Bone morphogenetic protein signaling regulates the size of hair follicles and modulates the expression of cell cycle-associated genes -- Sharov et al. 103 (48): 18166 Data Supplement - HTML Page - index.htslp -- Proceedings of the National Academy of Sciences

Sharov et al. 10.1073/pnas.0608899103.

Supporting Information

Files in this Data Supplement:

Supporting Figure 5
Supporting Figure 6
Supporting Table 1
Supporting Table 2
Supporting Table 3
Supporting Table 4

Supporting Figure 5

Fig. 5. Morphometric parameters of distinct hair follicle types in wild-type and transgenic mice. Cryosections of anagen VI skin of 12-week-old WT and TG mice were processed for immunostaining with antibody against GATA3 (D and E), P-cadherin (J-L) or BrdU (M) or with DAPI (F-I), and histomorphometric analyses were performed (A-C, and M). Statistical analyses were performed using Student's t test. (A-C) Graph and images showing that in contrast to small anagen VI HFs in WT mice, hair cortex in intermediate HFs of TG mice (demarcated from the hair medulla by dotted line) displays significantly increased number of cells (A, P < 0.01) and thickness (D and E, arrowheads). Thickness and cellularity of the GATA3-positive inner root sheath show no differences between WT and TG mice (D and E, arrows). (B, C, F-I) Graph and images demonstrating lack of differences in size and cell number in the follicular papillae (arrows) between small anagen VI HFs in WT and intermediate HFs of TG mice (B, C, F, and G). Cell number in the follicular papillae (arrows) of large HFs in WT and TG mice is substantially higher, compared to small and medium-sized HFs (B, C, H, and I). (J-L) Lack of differences in size of postmitotic hair matrix keratinocytes (K and L, arrows) between small HFs of WT mice and intermediate HFs of TG mice. (M) Significant increase (P < 0.05) in number of BrdU+ cells in intermediate HFs of WT and TG mice, compared to small HFs in WT mice. FP, follicular papilla; IRS, inner root sheath; HC, hair cortex; HM, hair medulla.

Supporting Figure 6

Fig. 6. Molecular analyses of anagen hair follicles from WT and K5-Noggin mice. Anagen VI skin of 12 week-old WT and TG mice was harvested, and cryosections were processed for laser capture microdissection, RNA isolation and amplification, microarray and real-time PCR analyses (A), for immunohistochemistry and in situ hybridization (B-E). (A) Real-time PCR of the house keeping genes (GAPDH, Rpl13A, Ppia), hair matrix-specific genes (Msx2, Hoxc13, GATA3) and follicular papilla-specific genes (Fgf7, Fgf10, Alp2) in RNA samples prior and after two rounds of amplification. (B) Increase of Sostdc1 mRNA expression of in the hair matrix (arrows), inner and outer root sheath (arrowheads) in intermediate HFs of WT and TG mice, vs. small HFs and WT mice. (C) Lack of Krox20 expression in intermediate HFs of WT and TG mice (arrows). Expression of Krox20 in the outer and inner root sheaths is seen in all HF types (arrowheads). (D) Expression of Shh in cluster of hair matrix cells of all HF types (arrows). (E) Decrease of Wif1 in the follicular papilla of intermediate HFs in WT and TG mice (arrows) vs. small HFs in WT mice.

Table 1. Genes differentially expressed in the hair matrix of intermediate hair follicles of K5-Noggin mice vs. small or intermediate hair follicles of wild-type mice

Gene/Function	Gene Symbol	Accession Number	TG Intermediate Vs WT Small	TG Intermediate Vs WT Intermediate
Adhesion/Extracellular Matrix
Ankyrin 3, epithelial	Ank3	NM_170730	↑1.1	↑4.0
Calcium dependent, carbohydrate recognition domain) lectin, superfamily member 12	Clecsf12	NM_020008	↓1.1	↑10.7
Claudin 10
Decorin	Cldn10	NM_021386	↓2.0	↓2.3
Desmoglein 2	Dcn	NM_007833	↓2.2	↓1.6
Four and a half LIM domains 1	Dsg2	BC034056	↑1.4	↑5.0
Immunoglobulin-like receptor PIRB5	Fhl1	NM_010211	↑6.9	↑4.2
Protocadherin beta 21	Lilrb3	NM_011095	↑3.8	↑3.7
	Pcdhb21	NM_053146	↑1.1	↑4.6
Cell cycle
Cyclin A2	Ccna2	NM_009828	↑3.7*	↑1.5*
Cyclin D1	Ccnd1	NM_007631	↑3.1*	↑1.4*
Cyclin H	Ccnh	NM_023243	↑2.8*	↑1.8*
Cyclin E2	Ccne2	AF091432	↑2.2*	↑1.3*
Cyclin-dependent kinase inhibitor 1A (p21Cip1)	Cdkn1a	NM_007669	↓2.3*	↓1.1*
Cyclin-dependent kinase inhibitor 1B (p27Kip1)	Cdkn1b	NM_009875	↓10.4*	↓2.9*
Cytoskeleton/Cell Differentiation
Actin-binding LIM protein 2	Ablim2	NM_177678	↓1.9	↑4.6
Coronin, actin binding protein 1A	Coro1a	NM_009898	↑1.1	↑4.5
Crystallin, beta A4	Cryba4	NM_021351	↑2.0	↓1.6
Keratin associated protein 6-1	Krtap6-1	D86421	↓2.0	↓2.0
Keratin associated protein 6-2	Krtap6-2	NM_010673	↓1.7	↓3.5
Keratin associated protein 8-2	Krtap8-2	NM_010676	↓2.3*	↓2.4*
Keratin associated protein 16.4	Krtap16-4	AF345294	↓2.5*	↓2.0*
Keratin associated protein 16-5	Krtap16-5	NM_130857	↓2.3	↓2.1
Keratin-associated protein 16.6	Krtap16.6	AF345296	↓1.8	↓3.3
Keratin complex 1, acidic, gene 2	Krt1-2	NM_010665	↑2.7	↑1.9
Keratin complex 1, acidic, gene 10	Krt1-10	NM_010660	↑2.9	↑1.6
Keratin complex 2, basic, gene 1	Krt2-1	NM_008473	↑2.1*	↑1.0*
Keratin complex 2, gene 20 (Type II hair keratin)	Krt2-20	AY028606	↑2.1*	↑2.3*
Loricrin	Lor	NM_008508	↑2.3	↑1.2
Microtubule-associated protein 7	Mtap7	BC052637	↑1.1	↑5.4
Nestin	Nes	NM_016701	↓1.3	↑3.5
Small proline-rich protein 1A	Sprr1a	NM_009264	↑3.2*	↑1.0*
Small proline-rich like 7	Sprrl7	NM_027137	↑2.9	↑1.0
Metabolism
Adenylosuccinate synthetase like 1	Adssl1	NM_007421	↑4.9	↑2.6
Amine oxidase, copper containing 3 (Aoc3)	Aoc3	NM_009675	↑3.3	↑2.0
Apolipoprotein C-I	Apoc1	NM_007469	↓1.2	↓6.7
ATPase, H+ transporting, V1 subunit C, isoform 2	Atp6v1c2	NM_133699	↑3.9	↑2.5
Carbohydrate sulfotransferase 3	Chst3	NM_016803	↑1.1	↑4.9
Carbonic anhydrase 6	Car6	NM_009802	↑4.1	↑1.1
Cytochrome c oxidase, subunit VI a, polypeptide 2	Cox6a2	NM_009943	↑3.4	↑1.2
Cytochrome P450, family 2, subfamily f, 2	Cyp2f2	NM_007817	↑3.9	↑1.6
Dehydrogenase/reductase (SDR family) member 7	Dhrs7	BC016189	↑2.1	↑1.0
Malate dehydrogenase 1, NAD (soluble)	Mdh1	NM_008618	↑1.1	↑3.7
Lipoprotein lipase	Lpl	NM_008509	↑2.8	↑4.9
Phosphoglycerate kinase 1	Pgk1	NM_008828	↑1.5	↑5.5
Phosphatidylinositol 4-kinase type 2 beta	Pi4k2b	NM_028744	↓1.2	↑4.9
Pleckstrin homology-like domain, family B, member 2	Phldb2	NM_153412	↓1.1	↑3.6
Pleckstrin homology, Sec7 coiled-coil domains 3
Proline dehydrogenase	Pscd3	NM_011182	↓1.2	↑8.3
Retinol dehydrogenase 5	Prodh	NM_011172	↑1.1	↓3.3
Solute carrier organic anion transporter family, member 4a1	Rdh5	NM_134006	↓1.5	↓3.4
	Slco4a1	NM_148933	↓2.0	↓2.0
Proteolysis
Cathepsin L	Ctsl	NM_009984	↑2.1	↑2.1
Cystatin N homolog	Cst6	N28197	↑5.3	↑1.2
Cysteine proteinase inhibitor (MS1)		M92417	↑2.0	↑4.3
Serine proteinase inhibitor, clade B, member 1a	Serpinb1a	NM_025429	↑2.2	↑3.4
Serine proteinase inhibitor, clade A, member 5	Serpina5	NM_172953	↓2.0	↑3.9
Serine proteinase inhibitor, clade B, member 6b	Serpinb6b	NM_011454	↓1.1	↑3.7
Ubiquitin specific protease 33	Usp33	BC031366	↓1.2	↑6.2
Signaling				↑2.3
Annexin A8	Anxa8	NM_013473	↑4.7	↓4.0
Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A	Cidea	NM_007702	↑5.8
Cdk5 and Abl enzyme substrate 1				↓5.0
Cholinergic receptor nicotinic, epsilon polypeptide	Cables1	NM_010112	↓1.4	↓1.9
Coagulation factor XIII, alpha subunit	Efs	NM_022021	↓2.1	↑2.4
Colony stimulating factor 2 receptor, beta 2	F13a1	NM_028784	↑3.4	↑3.6
EGF-like-domain, multiple 4	Csf2rb2	NM_007781	↓1.5	↑1.4
Ephrin B1	Egfl4	BC036727	↓2.1	↓6.3
Fyn-associated substrate	Efnb1	NM_010110	↓2.1	↓4.8
Growth factor receptor bound protein 7	Chrne	NM_009603	↑1.2	↓3.1
Janus kinase 2	Grb7	NM_010346	↓1.3	↑3.8
Metallothionein 4	Jak2	NM_008413	↑1.3	↓2.0
Mitogen activated protein kinase 13	Mt4	NM_008631	↑4.1	↓3.3
Muskelin 1	Mapk13	NM_011950	↑1.1	↑2.6
Myeloid leukemia factor 1	Mkln1	BB154892	↓2.0	↑2.6
Olfactory receptor 1221	Mlf1	NM_010801	↑2.5*	↓2.0
Patched homolog 2	Olfr1221	NM_146902	↓2.5	↓1.3
Potassium large conductance calcium-activated channel, subfamily M, beta member 4	Ptch2	NM_008958	↑2.4*	↓3.6
Programmed cell death 1	Kcnmb4	NM_021452	↓2.1
RAB1, member RAS oncogene family				↑3.8
RAS p21 protein activator 4	Pdcd1	NM_008798	↓1.3	↑3.4
Ras homolog gene family, member T1	Rab1	NM_008996	↓1.3	↑7.2
SPARC related modular calcium binding 2	Rasa4	BC057460	↓1.3	↑3.5
Transforming growth factor, beta induced (Tgfbi)	Rhot1	NM_021536	↓1.1	↓3.9
Tumor necrosis factor receptor superfamily, member 25	Smoc2	NM_022315	↓1.3	↑2.0
	Tgfbi	NM_009369	↑3.4	↓3.6
	Tnfrsf25	NM_033042	↓1.7
Transcription
Btg3 associated nuclear protein	Banp	NM_016812	↓2.5	↓3.6
Distal-less homeobox 2	Dlx2	NM_010054	↓3.5*	↓3.4
Early growth response 2 (Krox-20)	Egr2	X06746	↓6.4*	↓4.8*
Ets2 repressor factor	Erf	NM_010155	↓1.8	↓3.1
Forkhead box C1	Foxc1	NM_008592	↑2.0*	↑1.1
GATA binding protein 2	Gata2	NM_008090	↑1.5	↑3.2
GATA binding protein 3	Gata3	NM_008091	↑2.0*	↓2.7
Homeo box, msh-like 2	Msx2	NM_013601	↓2.0*	↓2.2
Iroquois related homeobox 4	Irx4	NM_018885	↓2.0*	↓2.8
LIM homeobox protein 9	Lhx9	NM_010714	↓1.2	↑5.8
Nucleoplasmin 3	Npm3	NM_008723	↓1.4	↓3.6
Odd Oz/ten-m homolog 4	Odz4	NM_011858	↓2.2	↓2.4
Paired related homeobox 1	Prrx1	NM_011127	↓1.1	↑3.4
POU domain, class 2, associating factor 1	Pou2af1	NM_011136	↑1.1	↑5.0
POU domain, class 5, transcription factor 1	Pou5f1	NM_013633	↑2.0*	↓1.5
Trans-acting transcription factor 3	Sp3	NM_011450	↓1.1	↑3.5
Zinc finger transcription factor Gli5	Glis1	AF220434	↓1.3	↑3.9
Zinc finger protein 296	Zfp296	NM_022409	↓1.3	↓3.7

Significant increases or decreases of expression are shown by red or blue colors, respectively. Differences in expression validated by real-time PCR are shown by asterisks.

Table 2. Genes differentially expressed in the follicular papilla of K5-Noggin mice vs. wild-type mice

Gene/Function	Gene Symbol	Accession Number	TG Intermediate Vs WT Small	TG Intermediate Vs WT Intermediate
Adhesion/Extracellular Matrix
Blood vessel epicardial substance	Bves	NM_024285	↓5.2	↓5.0
CD164 sialomucin-like 1	Cd248	NM_054042	↑2.0	↓1.1
Chondrolectin	Chodl	NM_139134	↑3.0	↑3.9
Matrilin 2	Matn2	NM_016762	↑2.9	↑1.7
Contactin 1	Cntn1	NM_007727	↑2.5	↑3.9
Microfibrillar-associated protein 4	Mfap4	BC022666	↑2.3	↓1.1
Nidogen 2	Nid2	NM_008695	↑2.1	↑1.1
Periostin	Postn	NM_015784	↑3.0	↑5.7
Phosphacan short isoform	Ptprz1	AJ428208	↓1.2	↑3.7
Procollagen, type XIII, alpha 1	Col13a1	NM_007731	↓2.4	↓2.3
SPARC-like 1 (mast9, hevin)	Sparcl1	NM_010097	↑2.6	↑1.1
Vascular cell adhesion molecule 1	Vcam1	NM_011693	↓2.8	↓3.7
Cytoskeleton/Cell Motility
Desmuslin	Dmn	BC026872	↓2.4	↓3.6
Kinesin family member 5B	Kif5b	NM_008448	↓1.1	↑6.8
Myosin, heavy polypeptide 2, skeletal muscle	Myh2	NM_144961	↓2.9	↓16.3
Myosin, light polypeptide 3	Myl3	NM_010859	↓2.2	↓2.4
Troponin C2, fast	Tnnc2	NM_009394	↓1.8	↓6.4
Tubulin, beta 4	Tubb4	NM_009451	↑4.9	↑5.5
Metabolism
Acyl-CoA synthetase long-chain family member 1	Acsl1	NM_007981	↑3.8	↑5.0
Adipose differentiation related protein	Adfp	NM_007408	↑2.3	↑1.9
Apolipoprotein B editing complex 2	Apobec2	NM_009694	↓2.6	↓5.2
Cytochrome b-245, beta polypeptide	Cybb	NM_007807	↑3.3	↓1.1
Cytochrome P450, family 1, subfamily b, polypeptide 1	Cyp1b1	NM_009994	↓2.5	↓1.4
Cytochrome P450, family 2, subfamily g, polypeptide 1
Cytochrome P450, family 2, subfamily f, polypeptide 2	Cyp2g1	NM_013809	↑2.7	↑1.6
Diacylglycerol O-acyltransferase 2
ELOVL family member 6, elongation of long chain fatty acids	Cyp2f2	NM_007817	↑3.1	↑2.9
Elongation of very long chain fatty acids-like 3
Enolase 3, beta muscle	Dgat2	NM_026384	↑3.4	↑3.2
FXYD domain-containing ion transport regulator 4	Elovl6	NM_130450	↑3.0	↑4.8
Glycine amidinotransferase
Glycogen synthase 2	Elovl3	NM_007703	↑2.4	↑3.2
Glucan (1,4-alpha-), branching enzyme 1	Eno3	NM_007933	↓3.1	↓3.8
Lipoprotein lipase	Fxyd4	NM_033648	↑2.5	↑1.6
Low density lipoprotein receptor-related protein 4	Gatm	NM_025961	↑1.1	↑8.6
Mannose receptor, C type 1	Gys2	BC021322	↑7.6	↑14.9
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	Gbe1	NM_028803	↑2.3	↑2.2
Phosphatidylinositol 4-kinase type 2 beta	Lpl	NM_008509	↑2.9	↑5.5
Sialyltransferase 7	Lrp4	NM_172668	↓2.0	↑1.1
Sialyltransferase 10	Mrc1	NM_008625	↑5.7	↑16.1
Sterol O-acyltransferase 2	Pfkfb3	NM_133232	↑2.9	↑3.9
Transketolase
	Pi4k2b	NM_028744	↓1.1	↑10.9
	St6galnac5	NM_012028	↓2.0	↓7.9
	Siat10	NM_018784	↓1.5	↓3.8
	Soat2	NM_146064	↑3.2	↑3.5
	Tkt	NM_009388	↑2.3	↑1.7
Neural/Neural Crest
Glia maturation factor, beta	Gmfb	NM_022023	↑1.4	↑3.4
S100 protein, beta polypeptide, neural	S100b	NM_009115	↑3.1	↓2.4
S100 calcium binding protein A16	S100a16	BC020031	↓1.1	↑6.8
Proteolysis
Carboxypeptidase A3, mast cell	Cpa3	NM_007753	↑5.0	↑5.0
Cathepsin S	Ctss	NM_021281	↑2.6	↑6.0
Extracellular proteinase inhibitor	Expi	NM_007969	↑4.7	↓1.3
Mast cell protease 4	Mcpt4	NM_010779	↑4.8	↑3.4
Mast cell protease 5 (serine proteinase)	Mcpt5	M73760	↑3.9	↑11.7
Serine (or cysteine) proteinase inhibitor, clade B, member 1a	Serpinb1a	NM_025429	↑2.3	↑3.8
Signaling
Activin A receptor, type IC	Acvr1c	C230097P10	↑3.3	↑1.4
Adipocyte, C1Q and collagen domain containing	Adipoq	NM_009605	↑2.2	↑1.5
Chitinase 3-like 1	Chi3l1	BC005611	↓6.4	↓1.1
Chordin-like 1	Chrdl1	BC066832	↑2.6	↑6.8
Deiodinase, iodothyronine, type II	Dio2	NM_009892	↓2.8	↓1.5
Endothelin 3	Edn3	NM_007903	↓2.1	↑6.0
Fibroblast growth factor 21	Fgf21	NM_020013	↓1.3	↑23.3
Follistatin-like 1	Fstl1	NM_008047	↓2.2	↓2.0
Growth differentiation factor 1	Gdf1	NM_008107	↓1.1	↓3.9
Growth hormone receptor	Ghr	NM_010284	↑2.4	↑2.4
Lysozyme	Lyzs	NM_017372	↑2.7	↑4.3
Noggin	Nog	NM_008711	↑2.9	↑2.9
Patched homolog 2	Ptch2	A730013M03	↓2.8	↓2.9
Phosphatidic acid phosphatase type 2B	Ppap2b	NM_080555	↑2.2	↑1.3
Potassium channel, subfamily K, member 7	Kcnk7	NM_010609	↑1.2	↑5.6
Receptor calcitonin activity modifying protein 2	Ramp2	D930029B10	↑2.1	↑1.1
Resistin like alpha	Retnla	NM_020509	↑7.2	↑16.9
Secreted frizzled-related sequence protein 2	Sfrp2	NM_009144	↑1.8	↓3.9
Small chemokine (C-C motif) ligand 11	Ccl11	NM_011330	↑2.4	↑9.2
Suppressor of cytokine signaling 3	Socs3	NM_007707	↓1.1	↓3.5
Thrombospondin 4	Thbs4	NM_011582	↑2.5	↓1.1
Thyroid hormone responsive SPOT14 homolog	Thrsp	NM_009381	↑3.8	↑2.5
Wnt inhibitory factor 1	Wif1	NM_011915	↓2.5*	↓1.5
Transcription
Lymphoid enhancer binding factor 1	Lef1	NM_010703	↓2.3*	↓4.6

Significant increases or decreases of expression are shown by red or blue colors, respectively. Differences in expression validated by real-time PCR are shown by asterisks.

Table 3. List of PCR primers

Accession Number	Sequence Definition	Sense/Anti-sense Primers
NM_007431	Alkaline phosphatase 2 (Akp2)	TGAGCGACACGGACAAGAAG
		AGTTGTTGTGAGCGTAATCTACC
NM_007560	Bone morphogenetic protein receptor, type 1B (Bmpr1b)	CATGCTGGACTTGGCTTC AGTGTGATGAATCTGGTTGG
NM_009828	Cyclin A2 (Ccna2)	CCTGCCTTCACTCATTGC
		TTTCCCGTATTGACTGTTGG
NM_007631	Cyclin D1 (Ccnd1)	TGAGGGAAGAGGTGAAGG
		TACAAAGCAATGAGAATCTGG
AF091432	Cyclin E2 (Ccne2)	AAGTGTGAGTCCAGTGAAGC
		CTCTTTGGTGGTGTCATAATGC
NM_023243	Cyclin H (Ccnh)	CCAGGTCTGACGAGGTTGC
		GCTGCGGTCATTTATTATGGTTAG
NM_007669	Cyclin-dependent kinase inhibitor 1A, (P21) (Cdkn1a)	CCCATTTCTTAGTAGCAGTTG
		CCAGACCAGGATGTTACAG
NM_009875	Cyclin-dependent kinase inhibitor 1B (P27) (Cdkn1b)	AGCCATCACACCTGTAGC
		TAGAGTCTTATGGTTGCTTGG
NM_009876	Cyclin-dependent kinase inhibitor 1C (P57) (Cdkn1c)	GCGGACGATGGAAGAACTC
		GACCAGCGTACTCCTTGC
NM_145592	Dickkopf homolog 4 (Dkk4)	GGGACAGGAGGGAGAAAG
		CTCGTAGAACTGGCTTGC
NM_010054	Distal-less homeobox 2 (Dlx2)	GCTCTCCCAACTCTTCCC
		CACTGGCAATGGATGAAGG
X06746	Early growth response 2, Krox20 (Egr2)	GTTGGGAGTTGCTGATTC TCCATTCACTGCTCTAGG
NM_010099	Ectodysplasin-A (Eda)	TTATGCGTCTTCTAGTGGATG
		CTGCTGAGTCTGGAGGTG
NM_008007	Fibroblast growth factor 3 (Fgf3)	ATAGCATCCTGGAGATTAC
		TAGTGATCCGAAGCATAC
NM_008008	Fibroblast growth factor 7 (Fgf7)	AGGAGTAGCAATCAACGCAAG
		AGACAGACGAGGTGGAAGC
NM_008002	Fibroblast growth factor 10 (Fgf10)	GGAGAGAGGAGATTCTTCTTCAC
		CCGTGGCTAACACACTTCAG
NM_008005	Fibroblast growth factor 18 (Fgf18)	CTTCCAGGTTCAGGTGTTG
		GCTTCCGACTCACATCATC
NM_023304	Fibroblast growth factor 22 (Fgf22)	GTGTACTCAGGCTTCTATG
		AACCTACAGTCCACAGAG
NM_008592	Forkhead box C1 (Foxc1)	CTGAGTTGGCACATGAACAAATAC
		ACACATAGGCTGATCTCCATCTG
NM_008238	Forkhead box N1 (Foxn1)	CACCAGCAGCCATTGTTC
		ATAGCATCCAGGTCAGTCC
NM_021457	Frizzled homolog 1 (Drosophila) (Fzd1)	GCGGTGGACTGACGGATG
		AGACAGGAGCACACAAGATGG
NM_175284	Frizzled homolog 10 (Drosophila) (Fzd10)	GTGAGGAGGAGAGGGGATAAAAG
		GCGTGGGCTCTGTGTTGG
NM_008057	Frizzled homolog 7 (Drosophila) (Fzd7)	TTCAAGACATAACGCTCACATTAG
		TGACTCAAACTCTCCTCTTCCTTC
NM_008091	GATA binding protein 3 (Gata3)	AGCCACATCTCTCCCTTC
		CCCACAAAGAACACCAAAGAGAGG
NM_008109	Growth differentiation factor 5 (Gdf5)	ACCTTCATTTCTCTCCAGACTCT CCTGCCCAAGCCCTTTCC
NM_145741	Growth differentiation factor 10 (Gdf10)	AATATGTCCGTAGAGACCTGTG AACTGAAGAATTGCGATGTGG
NM_013601	Homeo box, msh-like 2 (Msx2)	GTCTGCCCTTCCCTATCAACTC
		GTCTGGTCCATCTGGTCTTCC
AF193796	Homeodomain protein (Hoxc13)	AGTTCTTGCCTCTTCCTGTG
		ACCTTGCCTATGGAGTTCAG
NM_010512	Insulin-like growth factor 1 (Igf1)	TCCAGTTGCTCTAAGTTTCTCTC
		AAGTGTTAGGAAAGGGTGTGTC
NM_010514	Insulin-like growth factor 2 (Igf2)	GGATAGAGATGTGAGAGTAGAC
		TGAGGAGTGGGCAAGATG
NM_008343	Insulin-like growth factor binding protein 3 (Igfbp3)	AGCCTAAGCACCTACCTC
		TGGATGGAACTTGGAATCG
NM_010518	Insulin-like growth factor binding protein 5 (Igfbp5)	AACATCCTCACCATCATTCTCC
		TCTTCTCCTTGGCTCACTCC
NM_008344	Insulin-like growth factor binding protein 6 (Igfbp6)	TTGCCAGTGTCTCCAGATG
		AGTTATTCATTGCTTCACATACAG
NM_008048	Insulin-like growth factor binding protein 7 (Igfbp7)	ACGCTGGAGAGTATGAGTG
		GTCTGAGAGCACCTTTAGC
NM_023670	Insulin-like growth factor 2 binding protein 3 (Igf2bp3)	GCCAGCGAGTCAAGGTAG TGAACAAAGCAACAAGAACAAC
NM_010513	Insulin-like growth factor I receptor (Igf1r)	ACAATCTATTCACAAGCCTCCTG
		CAGTTAAGGGTTCGGGTAAAGG
NM_018885	Iroquois related homeobox 4 (Drosophila) (Irx4)	ATGTTGCGTCCACCTGAG
		CCAGAAGGAGAAGCGACAC
NM_018826	Iroquois related homeobox 5 (Drosophila) (Irx5)	CCTTCGGACATCTTCACG ACATACCTTTCTTCAACTCATAG
NM_130857	Keratin associated protein 16-5 (Krtap16-5)	CGTGTTCAGTTGGCTTAG CTGGATATGGAGGCTATGG
NM_010676	Keratin associated protein 8-2 (Krtap8-2)	ACCATAACTACCAGTCTTGACACC
		CCACAGCCACAGCCATAGC
NM_010665	Keratin complex 1, acidic, gene 2 (Krt1-2)	TGACCACAATCCTGAGACCAA
		CCAGAAACACCACCAAAGAGA
NM_033373	Keratin complex 1, acidic, gene 23 (Krt1-23)	TGGTTCAGAGAGCAGTCAG
		GAGACGGCAGGAGTATCG
NM_010666	Keratin complex-1, acidic, gene C29 (Krt1-c29)	TCGTGGAAGAGTTAGACC
		TTAGAGGCGGAGTTCAAG
NM_013598	Kit ligand, SCF (Kitl)	AAGTAGGCAGTTAGGTGTAGTTG
		TGGCATAAGGGCTCACTCC
NM_010703	Lymphoid enhancer binding factor 1 (Lef1)	GCCAGCCACCGCCGATTC
		GGCGGCGTTGGACAGATC
NM_010801	Myeloid leukemia factor 1 (Mlf1)	ATGGCGAAGATTCCTTAACTC
		GTGGTTCATCTCCTACTTTGG
NM_008958	Patched homolog 2 (Ptch2)	CGGGAACTGCTAGATAAGGC
		TCATCAGGGTCCAGACAGG
NM_008907	Peptidylprolyl isomerase A (Ppia)	ATGAACATTGTGGAAGCC
		AGAGATTACAGGACATTGC
NM_008960	Phosphatase and tensin homolog (Pten)	TTTGAAGACCATAACCCACCACAG
		ACACCAGTCCGTCCCTTTCC
NM_013633	POU domain, class 5, transcription factor 1 (Pou5f1)	CCGTGTGAGGTGGAGTCTGGAG
		GCGATGTGAGTGATCTGCTGTAGG
NM_009438	Ribosomal protein L13a (Rpl13a)	GTGGTCCCTGCTGCTCTC
		CTGCTTCTTCTTCCGATAGTGC
NM_025312	Sclerostin domain containing 1 (Sostdc1)	AACGAGTCCAGCCACAAC CAAGTGAGGAAAGAGCAATGG
NM_009264	Small proline-rich protein 1A (Sprr1a)	GCTGAGGCTGCTGTCTATC
		CTTGAAGATGAGGATGAGAGTC
NM_009170	Sonic hedgehog (Shh)	CATTCCTCTCCTGCTATGCTCCTG
		ATGACAAAGTGGCGGTTACAAAGC
NM_009518	Wingless related MMTV integration site 10a (Wnt10a)	TACAATCACCAGACAGTC
		GGAAGAAGAGATGACAGG
NM_011718	Wingless related MMTV integration site 10b (Wnt10b)	AGCGTCTTCTCTACCTACAG
		ACACAATGCCTGCTATTATCC
NM_009521	Wingless-related MMTV integration site 3 (Wnt3)	AAGAGGCAAGCAGCGAATG
		AGCAGACCCTAGACAGAAGC
NM_009523	Wingless-related MMTV integration site 4 (Wnt4)	CGCTAAAGGAGAAGTTTGAC
		CATCTGTATGTGGCTTGAAC
NM_009524	Wingless-related MMTV integration site 5A (Wnt5a)	CCACGAATACCAGGAAGCAAGC
		CCCACAAAGAACACCAAAGAGAGG
NM_011915	Wnt inhibitory factor 1 (Wif1)	CCACCTGAATCCAATTACATC
		TGAACAGCATTTGAACATCC

Table 4. List of primary antibodies

Anigen	Host	Dilution	Manufacturer
BrdU	Mouse	1:50	BD Pharmingen, Franklin Lakes, NJ
GATA-3	Mouse	1:100	Santa Cruz Biotechnology, Inc. Santa Cruz, CA
Ki-67	Rat	1:1000	Dako Denmark, Glostrup, Denmark
Krox20	Goat	1:100	R&D Systems Inc., Minneapolis, MN
p27 (Kip1)	Rabbit	1:1000 (Tyramide amplification)	Zymed Lab, South San Francisco, CA
pSmad1/5	Rabbit	1:1000 (Tyramide amplification)	Chemicon International Inc., Temecula, CA
Shh	Goat	1:1000 (Tyramide amplification)	R&D Systems Inc., Minneapolis, MN
Wif-1	Goat	1:1000 (Tyramide amplification)	R&D Systems Inc., Minneapolis, MN