ESET luciferase (Luc) activity independently and interdependently. (A) Both Sp1 and Sp3 induce ESET promoter activity independently. (B) Cotransfection of Sp1 additively activates ESET promoter activity, while Sp3 (100 ng) is being constantly transfected. (C) Cotransfection of Sp3 additively activates the ESET promoter activity, while Sp1 (100 ng) is being constantly transfected. Neuroblastoma cells (SH-SY5Y) were transfected with ESET promoter (-150/+80) and Sp1 or Sp3 construct for 48 h. Luciferase activity was normalized to total protein concentration.

Fig. 9. Cystamine modulates ESET promoter activity and trimethylation of histone-H3 (K9). (A) Constant dose of cystamine (500 mM) along with dose escalation of mithramycin shows additive affects in the suppression of ESET luciferase activity by mithramycin, with a dose-dependent suppression. (B) Cystamine treatment decreases the level of TMH-H3 (K9) in a transgenic mouse model of HD. The TMH-H3 (K9) immunoreactivity was markedly increased in the striatal neurons of N171Q82 mice (Center) compared with WT (Left). Cystamine attenuated the TMH-H3 (K9) immunoreactivity in striatal neurons of N171-Q82 mouse (Right).