Lacy-Hulbert et al. 10.1073/pnas.0707421104. |
Fig. 7. Conditional deletion of av integrins. (a) Targeting strategy for generation of av-flox mice, showing genomic Itgav locus (i), targeting vector (ii) and genomic locus following homologous recombination (iii). Cre-mediated recombination was used to remove the neomycin selection cassette to produce the final floxed allele (iv), from which av-flox mice were generated. After Cre-mediated recombination in vivo, the deleted allele was generated (v). The probe used for Southern blot analysis of targeted alleles is indicated in red, as are the lengths of the fragments containing the probe sequence following digestion with BamHI and BglII. Also shown (blue arrows) are the primers used for PCR analysis of deletion (primers 1f/rev for the PCR in Fig. 13 a and primers 2f/rev for Fig. 1d). (b) Southern blot analysis of genomic DNA from wild type (+/+), and av-flox heterozygous (fl/+) and homozygous (fl/fl) mice, digested with BamHI and BglII and hybridized to the probe indicated in a.
Fig. 8. Normal angiogenesis in av-tie2 mice. (a and b) Brain surface blood vessels revealed by LacZ staining of av-tie2 or control mice, also carrying the LacZ Cre reporter construct. Similar patterns of staining were seen in two independent experiments. (c-f) Retinal angiogenesis in control and av-tie2 pups at P5, revealed by staining with TRITC-conjugated lectin, viewed by fluorescence microscopy at ´5 (c and d) and ´10 (e and f) magnification. Similar patterns of staining were seen in three control and three av-tie2 mice.
Fig. 9. Normal Immune Development in av-tie2 Mice. FACS analysis of leukocytes in 6-week-old av-tie2 and littermate control mice. (a and b) Thymocytes stained with antibodies for CD4 and CD8, and gated to determine frequencies of CD4 or CD8 single-positive (CD4+, CD8+ respectively), double-positive (DP) and double-negative (DN) populations. (c and d) Splenocytes and lymph node cells stained with antibodies to CD3, CD4 and CD8 and gated to determine frequencies of CD4 and CD8 single-positive CD3+ T cells. (e and f) Bone marrow cells stained with antibodies to B220 and CD21 and gated by forward/ side scatter to detect B cell precursors (B220+ CD21+ cells). (g) Splenocytes and lymph node cells stained with antibodies to IgM and IgD and gated to determine frequencies of IgDhi IgMlow and IgMhi IgDlow populations. (i and j) Bone marrow and blood cells stained with antibodies to Gr1 and CD11b (aMb2 integrin) and gated to determine frequencies of neutrophils (Gr1high CD11b+, PMN) and monocytes (Gr1low CD11b+, mono). In all cases, FACS plots are representative of four mice, and numbers are percentages of cells that fall within indicated gates. Graphs show mean ± SEM for four control (open bars) and av-tie2 (filled bars) mice. In no case were the av-tie2 mice significantly different from control mice (P < 0.01, Student's t test).
Fig. 10. Colon tumors and inflammation in other organs in av-tie2 mice. (a and b) Outgrowth of colon (outlined by white dashed line) (a) and histology of tumor (b) from av-tie2 mice (40 weeks of age) showing invasion of epithelium into muscular wall and peritoneum. (c) Occlusion of the nasal cavity by inflammatory cells and breaching of the epithelial wall in 20-week-old av-tie2 mice. Inflammation in the airways was associated with noisy breathing in av-tie2 mice and occurred episodically. Some evidence of nasal inflammation was seen in »40% of mice >20 weeks of age. Areas marked by squares in Upper are shown at higher magnification in Lower. (d) Omentum of 20-week-old av-tie2 mice has smaller fat cells, larger leukocyte aggregates and increased numbers of leukocytes.
Fig. 11. Immune activation in av-tie2 mice. (a) T cell activation in lymphoid organs of av-tie2 mice. Isolated lymphocytes were stained for CD4, CD44 and L-selectin and analyzed by FACS. Graphs show proportion of CD4+ cells that are activated (CD44high L-selectinlow) and are mean ±SEM., n ³ 3 mice per group. (b) mRNA expression of cytokines in colons of av-tie2 and control mice at 6 weeks of age measured by real time PCR. Cytokine gene expression was normalized to the housekeeping gene GAPDH and expressed relative to control mice, mean ± SEM, n = 6 mice. (c) Levels of cytokine protein in colon from av-tie2 and control mice at 6 weeks of age measured by using cytokine bead array. Data are expressed relative to control mice, mean ± SEM, n = 3 mice.
Fig. 12. Expression of av on immune cells of av-conditional knockout mice. (a) av expression on Thymic T cells (gated on TCR-a+ cells) and Spleen B cells (gated on B220+ cells) from controls (blue filled histogram), relevant T and B cell conditional knockout mice (red line), and control cells stained with isotype-control antibody (gray filled histogram). Histograms show loss of av-surface staining from conditional knockout mice. (b) Southern blot analysis of av-deletion in sorted spleen T cells (Lck-CRE) or B cells (CD19-CRE) from mice carrying indicated av and CRE alleles. Note deletion efficiency of 50-70% for Lck-CRE and 100% for CD19-CRE. (c) FACS analysis of av expression on indicated macrophage and DC populations from control (blue filled histograms), av-tie2 (gray filled histograms), and av-LysM (red line) mice. Numbers represent percentages of av+ cells (av-tie2/av-LysM/control), assayed from staining with isotype control antibody (data not shown). Data are from histograms shown, and are representative of cells from at least three mice per group. (d) Southern blot analysis of av-deletion in cultured bone-marrow-derived macrophages from av-LysM mice, controls (carrying one av-floxed and one av-wild-type allele, with the LysM-CRE allele) and av-tie2 mice. Note »50% deletion in av-LysM mice and controls and 100% deletion in av-tie2 mice.
Fig. 13. av integrins and phagocytosis of apoptotic cells. (a) PCR (using primers 1f and rev) of floxed and deleted av alleles from genomic DNA of av-flox macrophages infected with adenovirus expressing CRE recombinase at multiplicity of infection (MOI) of 75 and 100. (b) macrophages infected with increasing quantities of adenovirus (MOI of 75, 100) expressing GFP to assay the extent of cell infection. The efficiency of transduction and expression of viral transgenes in macrophages was »75% (CRE) and 90% (GFP). Similar results were seen in three independent cultures.
Fig. 14. Model for roles of av integrins in mucosal immune regulation. We propose that av integrins on myeloid cells play important roles in antigen acquisition and both autocrine and paracrine TGF-b signaling to regulate mucosal immunity. Macrophages and DCs acquire self and self-associated antigen, in part through through phagocytosis of apoptotic intestinal epithelial cells via avb3 and avb5 (1). This stimulates production of latent-TGF-b by macrophages and DCs, which is activated by avb8, and subsequent TGF-b signaling to DCs induces tolerogenic DCs (2). These DCs migrate to mLNs, where they selectively stimulate the production of gut-homing aTreg cells, a process that also depends on local activation of TGF-b by avb8 on DCs (3). Mucosal inflammation is then limited by Treg cells and anti-inflammatory macrophages (4).
SI Methods
Generation of Conditional Knockout Mice.
To generate the av-flox targeting vector, 8 kb of genomic DNA spanning exon 4 of mouse Itgav was amplified by PCR. A LoxP-flanked Neomycin-resistance cassette was inserted at an XbaI site 5' of the start of exon 4 and an additional Lox P site was placed 3' of exon 4. E14-1 ES cells were transfected with linearised vector and homologous recombinants identified by PCR and confirmed by Southern blot analysis. The Neomycin-resistance cassette was removed by transient transfection with CRE recombinase, and ES cells injected into C57BL/6 blastocysts to generate chimeras. Chimeric mice were bred to C57BL/6 mice to verify germline transmission and produce av-flox mice of a mixed 129/ C57BL/6 genetic background. Mice were genotyped by PCR of tail or ear tissue DNA with primers 1f (GGTGACTCAATCTGTGACCTTCAGC) and rev (CACAAATCAAGGATGACCAAACTGAG), which generates bands of 550 bp in wild-type mice, 700 bp in floxed mice and 150 bp following CRE-mediated deletion. Deletion was also assessed using primers 2f (TTCAGGACGGCACAAAGACCGTTG) and rev which gives bands of 250 bp in wild-type mice, 400 bp in floxed mice and no band following CRE-mediated deletion.Conditional knockout mice were bred to have one av-flox and one av-knockout allele or two copies of the av-flox allele, with the appropriate CRE allele. In all cases control mice were littermates carrying one av-flox allele, one wild-type av allele and the relevant CRE transgene. av-knockout mice and all CRE mice have been described previously (1-5). LacZ reporter mice were obtained from Jackson labs and crossed with tie2-CRE mice.
Adenoviral Gene Transfer.
For adenoviral gene delivery, macrophages were cultured with adenoviral preparations at a multiplicity of infection (MOI) of 75 or 100 in normal growth media for 24 h, and the extent of cell infection was assessed after a further 24-48 h. Adenoviral GFP (A kind gift of M Hitt, McMaster University, Ontario, Canada) was used to determine the optimum dose of adenovirus required for adequate infection of mouse bone-marrow-derived macrophages. An MOI of 100 and above was sufficient to infect »90% of the macrophages without inducing cell death. Adenoviral CRE (F. Graham, McMaster University) was used at MOI of 75 and 100, and CRE-mediated deletion of av assessed by PCR on genomic DNA of treated cells. Phagocytosis was assessed 48 h after treatment with adenoviral-CRE.Tissue Staining and Histology.
For LacZ staining, tissues were fixed in 4% paraformaldehyde for 4 h and stained with X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside) for 48 h at 30°C. Tissues were then fixed again, washed, and photographed by stereomicroscopy or sectioned, counterstained with nuclear fast red, and imaged by microscopy. For staining retinal angiogenesis, eyes from 5-day old pups were removed and fixed in 4% paraformaldehyde. Retinas were dissected and incubated with Lectin BS-1 TRITC (Sigma) overnight at 4°C, washed extensively in PBS, mounted on glass slides, and imaged by fluorescence microscopy. For examination of intestinal inflammation, intestines were removed, gently flushed with PBS, fixed with buffered 10% formalin before paraffin embedding and sectioning. Apoptosis was measured by TUNEL staining (ApopTag; Chemicon, Temecula, CA) on formalin-fixed sections of colon from 6-week-old mice. Other tissues were fixed in either formaldehyde or Bouins solution before sectioning.FACS Analysis.
Immune cell populations were prepared from peritoneal cavity by lavage and from lymphoid organs by digestion with liberase (Roche, Indianapolis, IN) and DNase I (Boehringer, Mannheim, Germany) followed by disruption. Lamina Propria cells were isolated from colon (6). All antibodies used were from BD PharMingen except anti-FoxP3 (eBioscience, San Diego, CA). All analysis used FACS-Calibur or FACS-Scan (BD PharMingen) and FloJo software.Immune Analysis.
For gene expression analysis, RNA was prepared from whole colon (approx 1 cm of tissue proximal to caecum; RNAEasy; Ambion, Austin, TX) and assayed by quantitative real-time PCR (Light Cycler; Bio-Rad), expressed relative to GAPDH expression. Cytokine protein levels were measured on homogenates of colon tissue by cytokine bead array (BD PharMingen) and corrected for total protein (6). To measure autoantibodies, ELISA plates (Immunosorb) were coated with phosphatidylserine (Sigma-Aldrich), dsDNA (Stratagene, Valencia, CA) or tropomyosin (Sigma-Aldrich), incubated with serial dilutions of serum and detected with biotinylated anti-mouse IgG antibodies (BD PharMingen), streptavidin-alkaline phosphatase (Boehringer) and tetramethylbenzidine (R&D Systems, Minneapolis, MN). Titres were determined by the dilution required to produce an OD > 0.2 and were normalized between assays by comparison to a positive control antiserum. Antinuclear antibodies (ANA) were measured by nuclear staining of Hep-2 cells with serial dilutions of serum.1. Bader BL, Rayburn H, Crowley D, Hynes RO (1998) Cell 95:507-519.
2. Kisanuki YY, Hammer RE, Miyazaki J, Williams SC, Richardson JA, Yanagisawa M (2001) Dev Biol 230:230-242.
3. Rickert RC, Roes J, Rajewsky K (1997) Nucleic Acids Res 25:1317-1318.
4. Clausen BE, Burkhardt C, Reith W, Renkawitz R, Forster I (1999) Transgenic Res 8:265-277.
5. Hennet T, Hagen FK, Tabak LA, Marth JD (1995) Proc Natl Acad Sci USA 92:12070-12074.
6. Uhlig HH, McKenzie BS, Hue S, Thompson C, Joyce-Shaikh B, Stepankova R, Robinson N, Buonocore S, Tlaskalova-Hogenova H, Cua DJ, Powrie F (2006) Immunity 25:309-318.