cDNA Synthesis. Total spleen RNA from B10.Q/Ai and B10.Q/J mouse strains was extracted by using TRIzol (Invitrogen). First-strand cDNA synthesis was carried out by using 2 μg of total RNA, 0.2 μg of random hexamers, and 100 units of SuperScript RNase H- Reverse Transcriptase (Invitrogen). The reaction conditions for cDNA synthesis were followed according to the manufacturer’s protocol.

Tyk2 Sequence Analysis. cDNA was derived by reverse transcription of total splenic RNA (as described above). Nine pairs of primers, designated fragments A–I, (Invitrogen), spanning the entire coding region of Tyk2 were used (sequence available on request). PCR amplification was performed by 35 cycles of denaturation at 94° C (1 min), annealing at 50° C (1 min), and extension at 68° C (1 min), followed by a final extension at 72° C (7 min). PCR was carried out by using Platinum Pfx DNA Polymerase (Invitrogen). PCR products were purified by using QIAquick kits from Qiagen (Valencia, CA). Amplified products were then directly sequenced (Howard Hughes Medical Institute–Keck Facility, Yale University, New Haven, CT). The cDNA sequences from B10.Q/J and B10.Q/Ai were directly compared to the published Tyk2 sequence (GenBank accession no. NM_018793) by using ASSEMBLYLIGN and MACVECTOR 7.1.1 (Accelrys, San Diego).

AvaI Restriction Typing. Each 15-μl PCR reaction contained 0.2 pmol of forward TCTCCAGGGAAGGTGAGTTC and reverse TCTCAAGAAGGGTGGCACCA primers in 1´ Invitrogen PCR buffer with 2 mM Mg²⁺ and 20 ng of total genomic DNA as a template. After 40 cycles of 30-sec denaturation at 95° C and 1 min annealing/extension at 60° C, a 204-bp amplified fragment was subjected to digestion with AvaI. A 10-μl aliquot containing 1.6´ NEB 4 (Beverly, MA) restriction buffer and 2.5 units of AvaI restriction enzyme was added to each PCR reaction. After incubation at 37° C for 1 h, restriction digest products were resolved in a 3% agarose gel. The presence of the BALB/c allele of Tyk2 manifested by appearance of 126- and 78-bp bands. Of the 180 mice typed by AvaI restriction site polymorphism, three appeared discordant. Repeat measurement of IFN-g levels in stored serum samples and a recount of infected cells in permanently stained smears indicated errors in initial assignment of phenotype for two of the discordant mice. The last discordant mouse was uninfected and excluded from analysis.

In Vitro Mutagenesis of Human Tyk2 and Complementation Assay. The human Tyk2 E782K mutation was introduced into a 720-bp BsiW1-BstX1 fragment by PCR by using mutagenic primers (sequence available on request) and the overlap extension method. The fragment was then subcloned into pRcCMV-Tyk2B (1) and sequenced. IFN responsiveness of 11,1 cells stably transfected with the wild-type, the E782K, or the R856G mutant and selected in neomycin (450 μg/ml) was analyzed as described (2). Briefly, 4 ´ 10⁵ cells were seeded in a 100-mm dish in 15 m g of hypoxanthine/0.2 m g of aminopterin/10 m g of thymidine per milliliter medium and a saturating dose of IFN-α (1 nM human recombinant IFN-α2 from D. Gewert, Glaxo-Wellcome Research and Development, Hertfordshire, U.K.). One week later, cells were fixed, and stained colonies were counted.

Cultivation of Primary Lung Fibroblasts. Lungs were isolated and minced into fine pieces by using sterile surgical blades. Once finely minced, the tissues were cultured until 100% confluent in DMEM (Life Technologies, Gaithersburg, MD) supplemented with 10% FBS (HyClone), antibiotics, L-glutamine, Hepes (10 m M), and 2-mercaptoethanol (2-ME) (5 m M). For signal transducer and activator of transcription (Stat)1 activation, 2 ´ 10⁶ cells were cultured in 100-mm dishes with DMEM (Life Technologies) supplemented with 10% FBS (HyClone), antibiotics, L-glutamine, Hepes (10 m M), and 2-ME (5 m M). Twenty-four hours later, cells were treated with 1,000 units/ml IFN-α for 15 min. Cells were lysed in radioimmunoprecipitation assay, and total protein was separated on SDS/PAGE and IB with p-Stat1- or Stat1-specific antibody. For the antiviral assay, 5 ´ 10⁵ cells were plated in 96-well plates 24 h prior to treatment with recombinant murine IFN-α ranging from 0 to 1,000 units/ml (PBL Biomedical Laboratories, New Brunswick, NJ). Twenty-four hours later, cell monolayers were infected with vesicular stomatitis virus (multiplicity of infection of 0.01). Cell viability was determined 48 h postinfection by crystal violet staining and quantified by spectroscopy at 595 nm, as previously outlined (3).

1. Yeh, T. C., Dondi, E., Uze, G. & Pellegrini, S. (2000) Proc. Natl. Acad. Sci. USA 97, 8991–8996.

2. Pellegrini, S., John, J., Shearer, M., Kerr, I. M. & Stark, G. R. (1989) Mol. Cell. Biol. 9, 4605–4612.

3. Hogan, M. a. V., S. (2000) in Current Protocols in Immunology, ed. Coico, R. (Wiley, New York), Vol. 1, pp. 6.10.11.