Brosnan et al. 10.1073/pnas.0706701104. |
Fig. 6. Phenotypes of the WT GFP target and WT S2 silencer plant lines photographed under blue light. S2 expressed a hairpin RNA homologous to nucleotides 9-400 of the GFP coding sequence, referred to as GF, plus an intact, albeit silenced, GFP transgene (see SI Fig. 10).
Fig. 7. (a) Bisulfite sequencing showing percent cytosine methylation in WT S2 plants and in WT target scions grafted onto WT S2 rootstocks. (b) Southern analysis of HpaII-digested DNA. High-molecular-weight fragments in WT S2 are indicative of methylated DNA, whereas unmethylated fragments (531 bp) were predominantly seen in WT target and WT target scions. M, size marker; H, HpaII sites in the schematic representation of GFP. Southern blotting was performed with »3 mg of DNA digested with HpaII. Digested DNA was separated on a 1.4% agarose gel and blotted to a nylon membrane in 10´ SSC. Prehybridization, hybridization, probe labeling, and washes were carried out as described for Northern blots in the paper.
Fig. 8. (a) Phenotype of WT target scions grafted onto WT S3 rootstocks. (b) Small RNA analysis from WT silencers S1 and S3, and from WT target scions grafted onto WT S3 rootstocks, probed with G sequences. (c) Small RNA analysis from WT silencer S3, and from WT target scions grafted onto WT S3 rootstocks, probed with FP and 3′ ocs sequences. S1 expressed a hairpin RNA homologous to nucleotides 9-400 (GF), whereas S3 expressed a hairpin RNA homologous to nucleotides 300-700 of the GFP coding sequence, referred to as FP (see SI Fig. 10). G refers to nucleotides 1-300 of GFP.
Fig. 9. (a) Small RNA from wild-type S2 and dcl3 S2 plants probed with full-length GFP. (b) Phenotypes of wild-type target scions grafted onto WT S2 and dcl3 S2 rootstocks.
Fig. 10. T-DNA regions of binary vectors used to produce target and silencer transgenic Arabidopsis lines. pUQC214 was used to produce target plant lines expressing GFP. pUQC218 was used to produce S2 silencer lines expressing a GF-specific dsRNA (RNAi) transgene and a functional, albeit silenced, GFP transgene. pUQC251 was used to produce S1 silencer lines expressing the same GF-specific dsRNA (RNAi) transgene but without a GFP transgene. pUQC868 was used to produce S3 silencer lines expressing the FP-specific dsRNA (RNAi) transgene also without a GFP transgene. pUQC1081 was used to produce the BAR S2 silencer line expressing BAR-specific siRNAs. LB, T-DNA left border; RB, T-DNA right border; 35S, Cauliflower Mosaic Virus 35S promoter; ocs, octopine synthase 3′ terminator; BAR, confers resistance to the herbicide phosphinothricin; NPTII, confers resistance to kanamycin.
Fig. 11. (a) Quantitative real-time PCR analysis of BAR transcript levels in WT nongrafted and WT GFP-silenced scions grafted onto WT S2 rootstocks. (b) BAR siRNA analysis of WT nongrafted and WT GFP-silenced scions grafted onto WT S2 rootstocks, and positive control line (BAR S2; see pUQC1081 in SI Fig. 10) expressing BAR-specific dsRNA and siRNAs. The positive control was diluted 10- and 100-fold compared with the other small RNA samples.
Fig. 12. Phenotype of nrpd1b (pol IV1b) target scions grafted onto WT S2 rootstocks.
Fig. 13. Alignment of P-specific 5′-RACE products. The bold, underlined G in italic represents the 400th nucleotide of GFP and the final nucleotide of the GF-specific sequence that was used to construct the GF-specific dsRNA (RNAi) transgene. Sequence analysis of 10 5′-RACE products showed that five started at 52 nt, and the other five started at 37, 40, 49, 58, and 79 nt, into the P sequence of GFP.
Table 1. Frequency of methylated cytosines in bisulfite-treated GFP DNA extracted from ungrafted and grafted Arabidopsis plants
DNA source | |||
CpG | CpNpG | CpHpH† | |
GF (99 nt containing 9 CpGs, 6 CpNpGs, and 14 CpHpHs) | |||
S2 silencer | 72/81 (89%) | 22/54 (41%) | 21/126 (17%) |
Silenced scion | 0/90 (0%) | 0/60 (0%) | 0/140 (0%) |
P (267 nt containing 22 CpGs, 23 CpNpGs, and 49 CpHpHs) | |||
S2 silencer | 166/198 (84%) | 107/207 (51%) | 14/441 (3%) |
Silenced scion | 3/220 (1%) | 0/230 (0%) | 1/490 (0%) |
The number of methylated cytosines of the total number of cytosines analyzed from 9 or 10 clones is listed (and as a percentage in brackets). All plants used were wild type. Bisulfite sequencing was performed as described by Jacobsen et al. (1), using the primers GFPbis-F and GFPbis-R, and AtSN1bisF2, and AtSN1bisR1 (SI Table 3). H = A, C, or T. CpGpG sites were counted as CpG and not CpNpG. Nine, 10, 9, and 10 bisulfite-treated clones were sequenced to generate the data for the GF S2 silencer, GF silenced scion, P S2 silencer, P silenced scion, respectively.
1. Jacobsen SE, Sakai H, Finnegan EJ, Cao XF, Meyerowitz EM (2000) Curr Biol 10:179-186.
Table 2. GFP silencing in grafted WT and mutant Arabidopsis plants
Scion | Rootstock | Total no. of grafts | No. of scions showing silencing | No. of scions showing no silencing |
WT GFP | WT S1 or S2 | 95 | 95 | 0 |
dcl3 GFP* | WT S2 | 7 | 0 | 7 |
nrpd1a GFP† | WT S2 | 32 | 0 | 32 |
rdr2 GFP† | WT S2 | 21 | 0 | 21 |
ago4 GFP† | WT S2 | 13 | 8‡ | 5 |
rdr6 GFP* | WT S2 | 5 | 0 | 5 |
nrpd1b GFP* | WT S2 | 8 | 8 | 0 |
WT GFP | dcl3 S2† | 30 | 30 | 0 |
WT GFP | nrpd1a S2† | 17 | 17 | 0 |
WT GFP | rdr2 S2† | 20 | 20 | 0 |
WT GFP | rdr6 S2* | 7 | 7 | 0 |
WT GFP | dcl1-8 S2* | 8 | 8 | 0 |
WT GFP | WT nontransformed | 6 | 0 | 6 |
Scions were scored for GFP expression up to the stage of flowering.
*Homozygous mutant F2 segregants were used from crosses between mutant and WT target lines; the same S2 or GFP transgenic line was used to generate all the F2 segregants used for the experiments reported in the table, and WT F2 segregants were used as positive controls.
†
Homozygous mutant T2 (scion) or T1 (rootstock) produced by transformation with the target or silencer transgenes; scion numbers represent data from two independent transgenic lines, and each rootstock represents an independent transgenic line.
‡
Most of these ago4 scions showed delayed silencing.
Table 3. DNA oligonucleotides used in this study
Oligonucleotide | |
DCL3-F* | GGCTTCAAGTGTTGGGAAAA |
DCL3-R* | GTTGCACACCATTGAGCATT |
APHA1* | CTATGACTGGGCACAACAGACAATCGGCTGC |
APHA2* | ATACCGTAAAGCACGAGGAAGCGG |
SDE1-F† | ATATCGAGTGCTCATATCTCC |
SDE1-R† | TTGGAGAGCTCAACTTCTGG |
DCL4-5′8300F‡ | GCAGGTTCTTGGTGACTTGGTAGAATCC |
DCL4-5′9200R‡ | CAGGTGGCCTGGTCCTTCCTCTTCAC |
LB-p161pw‡ | CGCTGCGGACATCTACATTTTTG |
GFPs65tNcoI | ATCCATGGTGAGCAAGGGCGA |
GFPs65tBamHI | |
GF5′ClaIKpnI | GTATCGATGGTACCCAAGGGCGAGGAGCT |
GF3′BamHIEcoRI | CAGGATCCGAATTCCCTCCTTGAAGTCGAT |
BAR5′ClaIKpnI | GGATCGATGGTACCATGAGCCCAGAACGACGCCC |
BAR3′BamHIEcoRI | GGGGATCCGAATTCTGTGCCTCCAGGGACTTCAG |
OCS-R | GGTAAGGATCTGAGCTACACATGCTCAGG |
RLM-Race outer | GCTGATGGCGATGAATGAACACTG |
RLM-Race inner | CGCGGATCCGAACACTGCGTTGCTGGCTTTGATG |
GFP330-F | GGACGGCAACATCCTGGGG |
GFPjunc-F | |
GFPjunc-R | |
GFPsiRNA1 | |
GFPsiRNA2 | |
GFP250-F | |
GFPbisF1 | TYTTYTTYAAGGAYGAYGGYAAYTAYAAGA |
GFPbisR1 | TTACTTRTACARCTCRTCCATRCCRARART |
*Genotyping of the dcl3 mutant was performed using the oligonucleotides DCL3-F and DCL3-R, flanking the T-DNA insertion. No fragment was amplified from alkali-treated template (1) of plants homozygous for the T-DNA insertion in DCL3. The dcl3 T-DNA insertion allele was detected using primers specific for the NPTII sequence (APHA1 and APHA2) in the SALK T-DNA.
†
A codominant PCR test for rdr6 (sde1) involved StyI digestion of PCR products produced with the oligonucleotide primers SDE1-F and SDE1-R.‡
Genotyping of the dcl4 mutant was performed using the oligonucleotides DCL4-5′-8300F and DCL4-5′-9200R, flanking the T-DNA insertion. No fragment was amplified from plants homozygous for the T-DNA insertion in DCL4. The dcl4 T-DNA insertion allele was detected using DCL4-5′-8300F and a primer specific for the LB of the T-DNA called LB-p161pw.1. Klimyuk VI, Carroll BJ, Thomas CM, Jones JD (1993) Plant J 3:493-494.