Min et al. 10.1073/pnas.0611725104. |
Fig. 5. Alignment of the human E-Syt1 (E1), E-Syt2 (E2), and E-Syt3 (E3) sequences with each other and with the Drosophila (Dm), mosquito (Ag), and Caenorhabditis elegans (Ce) E-Syt sequences. Residues shared by at least half of the sequences are shaded in a domain-specific manner (gray, TMR; blue, juxtamembranous E-syt domain; red, C2-domains). In the C2 domains, the approximate locations of the b-strands are indicated below the sequence. Aspartate, asparagine, and glutamate residues that correspond to residues involved in ligating Ca2+ in synaptotagmin-1 C2 domains are shown in white on a black background. Note that in E-Syt1, the C2A and C2B domains are duplicated (Fig. 1), resulting in a total of five C2 domains in which the C2A-and C2C, and the C2B and C2D domains are equivalent. In the figure, the C2C and C2D domains of E-Syt1 are therefore aligned with the C2A and C2B domains, respectively (E1', E-Syt1 sequences starting with the C2C domain aligned with the C2A domains of the other E-Syts). Sequences are numbered on the right.
Fig. 6. Expression pattern of E-Syts determined by RT-PCR of RNA from human adult tissues. RT-PCR analysis was performed for E-Syt1, E-Syt2, and E-Syt3 by using single-stranded cDNA generated from various human adult tissue RNA samples as indicated (obtained from PrimGen). Although E-Syt1 is expressed ubiquitously, E-Syt2 and E-Syt3 are expressed primarily in cerebellum. GAPDH was used as an RT-PCR control to ensure the integrity of the samples.
Fig. 7. Disruption of the actin or microtubule cytoskeleton does not alter plasma membrane localization of an E-Syt2 C2B/C2C domain fragment. (A) Subcellular fractionation of the E-Syt2 C2B/C2C domain fragment (see Fig. 4A). Transfected HEK293 cells expressing the C2B/C2C domain fragment were treated with DMSO alone or with latrunculin or nocodazole for 24 h, lysed, and separated by centrifugation into a cytosolic fraction, a Triton X-100-solubilized fraction, and a Triton X-100-insoluble fraction. Samples were analyzed by immunoblotting for the E-Syt2 fragment (Upper) and for actin and the actin-binding protein filamin A as a control. (B) Transfected HEK293 cells expressing E-Syt2 C2B/C2C domain fragment were either left untreated or treated for 24 h with DMSO, latrunculin, and nocodazole. Cells were then fixed, permeabilized, and analyzed by staining for E-Syt2 and phalloidin. Note that the latrunculin treatment almost completely abolishes phalloidin staining, demonstrating that actin filaments are severed in these cells. (Scale bar: 5 mm.)
SI Experimental Procedures
RT-PCR Analysis.
The Human Normal Tissue cDNA Panel obtained from PrimGen was used for PCR reaction by several pairs of primers. For E-Syt1 PCR, GCTCACGCAAAGCCAGACCCAG and GAAGGGCCAGACCTGGGCCAC primers, for E-Syt2 PCR, GACCACCAACACTCA GCTCAAG and GCTTGTTTCTCTGCGAGCTG primers, for E-Syt3 PCR, CTCTGTAC CTTCGTGGTGCG and GTCCTCAGGTGGATGCTC primers were used. PCR reaction of GAPDH was used as a loading control.Subcellular Fractionation and drug treatment.
Transfected HEK293 cells were washed with PBS, collected, and homogenized 2 d after transfection. Homogenates were centrifuged at 500 × g for 20 min to obtain a postnuclear supernatant that was centrifuged at 100,000 × g for 1 h to isolate the cytosolic fraction from pellet fraction. The pellet was resuspended with buffer containing 1% Triton X-100 and permeabilized with rocking for 1 h. After permeabilization, it was centrifuged at 100,000 ´ g for 1 h to isolate Triton X-100-soluble fraction from Triton X-100-insoluble fraction. Latrunculin-A (Biomol), Nocodazole (Biomol), and DMSO were applied on the day after the transfection for 24 h before harvest of the cells.