The tobacco rattle virus (TRV)-based virus-induced gene silencing (VIGS) vectors pTRV1 and pTRV2 (1) were obtained from S. P. Dinesh-Kumar (Yale University, New Haven, CT). The manipulated vector (pTRV2) contains either a part of the target gene cDNA or a control cDNA inserted into a multiple cloning site (MCS). Agrobacteria containing either pTRV1 or -2 are coinfiltrated into cotyledons. After an initial infection and systemic spreading stage, the viral mRNA including the target gene mRNA along with any endogenous mRNA with sequence homology will be degraded by posttranscriptional gene silencing. This results in a reduction-of-function phenotype for endogenous genes with homology to the cDNA cloned into pTRV2 (1). For cosilencing of MPK1/2, a 578 bp fragment of the MPK1 (accession AY261512; nucleotides 123-700) ORF was PCR-amplified (forward primer: GGCGCGAGCTCCATGGTGGCAGGTTCATTC; reverse primer: CGGCGCTCGAGGCTCAGGTGGACGATACCAT; primers contain XhoI and SacI restriction sites). This MPK1 fragment is 91% identical to MPK2 (GenBank accession no. AY261513) at the nucleotide level and has seven identical stretches that are more than 21 nt in length, the longest comprising 77 nt. Exact nucleotide identity of at least 21-23 nucleotides is the minimal requirement for efficient posttranscriptional gene silencing (2). The sequence did not contain stretches of ³16 nt that are identical to MPK3. The PCR fragment was inserted into the XhoI-SacI site within the multiple cloning site of the pTRV2 vector. To specifically silence MPK1, 201 bp of the 3'UTR was PCR-amplified (forward primer: GGCCGTCTAGAATAATTGCTGACAGATTGTT; reverse primer: CGCGCGGA TCCCATTTCAGTCTAAAATAAAA) and cloned into the XbaI-BamHI site of pTRV2. Similarly, a 228 bp 3'UTR fragment of MPK2 (forward primer: GGCCGTCTAGAGTACTCGCTCGTTTGCTGTTG; reverse primer: CGCGCGGATCCAGCAGAAAAAAATTCATTTC) and a 406-bp 3'UTR fragment of MPK3 (accession AY261514) (forward primer: GGCCGTCTAGAGCATAAGAGAAATCAGTTCTTC; reverse primer: CGCGCGGATCCACACCCAAAACTTCAAAATGAC) were inserted into pTRV2. For the control vector a 350-bp fragment of GFP was amplified from vector pBIN-mGFP-ER (3) (forward primer: TATGGTACCGAGAGGGTGAAGGTGATGC; reverse primer: ATGAGCTCCCTGCCATGATGTATAACATTGTG) and cloned into the KpnI-SacI site of pTRV2. For silencing of PDS, the pTRV2-PDS vector was provided by S. P. Dinesh-Kumar (1). All constructs were confirmed by sequencing and then transformed to A. tumefaciens strain GV 3101. All primer sequences are given in 5' to 3' orientation.

. RNA isolation from leaves and reverse transcription were described (4). PCR cycle conditions were 95°C for 1 min, followed by 35 cycles of 15 s at 95°C, 30 s at 56°C, and 45 s at 72°C, and a final extension of 7 min at 72°C. Five-microliter aliquots were collected at two or three cycle intervals as indicated in the text. PCR products were separated by agarose gel electrophoresis followed by ethidium bromide staining. "No-RT" controls demonstrated the absence of genomic DNA contamination. Actin transcript levels were used as internal controls for normalization. The following sets of primers were used for sqRT-PCR to analyze silenced plants. They amplified sequences outside the target sequence in the pTRV2 vector. For analysis of MPK1/2-cosilenced plants, primers which amplify parts of the 3'UTR of MPK1 (forward GCTGACAGATTGTTGCAGGT; reverse TCCACCCCATAAAGATACATCA; 172 bp) and MPK2 (forward TACTCGCTCGTTTGCTGTTG; reverse TTGGAGTACAGGAAAACAATGG; 170 bp) were used. To assess transcript levels of MPKs in experiments that target only one specific MPK, the following primers were used. MPK1: forward TGCACCTCCGGTCAACAA; reverse GGCAGTGCTCCTCAGATAAA; MPK2: forward GGAGAAAAGAGGGAAAATTTGA; reverse GGCAATGTTCTTCTGATAAT; MPK3 forward CTAAATTTCTATCAATAATGGTTGATGC; reverse GCGGAGGAATCACATCTCTT. To determine the expression levels of wound response genes by sqRT-PCR, the following primers were used. LeAOS2 (GenBank accession no. AF230371): forward GCAACGAAGGATCCGAAAAT, reverse ACTGGCCGATAGTGACAGTG, 344 bp long; LeLoxD (GenBank accession no. U37840): forward CCGTGGTTGACACATTATCG, reverse ACAGCAGTCCGCCCTATTTA, 344 bp long; LeAOC (GenBank accession no. AJ272026): forward GCACCTCAACAGATTCAACTAACACTG, reverse GTAATTTTCAGTGCGGCCCCTTCC, 533 bp long; LePI-I (GenBank accession no. K03290): forward TGAAACTCTCATGGCACGAA, reverse TTTTGACATATTGTGGCTGCTT, 331 bp long; LePI-II (GenBank accession no. K03291): forward CCCACGTTCAGAAGGAAGTC, reverse TTTTGGGCAATCCAGAAGAT, 361 bp long; LeACTIN (GenBank accession no. U60478): forward ATGACTCAAATCATGTTTGAGACCTTC, reverse ACCTTAATCTTCATGCTGCTTGGAGC, 631 bp long. The band intensities in the linear range of amplification were quantified using ImageQuant version 5.2 software (Molecular Dynamics, Sunnyvale, CA). For this, the band intensities were first normalized with respect to actin mRNA levels in control plants. The normalized band intensity in silenced plants was expressed as percentage of mRNA levels in control plants.

Volatiles eluted from a SuperQ matrix (Alltech Associates, State College, PA) were analyzed by GC-MS using electron impact ionization (EI) in selective ion mode. Briefly, an HP 5890 gas chromatograph equipped with a split/splitless injector (splitless mode, injection volume 1 ml) was interfaced to an VG-70S magnet sector mass spectrometer (Waters Corp, Milford, MA). Compounds were separated on an Restek RTx-5 (30 m in length, 0.25-mm ID, 0.2-mm film) column preheated to 80°C. After injection, the temperature was increased at 10°C/min to 130°C, then 3°C/min to 180°C, and finally 10°C/min to 300°C, and held at 300°C for 10min. Helium was used as the carrier gas at 10 psi. Specific EI conditions were 70 eV, selection monitoring at 4,000 resolution. Retention time for the JA (224.1412) transisomer was 18.35 min, for the cis-isomer 19.35 min, for the dhJA (226.1569) transisomer 18.44 min, and 19.36 min for the cis-isomer.

The internal standard dhJA was prepared from dihydro methyl jasmonate (a kind gift from Bedoukian Research, Danbury, CT) by alkaline hydrolysis according to Dathe et al. (5).

Leaves of 4-week old pTRV-MPK1/2-infiltrated 35S::prosys plants (var. MicroTom) or pTRV-GFP-infiltrated 35S::prosys control plants were excised at the petiole. Leaflets were weighed (»0.5 g for each sample) and then incubated for 2 hr at 27°C under bright light in a sealed Petri dish featuring a septum. Five-hundred-microliter air samples were collected from the Petri dish with an airtight syringe at 1 and 2 hr after excision and immediately injected into a gas chromatograph [Shimadzu GC-8A, column: Porapak T 80/100 (Altech), 180 ´0.31 ´ 0.085 cm; N2 Carrier gas] equipped with a flame ionization detector. Ethylene eluted with a retention time of 0.91 min which was verified with an authentic standard of ethylene (National Welders, Charlotte, NC).

1. Liu Y, Schiff M, Dinesh-Kumar SP (2002) Plant J 31:777-786.

2. Burch-Smith TM, Anderson JC, Martin GB, Dinesh-Kumar SP (2004) Plant J 39:734-746.

3. Haseloff J, Siemering KR, Prasher DC, Hodge S (1997) Proc Natl Acad Sci USA 94:2122-2127.

4. Higgins R, Lockwood T, Holley S, Yalamanchili R, Stratmann J (2007) Planta 225:1535-1546.

5. Dathe W, Rönsch H, Preiss A, Schade W, Sembdner G, Schreiber K (1981) Planta 153:530-535.