BLIMP1 regulates cell growth through repression of p53 transcription -- Yan et al. 104 (6): 1841 Data Supplement - HTML Page - index.htslp -- Proceedings of the National Academy of Sciences

Yan et al. 10.1073/pnas.0605562104.

Supporting Information

Files in this Data Supplement:

SI Materials and Methods
SI Figure 6
SI Figure 7
SI Figure 8
SI Figure 9

SI Figure 6

Fig. 6. p53 activates reporter containing the putative p53 binding site of BLIMP1 intron 3. Transfection of p53 in HCT116 p53-/- cells induced a significant and dose-dependent increase in p53wtBLIMP1-luc activity. p53mutBLIMP1-luc or p53wtBLIMP1-luc were cotransfected with p53 in HCT116 p53-/- cells.

SI Figure 7

Fig. 7. Depletion of BLIMP1 induces cell growth defects in HCT116 cells and IMR90 cells. (A) HCT116 cells and IMR90 cells were transfected with control or BLIMP1 siRNAs. The cells were stained with propidium iodide for DNA content and analyzed by FACS. (B) Impaired cell growth in BLIMP1 knockdown IMR-90 cells compared with control cells. LV-control shRNA or LV-BLIMP1 shRNA was introduced in IMR-90 cells by lentiviral infection. Cells were cultured for 10 days and were stained with crystal violet

SI Figure 8

Fig. 8. Restoration of surviving colony numbers of HCT116 cells exposed to both p53 shRNA (LV-p53 shRNA) and BLIMP1 shRNA compared to that of cells with BLIMP1 depletion alone. Cells were split at 24 h after transfection and selected with puromycin for 10 days. Plates were stained with crystal violet.

SI Figure 9

Fig. 9. BLIMP1 directly suppresses p53 transcription by binding to its promoter. (A) Overexpression of BLIMP1 suppressed p53 promoter activity. pLPCX-BLIMP1 or control plamids STAT1 and IRF-7 were transiently co-transfected with pGL3-p53luc into HCT116 cells. STAT1 and IRF-7 had no effect on the p53 promoter. (B) E2F1 ChIP did not show any fold enrichment in p53 promoter region scanned for BLIMP1 ChIP. The known E2F1 binding sites in the promoter region of CDC2 and PCNA genes were amplified as the positive controls for the E2F ChIP assays.

SI Materials and Methods

Promoter Constructs and Luciferase Assays.
To make constructs of p53 wtBLIMP1-Luc and p53mutBLIMP1-luc, two copies of the putative p53 binding site found within the 3^rd intron of BLIMP1 gene and its mutant version were cloned upstream of the luciferase coding sequence in a pGL3 basic vector (Promega). The following oligonucleotide pairs were annealed and cloned into the KpnI and XhoI site. For wild-type binding site: 5'-CGTGCAAGTCTGGACATGTTTACACTGTGCAAGTCTGGACATGTTTC-3' and 5'-TCGAGAAACATGTCCAGACTTGCACAGTGTAAACATGTCCAGACTTGCACGGTCA-3'. For mutant binding site: 5'-CGTGAAAATCTGGATATATTTACACTGTGAAAATCTGGATATATTTC-3' and 5'-TCGAGAAATATATCCAGATTTTCACAGTGTAAATATATCCAGATTTTCACGGTCA-3'.

For luciferase assay, HCT116 cells were seeded in 96-well plates (Costar). In the experiments that p53 transactivates reporter containing BLIMP1 fragments, 100 ng of p53 expression plasmid and 100 ng of reporter containing p53 BS or p53 mut-BS, and 1 ng of plasmid containing Renilla luciferase (pRL-SV40) were cotransfected into p53 -/- HCT116. To test BLIMP1 suppression on p53 promoter, increasing amounts of pLPCX-BLIMP1 expression constructs (25 ng, 50 ng or 100 ng), 100 ng of promoter plasmid (pGL3-p53-Luc), and 1 ng of pRL-SV40 were co-transfected into cells. pRL-SV40 plasmid served as an internal control for normalizing the transfection efficiency. The luciferase activities were measured following the manufacturer's procedures and were normalized against the renilla activity.

RNA Analysis.
Total RNA was isolated using TRIzol Reagent (Invitrogen) and purified with the RNAeasy Mini Kit (Qiagen). cDNA synthesis was performed with the SuperScript II Kit (Invitrogen) according to the manufacturer's instructions. mRNA levels were measured by real-time PCR analysis based on SYBR Green detection with the ABI Prism 7900HT real-time PCR machine. The real-time PCR primers were designed as follows in 5'-3' directions: BLIMP1-for, GACCGGCTACAAGACCCTTCCCTAC; BLIMP1-rev, ATGTGGCTTTTCTCCCGTGTGTACC; p53-for, GAGGGATGTTTGGGAGATGTAAGAAATG; p53-rev, TTCACAGATATGGGCCTTGAAGTTAGAGAA; p21- for, ATTAGCAGCGGAACAAGGAGTCAGACATTT; p21-rev, GGCCAGTATGTTACAGGAGCTGGAAGGT; Puma-for, AGCCAAACGTGACCACTAGC; Puma-rev, GCAGAGCACAGGATTCACAG. FACS.
For FACS analysis, cells were harvested and fixed in 70% ethanol. Fixed cells were stained with propidium iodide (50 mg/ml) after treatment with RNase (100 mg/ml). The stained cells were analyzed for DNA content FACS in a FACSCalibur (Becton Dickinson Instrument, San Jose, CA). Cell cycle fractions were quantified using the CellQuest software (Becton Dickinson). For BrdU incorporation assay, cells were grown in medium containing 10 mM BrdU for 4 h and then fixed in 4% PFA. Cells were stained with FITC-conjugated anti BrdU-antibody (BD PharMingen) and counterstained with Hoechst. Cells presenting normal nuclear Hoechst staining were counted first and were scored for BrdU staining. Transduction with Lentivirus Vectors.
Recombinant lentiviruses were produced by transient transfection of 293T cells according to standard protocols. Briefly, subconfluent 293T cells were cotransfected with 20 mg of a plasmid vector, 15 mg of pCMV-DR8.91, and 5 mg of pMD2G-VSVG using lipofectamine 2000. After 16 h medium was changed, and recombinant lentivirus vectors were harvested 24 h later. Antibodies.
The primary antibodies used included BLIMP1 (NB600-235A1, Novus); p53 (Sc-126, Santa Cruz Biotechnology, Santa Cruz, CA), p21 (Sc-756, Santa Cruz); Actin (MAB1501, Chemicon); Puma (PC686, Calbiochem); PARP (Sc-7150, Santa Cruz); Histone H1 (Sc-10806, Santa Cruz).