Supporting Information

Files in this Data Supplement:

Fig. 11. SOX9 regulates MITF, DCT, and TYR promoters. B16 cells were transfected with the indicated pMITF, pDCT, or pTYR constructs or pGL2 basic (0.3 mg), pCMVbgal (0.05 mg), and an expression vector encoding SOX9 (0.1 mg) or siRNA of SOX9 (100 nM). Luciferase activities were normalized against the b-galactivity, and the results are expressed as fold stimulation of the basal luciferase activity from cells transfected with an empty expression vector or siRNA mock depending on the experiments. Histograms show quantification of the data with the means ± SD of three independent experiments performed in duplicate. (A) Cells were cotransfected with SOX9 cDNA or empty expression vector with or without treatment with 20 mM forskolin (FSK) for 4 h. Overexpression of SOX9, and treatment with forskolin to a lesser extent, induced a strong activation of the MITF, DCT, and TYR promoters. (B) Cells were transfected with siRNA SOX9 or siRNA mock with or without treatment with 20 mM forskolin for 4 h. After the silencing of SOX9, the activity of the MITF, DCT, and TYR promoters was decreased and failed to be fully stimulated by forskolin.

Fig. 12. SOX9 does not regulate the CRE promoter. B16 cells were transfected with pCRE construct (0.3 mg), pCMVbgal (0.05 mg), and an expression vector encoding SOX9 (0.1 mg) or siRNA of SOX9 (100 nM). Luciferase activities were normalized against the b-gal activity, and the results are expressed as fold stimulation of the basal luciferase activity from cells transfected with an empty expression vector or siRNA mock depending on the experiments. Histograms show quantification of the data with the means ± SD of three independent experiments performed in duplicate. Silencing or overexpression of SOX9 had no effect on CRE promoter activity whereas forskolin (20 mM for 24 h) induced a strong activation.

Fig. 13. CRE and SOX9 binding sites are both required to activate MITF. (Left) A schematic representation of pMITF wt (wild-type), pMITF -873, pMITF -873 DSOX, pMITF -217, and pMITF DCRE. B16 cells were transfected with the indicated pMITF constructs (0.3 mg), pCMVbgal (0.05 mg), and an expression vector encoding SOX9 (0.1 mg). Luciferase activities were normalized against the b-gal activity, and the results are expressed as fold stimulation of the basal luciferase activity from cells transfected with an empty expression vector. Histograms show quantification of the data with the means ±SD of three independent experiments performed in duplicate.

SI Materials and Methods

Neonatal and adult human foreskin melanocytes (a-LP, n-LP, n-MP, and n-DP) were obtained from Cascade Biologics (Portland, OR). B16/F10 melanoma cells and HeLa cells were obtained from the ATCC (Manassas, VA). Cultured melanocytes were grown in melanocyte growth medium consisting of Medium 254 and human melanocyte growth supplement (both from Cascade Biologics). Melanocytes from the third to ninth passage were used in these experiments. B16 cells were grown at 37°C under 5% CO₂ in DMEM supplemented with 7% FBS and penicillin (100 units/ml) and streptomycin (50 mg/ml). HeLa cells were grown at 37°C under 5% CO₂ in DMEM supplemented with 10% FBS and penicillin (100 units/ml) and streptomycin (50 mg/ml). Forskolin (20 mM), aMSH (100 nM), and H89 (5 mM) were purchased from Sigma-Aldrich (St. Louis, MO). Recombinant ASP was purified from fresh culture supernatants of insect cell culture infected with a baculovirus construct that contained the mouse cDNA (Eukaryotic Expression Group, NCI, Frederick, MD). The purification protocol is based on ion-exchange chromatography and size-exclusion chromatography (Protein Purification Group, NCI, Frederick, MD).

The Sox9 cDNA was purchased from the ATCC and after amplification was ligated into the pcDNA3.1 vector (Invitrogen). The constructs were confirmed by sequence analysis. As a negative control, the pcDNA3.1 vector with no insertion was used. Transfection was performed for melanocytes uptake using lipofection with Lipofectamine 2000 (Invitrogen). Cells were seeded 1 day in advance and were transfected according to the manufacturer's instructions. For the study of the effects of SOX9 overexpression on SOX10, DCT, and tyrosinase protein expression and production of melanin, the transfection was done with the Amaxa system (Gaithersburg, MD) according to the manufacturer's instructions. The on-target plus SMARTpool (Dharmacon, Lafayette, CO) SiRNA for human SOX9 was used to silence SOX9 expression. A commercial negative control sequence (Invitrogen) was used to monitor for nonspecific effects.

Transfections for silencing experiments were performed with oligofectamine (Invitrogen). The amount of DNA used for each transfection was 2 mg per 1 ´ 10⁶ cells, whereas SiRNA was used at 100 nM. After 24 to 48 h, depending on experimental protocol, the transfected cells were harvested for various analyses including Western blotting.

Total RNA was reverse-transcribed using SuperScript III (Invitrogen). PCRs consisted of 25 cycles for b-actin and 35 cycles for SOX9 using TaqDNA polymerase (Invitrogen). PCR products for b-actin and SOX9 were 838 bp, and 288 bp, respectively, and were electrophoresed in parallel with DNA molecular mass markers (Invitrogen). Oligonucleotide primers used for PCR were based on mRNA sequences as follows: human SOX9 sense primer 5'- GGGAAGGCCGCCCAGGGCGA -3'; human SOX9 antisense primer 5'- TGCCTTGCCCGACTGCAGTTCT -3', b-actin sense primer 5'- ATCTGGCACCACACCTTCTACAATGAGCTGCG -3'; b-actin antisense primer 5'- CGTCATACTCCTGCTTGCTGATCCACATCTGC -3'. Each experiment was repeated at least in triplicate independently.

Cultures in 100-mm dishes were solubilized in 500-ml M-PERmammalian protein extraction reagent (Pierce Biotechnology, Rockford, IL) and Protease Inhibitor mixture (Roche, Mannheim, Germany). Protein concentrations of extracts were measured using the bicinchoninic acid protein assay kit (Pierce, Rockford, IL). Cell extracts (20 mg) were separated on 8-16% gradient SDS polyacrylamide gels (Invitrogen). After electrophoresis, proteins were transferred electrophoretically from the gels to Invitrolon PVDF transfer membranes (Invitrogen). The filters were incubated with antibodies to SOX9 (rabbit 1:500; Abcam, Cambridge, U.K.), SOX10 (goat 1:200; Santa Cruz Biotechnology, Santa Cruz, CA), DCT (1:2,000; ref.1), Tyrosinase (rabbit 1:10,000; ref. 1), or GAPDH (rabbit 1:10,000; Santa Cruz Biotechnology) for 1 h at 23°C to overnight at 4°C (depending on the antibody) and then were incubated with horseradish peroxidase-linked anti-rabbit, anti-mouse, or anti-goat whole antibodies (at 1:1,0000; GE Healthcare) at room temperature for 1 h. Antigens were detected using ECL-plus Western Blotting Detection System (GE Healthcare). Blots were quantitated using Scion Image Software (Scion, Frederick, MD). Each experiment was performed at least in triplicate.

Melanocyte cultures in two-well Lab-Tek chamber slides (Nalge Nune International Corp., Naperville, IL) were processed for indirect fluorescence to detect the expression of proteins using primary antibodies to SOX9 (rabbit 1:50, Abcam), MITF-ab3 (mouse 1:100 dilution; NeoMarkers, Fremont, CA), DCT (rabbit 1:7,500; ref. 1), and tyrosinase (rabbit 1:700; ref. 1). Bound antibodies were visualized with appropriate secondary antibodies, Alexa Fluor 488 goat anti-rabbit IgG (H+L) (Molecular Probes, Eugene, OR), Alexa Fluor 594 mouse anti-rabbit IgG (H+L) (Molecular Probes), Alexa Fluor 488 goat anti-mouse IgG (H+L) (Molecular Probes), or Alexa Fluor 594 goat anti-mouse IgG (H+L) (Molecular Probes) at 37°C for 30 min at 1: 500 dilution with 5% goat serum. DAPI (Vector) was used as a counterstain. The green fluorescence produced by Alexa 488, red produced by Alexa 594, and blue by DAPI were observed and captured using a Leica DMR B/D MLD fluorescence microscope (Leica, Wetzlar, Germany) and a Dage-MTI 3CCD 3-chip color video camera (Dage-MTI, Michigan City, IN).

Skin specimens obtained from the dorsal areas were taken from healthy volunteers after informed consent. The expression of proteins of interest was detected by indirect immunofluorescence with the following as primary antibodies: SOX9 (rabbit 1:50; Abcam) and MART1 Ab-3 (mouse 1:100 dilution; NeoMarkers). Bound antibodies were visualized with appropriate secondary antibodies, and fluorescence was observed and analyzed with a fluorescence microscope as detailed above.

Oligonucleotide probes specific for human SOX9 were designed. Target sites were selected based on the analysis of sequence matches and mismatches BLAST (GenBank). Probes showed no evidence of crossreaction with sequences of other genes including other SOX family genes. Best results were obtained with the following probes: sense primer 5'-CATACGATTTAGGTGACACTATAG-gggcaggcggaggcagagga-3'; antisense primer 5'-GCGCGTAATACGACTCACTATAGGG-gctgctcagctcgccgatgtcc-3'. The probes were 3' tailed with digoxigenin-11-dUTP with a DIG RNA labeling kit (Roche, Basel, Switzerland), according to recommendations of the manufacturer. TISH was carried out as described previously with minor modifications (2). Briefly, after deparaffinization and rehydration, skin sections were immersed in antigen retrieval solution and heated in a microwave for 12 min then cooled for 20 min. Slides then were washed in glycine solution (2 mg/ml in PBS) for 10 min then washed twice in PBS, and placed in 200 ml of acetylation buffer (0.1 M triethylamine, pH 8.0, containing 0.25% acetic anhydride) for 15 min. After washing in 4´ SSC for 10 min, samples were incubated in prehybridization solution (2´ SSC, 50% deionized formamide) for 1 h at 47°C. After overnight hybridization at 47°C, samples were placed in hybridization solution (3) containing 10 ml of purified DIG-labeled antisense riboprobe. Samples then were incubated in 10 mM Tris-HCl, 0.5 M NaCl, and 0.25 mM EDTA (TNE) buffer, treated with RNaseA for 30 min, and returned to TNE buffer for 3 min, all at 37°C. After washing in 0.1´ SSC for 15 min at 47°C, samples were blocked for 30 min and incubated with anti-DIG/HRP conjugate (DAKO, Carpinteria, CA) for 40 min at room temperature. For detection, we used the tyramide signal amplification system (GenePoint kit, DAKO) and VIP solution (Vector Laboratories) according to the manufacturers' instructions. Samples were observed and photographed in a Leica DMRB microscope. For double staining protocols to detect melanocytes, the experiment was stopped before fixation, and a standard immunohistochemistry was done as described above, starting with the primary antibody incubation.

1. Virador V, Matsunaga N, Matsunaga J, Valencia J, Oldham RJ, Kameyama K, Peck GL, Ferrans VJ, Vieira WD, Abdel-Malek ZA, et al. (2001) Pigment Cell Res 14:289-297.

2. Valencia JC, Watabe H, Chi A, Rouzaud F, Chen KG, Vieira WD, Takahashi K, Yamaguchi Y, Berens W, Nagashima K, et al. (2006) J Cell Sci 119:1080-1091.

3. Mutsuga N, Shahar T, Verbalis JG, Brownstein MJ, Xiang CC, Bonner RF, Gainer H (2004) J Neurosci 24:7174-7185.