Dotta et al. 10.1073/pnas.0700442104. |
Fig. 6. Phylogeny tree of the identified virus. The observed polyprotein (B4-DQ480420-Tuscany) was aligned with protein sequences from Coxsackie virus strains (Coxsackie A9-Griggs, B3-Nancy, B4-E2, B4-JVB, B5-Faulkner) previously shown to in vitro infect human islets, using the program ClustalW version 1.83 (A). Sequences were analyzed to build a maximum likelihood phylogeny. ML reconstruction was performed using the Jones, Taylor, and Thornton model of substitution at a constant rate of change. In addition, to test the reliability of tree phylogeny we used also MEGA3 software to bootstrap the sequences and we built with the minimum evolution method a consensus tree. The tree topology and branch lengths are highly conserved (B).
Fig. 7. Reactivity to VP-1 enteroviral peptide in human pancreatic islets in vitro infected with the isolated virus. Immunohistochemical analysis shows reactivity to VP-1 enteroviral peptide in human pancreatic islet cells infected in vitro with the isolated virus.
SI Methods
Virus Characterization.
Total RNA was extracted from infected human pancreatic islets from patient 2 (Tuscany isolate) and cDNA synthesis was performed in a 20 ml final volume using total RNA (4.5 mg), 50 pmol of oligo(dT)20, or 50 ng of random hexamers, 1 mM dNTPs and 15U of ThermoScript avian reverse transcriptase (Invitrogen) for 1 h at 50°C. In light of serological data from patient 2, indicating positivity for Coxsackie B2 and Coxsackie B4, nucleotide sequences for Coxsackie B2 (AF081485 and AF085363) and Coxsackie B4 (S76772 and X05690) were aligned by ClustalW and a set of primers was prepared to drive PCR amplification of overlapping fragments of Coxsackie genome (first set; see SI Table 2). 2 ml of cDNA were amplified (50 ml final volume) in the presence of 20 pmol of primer pairs and 2.5 units of Expand High-Fidelity TaqDNA polymerase (Roche) as described by the manufacturer. Amplification cycles were as follows: 94°C-5'; 94°C-30", 50°C-30", 72°-2' (35 cycles); 72°C-7'; 4°C. Overlapping fragments were purified by agarose gel electrophoresis followed by MinElute gel extraction (Qiagen). Amplicons covering a Coxsackie B4 genome region ranging from nt 583 to nt 7395 were successfully obtained and sequenced with the help of an ABI3700 DNA sequence analyzer and BigDye-terminator chemistry. Based on accumulated sequence information a set of additional primers specific for Coxsackie B4 was synthesized (second set; SI Table 2). To retrieve 5'-UTR missing information and to confirm both 3'-UTR sequence and poly(A) insertion site, a set of RACE-PCRs was realized. Two separate reverse transcriptions were realized by using components of 5'/3' RACE Kit (second generation, Roche). For 5'-RACE, 4.5 mg of total RNA were heated at 65°C before to be snap-cooled on ice, then they were retro-transcribed in the presence of C6NR gene-specific primer (reverse, nt.3299-3278, ATAGGGGCCTGTGGTTATCAAG) and 10U of Transcriptor RT (Roche) for 1h at 50°C. cDNA sample was later purified by High Pure PCR Product Purification kit (Roche) and eluted with 50 ml of 10 mM Tris-Hcl ph 8.5 following manufacturer's protocol. 19 ml of purified cDNA sample was then dA-tailed in a final volume of 25 ml with 80U of Terminal Transferase and 2 mM dATP at 37° for 30 min, followed by heat inactivation of the enzyme at 70°C for 10 min. 10 ml of dA-tailed material was amplified through a first round of PCR with 25 pmol each of oligo(dT) anchor (GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV; V = A, C or G) and C3NR nested primer (reverse, GGTGATTGAAAATCATCTGACG) to amplify nt.1 - 1798 of Coxsackie B4 genome. A second nested PCR was subsequently performed on 2% material coming from first round in the presence of 25 pmol each of PCR anchor (GACCACGCGTATCGATGTCGAC) and C1NR nested primer to amplify nt 1-771 of Coxsackie B4 genome. To confirm the exact 3'-UTR sequence and polyadenylation site, 4.5 mg of total RNA were heated at 65°C before to be snap-cooled on ice and then they were retrotranscribed in a total volume of 20 ml with 37.5 pmol of oligo(dT) anchor primer and 10U of Transcriptor RT for 1 h at 50°C, followed by heat inactivation of the enzyme at 70°C for 10 min. cDNA sample was later amplified with 25 pmol each of C11NF (GCATATACGGGGATGCCTAAC) and PCR anchor primers to amplify nt 5295-7395 of the Coxsackie B4 genome. Both 5'- and 3'-RACE PCR amplifications were done over appropriate cDNA samples in a total volume of 100 ml, in the presence of 2.5 mM Mg2+, 200 mM dNTPs mix, 25 pmol each primer, 1 mg of BSA, 3% DMSO and 2.5U of AmpliTaq polymerase (Roche). Amplification cycles were as follows: 95°C -5'; 95°C -30", 50°/55°C -30", 72°C -1' for every kb in size (35 cycles); 72°C -7'; 4°C. PCR fragments were gel purified and directly submitted for sequencing. The entire Coxsackie B4 genome sequence was obtained using a primer walking strategy through overlapping amplicons. After a 4X sequencing coverage effort and check for ambiguities (third set; SI Table 2), a consensus sequence of 7,395 nt (excluding the polyA-tract) was assembled by AutoAssembler (Applied Biosystems) and deposited to the GenBank database (accession no. DQ480420). Coxsackie B4 genome recovered codes for a 2183-aa polyprotein that was aligned by means of ClustalW v.1.83 with homologues from Coxsackie virus strains previously shown to be able to in vitro infect human islets (Coxsackie A9-Griggs, B3-Nancy, B4-E2, B4-JVB, B5-Faulkner). Sequences were analyzed with ProML module of the PHYLIP package version 3.6 (http://evolution.genetics.washington.edu) to build a maximum likelihood phylogeny. ML reconstruction was performed using the Jones, Taylor, and Thornton model of substitution at a constant rate of change. In addition, to test the reliability of tree phylogeny we used also MEGA3 software to bootstrap the sequences and we built with the minimum evolution method a consensus tree.