Alteri et al. 10.1073/pnas.0602304104. |
Fig. 5. SDS/PAGE analysis of purified MTP. Coomassie-stained (A) or Silver-stained (B) MTP. In A and B, lane 1 is molecular mass standards, lane 2 is 10 mg, lane 3 is 100 mg, and lane 4 is 500 mg of purifed MTP. Coomassie- or silver-stained SDS/PAGE was unable to detect any visible protein despite the presence of copious amounts of purified MTP (Fig. 1D) and BCA protein assay total protein determinations as indicated.
Fig. 6. Identification of Rv3312A (designated here as mtp) by tandem mass spectrometry (MS/MS). (A and B) Unique MS/MS fragment ions (A) and derived amino acid sequence (B) produced from MTP acid hydrolysates. (C) Predicted full-length amino acid sequence of the putative Mtp subunit in the M. tuberculosis H37Rv genome, indicating the identified MS/MS fragment (bold underlined sequence) and protein fragment used to generate peptide-specific anti-Mtp antibodies (bold sequence).
Fig. 7. Three-state topology prediction results for Rv3312A. Transmembrane hidden Markov modeling strongly suggests the Rv3312A gene product contains an N-terminal transmembrane domain (amino acids 9-30). The remaining portion of the molecule is predicted to be extracellular (amino acids 31-100). These data are consistent with pilin-associated properties. The blue line indicates the probability of the peptide contained within the membrane, the pink line represents the probability of an extracellular domain. The red lines indicate a transmembrane domain. The identity and location for each of these putative domains in Mtp was >90% probability (y axis). The numbers along the x axis refer to amino acid residue positions.
Fig. 8. Immunodetection of Mtp by using anti-Mtp peptide antibodies. (A) Western blot showing reactivity of purified MTP with anti-Mtp peptide antibody (lane 1) and no reactivity with preimmune serum (lane 2). Mass standards are indicated on the left. (B) Immunoelectron microscopy showing reactivity of anti-Mtp peptide antibody with MTP filaments. No reactivity was seen with preimmune serum (data not shown). Magnification is ×45,000. (C) Purified His6-Mtp protein with an apparent molecular mass of 14.5 kDa (lane 2) reacted with anti-Mtp peptide antibody (lane 3).
Fig. 9. PCR analysis of M. tuberculosis mtp mutants. Genomic DNA isolated from M. tuberculosis H37RvDmtp (lanes 2 and 3) and parental (lanes 4 and 5) and CDC1551Dmtp (lanes 6 and 7) and parental (lanes 8 and 9) strains were used as templates for PCR reactions using mtp-specific primers. PCR products in lanes 2, 4, 6, 8, and 10 were produced by using Rv3312L-f and Rv3312R-r flanking primers, and reactions in lanes 3, 5, 7, 9, and 11 were performed by using Rv3312A gene-specific primers. Lanes 1 and 13 are standards with sizes in base pairs indicated by arrows. Lanes 10 and 11 are ph3312 recombinant mycobacteriophage DNA, and lane 12 is a no-template control using the flanking primers. Note the absence of the 355-bp Rv3312A gene-specific PCR product in the M. tuberculosis mtp mutants (lanes 3 and 7). The allelic exchange is shown by the replacement of Rv3312A with the hyg allele, resulting in a larger PCR product (3.9 kb) in the amplifications from DNA isolated from the mutant strains (lanes 2 and 6) in comparison to the parental strain PCR products using the flanking primers (2.1 kb).
SI Materials and Methods
Biochemical Analysis and Tandem Mass Spectroscopy (MS/MS) of MTP.
SDS/PAGE was performed under reducing and denaturing conditions by using 16% polyacrylamide gels. Quadrupole time-of-flight (QTOF) MS/MS was used to identify the protein composition of the MTP fibers. Dilute acid hydrolysis normally hydrolyzes peptide bonds at either side of Asp and Asn to generate fragments. Ten micrograms of purified MTP was placed in a sealable tube to which 1.1 ml of concentrated HCl (constant boiling quality) was added with 500 ml water. The tube was degassed and nitrogen was added to protect the sample from oxidation. The sealed tube was subjected to boiling at 108°C for 4 h, the material was reconstituted in 10-100 ml of water, and the samples were analyzed by LC-MS/MS using a QTOF2 instrument (Waters, Milford, MA). Masslynx 4.0 was used to generate peaklist (pkl) files from mass spectral data. These pkl files were submitted to in-house MASCOT database searches allowing for 0.8-Da peptide mass tolerance and 0.2-Da fragment mass tolerance.Construction of His-Mtp Protein Fusion.
Recombinant Rv3312A was prepared by amplifying the Rv3312A ORF (from base 3,700,705 to 3,701,016) from M. tuberculosis H37Rv genomic DNA using forward and reverse primers containing NdeI and XhoI restriction sites. The digested PCR product was ligated into pET15b (Novagen) to form the pET-Mtp N-terminal 6XHistidine-tagged expression construct and introduced into E. coli BL21(DE3) pLysS. The His-Mtp fusion protein was induced with 1 mM IPTG and purified over a Nickel-NTA column as recommended by the manufacturer (Qiagen).To generate Rv3312A deletion mutants in M. tuberculosis, PCR was used to amplify 850-bp fragments upstream (left PCR, L) and downstream (right PCR, R) from Rv3312A using primers 3312L-f 5'AAATACTAGTATCGGGTCGCCTTCGAATGC
3312L-r 5'AAATCTCGAGGAGAACTTGCTGATTACTCGCT
3312R-f 5'AAAATACCGGTGCCGTCCGATGACAGAAAAT
3312R-r 5'AAAAATAGGCCTAACAACGCACCGAATAGCCG
and M. tuberculosis H37Rv genomic DNA as template. Flanking arms were directionally cloned into cosmid pYUB854 (31). The cosmid p3312-L+R was introduced into E. coli HB101 by heat shock, extracted, and linearized with PacI. Oligomerized phAE159 DNA was digested with PacI and the allelic exchange substrate was ligated with the PacI digested phasmid. A commercial l packaging extract, GigaPack III XL (Stratagene), was used to in vitro package the ligation mix into l phage heads and introduced into E. coli HB101 following the manufacturer protocol. The phasmid DNA was introduced in M. smegmatis by electroporation and following replicate plating, one temperature sensitive plaque, representing the recombinant mycobacteriophage ph3312, was selected and used to generate high-titer phage lysate. M. tuberculosis cells were prepared for transduction as described (31) and prewarmed high titer phage lysate was added to the cells by gentle pipeting to achieve an MOI of 10. After overnight incubation, the cells were recovered by centrifugation and plated onto 7H11 OADC containing hygromycin and were incubated at 37°C for three weeks to obtain M. tuberculosis H37Rv D3312A::hyg (H37RvDmtp) and homologous CDC 1551 D3413::hyg (CDC1551Dmtp) deletion mutants. As a negative control, mock-infected cells were processed in parallel to determine lack of spontaneous hygromycin resistance. Allelic exchange was confirmed by locus-specific PCR using primers 3312-f 5'ACCGTCATCATATGTACCGGTTCG
and 3312-r 5'CATCGGCTCGAGAGCGTAAATCTG.
31. Bardarov S, Bardarov S, Jr, Pavelka MS, Jr, Sambandamurthy V, Larsen M, Tufariello J, Chan J, Hatfull G, Jacobs WR, Jr (2002) Microbiology 148:3007-3017.