Species-specific endogenous retroviruses shape the transcriptional network of the human tumor suppressor protein p53 -- Wang et al. 104 (47): 18613 Data Supplement - HTML Page - index.htslp -- Proceedings of the National Academy of Sciences

Wang et al. 10.1073/pnas.0703637104.

Supporting Information

Files in this Data Supplement:

SI Text
SI Table 4
SI Table 5
SI Table 6
SI Figure 4
SI Figure 5
SI Table 7

SI Figure 4

Fig. 4. Genomewide distribution properties of p53 site-containing LTRs. Distribution metrics were calculated for four types of elements: all ERV/LTRs, LTRs of LTR10 and MER61 families that have a p53 site, LTRs of LTR10 and MER61 families that do not have any p53 site, and simulated elements. Simulation is done three times for all ERV/LTRs in a way such that the length distribution, orientation, and chromosome distribution of simulated elements is identical to that of all ERV/LTRs, but the location of the simulated element is randomly selected from the same chromosome. (A) Distribution of distance to known genes. (B) The relative location distribution of all elements that fall into gene boundary. Transcriptional start site of a gene is denoted as 0%, and transcriptional end site of the same gene is denoted as 100%. (C) Distribution of all elements that are within 100 kb of transcriptional start sites. (D) Strand bias, or the percentage of elements that are on the same strand of the closest known gene, binned based on the distance to the closest known gene. Distance 0 indicates LTRs in introns.

SI Figure 5

Fig. 5. Evolution of the TP53AP1 locus. (A) Genomic context of human TP53AP1 locus on chromosome 7, based on the University of California Santa Cruz (UCSC) Genome Browser (1). Selected tracks include (from top): ChIP PET fragment location; ERV structure prediction (2); UCSC gene prediction; human mRNA from GenBank; vertebrate conservation track; repetitive elements predicted by RepeatMasker. The TP53AP1 gene (or P53TG1 in graph) locus is included in the display, plus part of gene CROT. The MER61E elements are marked on the RepeatMasker track. (B) Genomic context of the mouse orthologous region on chromosome 5. The orientation of this part of the mouse genome is reversed with respect to the human region. Selected tracks include (from top): UCSC gene prediction; mouse mRNA from GenBank; conservation track; repetitive elements predicted by RepeatMasker. The CROT gene locus is included in the display. The empty space on the right of CROT locus is orthologous to the human TP53AP1 locus. The only transcript that covers this regions (besides those corresponding to CROT), AK040107, belongs to a more downstream mouse gene DMTF1 (not shown in graph). The human orthologous DMTF1 gene locates in the same syntenic block upstream of TP53AP1. (C) Multiple-species genomic sequence alignment of the TP53AP1 gene. The human genomic sequence that is potentially coding (270 bp) is used as an anchor. Orthologous sequences from chimp, rhesus, bushbaby, treeshrew, mouse, and rat are aligned to the human sequence to produce a multiple-sequence alignment. The predicted protein sequences of these species are also aligned under the nucleotide alignment. In the nucleotide alignment, darker blue shade indicates completely conserved position across all seven species; lighter blue shade indicates identical nucleotide to human; pink shade indicates positions at which the rhesus nucleotide is different from the human one. In the protein alignment, yellow shade indicates positions with a same amino acid as the human one; pink shade indicates a change of amino acid sequence in rhesus; red shade indicates stop codon.

1. Hinrichs AS, Karolchik D, Baertsch R, Barber GP, Bejerano G, Clawson H, Diekhans M, Furey TS, Harte RA, Hsu F, et al. (2006) Nucleic Acids Res 34:D590-D598.

2. Villesen P, Aagaard L, Wiuf C, Pedersen FS (2004) Retrovirology 1:32.

Table 4. Distribution of p53 sites in ERV/LTR elements

LTR/ERV	Fragment no.	Copy with p53 binding site	Percentage	Site/copy	Site/kb
All ERV	319106	1509	0.47	0.0048	0.011
MER61C	294	157	53.40	0.5300	1.500
MER61E	316	112	35.44	0.3600	0.950
LTR10B1	246	77	31.30	0.4309	1.367
LTR10E	252	69	27.38	0.4400	0.960
LTR10C	512	47	9.18	0.1100	0.250
ERVL-E	9573	38	0.40	0.0040	0.009
LTR76	184	36	19.57	0.2065	0.422
HERV16	4606	29	0.63	0.0065	0.013
LTR10D	190	35	18.42	0.1900	0.450
MER52A	1838	23	1.25	0.0125	0.012
MER74B	939	23	2.45	0.0245	0.075
LTR27B	525	22	4.19	0.0457	0.099
MER50	2613	21	0.80	0.0084	0.020
MER49	1311	19	1.45	0.0145	0.036
PABL_A	514	16	3.11	0.0311	0.066
LTR18B	396	15	3.79	0.0429	0.105
LTR27	397	15	3.78	0.0378	0.069
HUERS-P1	626	14	2.24	0.0224	0.025
LTR33	9381	13	0.14	0.0014	0.006
MLT2A1	3659	12	0.33	0.0033	0.012
LTR16C	9133	11	0.12	0.0012	0.005
MLT2C1	2560	11	0.43	0.0043	0.018
MLT2E	1367	11	0.80	0.0088	0.035
LTR47A	882	10	1.13	0.0113	0.044
LTR12C	2647	10	0.38	0.0038	0.003
HERVK14C	98	10	10.20	0.1020	0.067
LTR4	96	9	9.38	0.0938	0.197
LTR16B	3471	9	0.26	0.0026	0.009
HERVL-A1	980	8	0.82	0.0082	0.004
MER70A	531	8	1.51	0.0151	0.039
PABL_A-int	266	8	3.01	0.0338	0.047
MER77	2407	8	0.33	0.0033	0.010
MLT2B1	4552	8	0.18	0.0018	0.006
LTR28	522	8	1.53	0.0153	0.026
Harlequin	629	8	1.27	0.0143	0.010
MER70B	508	7	1.38	0.0138	0.046
MER68	1914	7	0.37	0.0037	0.010
HERVK	243	7	2.88	0.0288	0.015
LTR2B	319	7	2.19	0.0219	0.048
MER39	3167	7	0.22	0.0022	0.007
HUERS-P3	852	7	0.82	0.0082	0.010
ERVL-B4	3071	6	0.20	0.0023	0.004
LTR49	1395	6	0.43	0.0043	0.013
LTR16D	1752	6	0.34	0.0034	0.016
MER74A	1549	6	0.39	0.0039	0.011
MER21B	3645	6	0.16	0.0016	0.004
MER21C	4915	5	0.10	0.0010	0.003
HERV1_I	66	5	7.58	0.0909	0.055
LTR50	2834	5	0.18	0.0018	0.007
MER4B	1748	5	0.29	0.0029	0.007
MER66B	1423	5	0.35	0.0035	0.012
MER57A	2675	5	0.19	0.0019	0.006
MER41B	2885	5	0.17	0.0017	0.005
LTR67	6336	5	0.08	0.0008	0.005
MLT2A2	3907	5	0.13	0.0013	0.003
HERVI	181	5	2.76	0.0276	0.014
LTR43	441	5	1.13	0.0113	0.035
MER41A-int	625	5	0.80	0.0080	0.010
HERVK9	718	4	0.56	0.0056	0.004
MER4D1	1430	4	0.28	0.0028	0.006
MER87	417	4	0.96	0.0096	0.035
MER72B	183	4	2.19	0.0219	0.056
MER51A	963	4	0.42	0.0042	0.010
MER50B	686	4	0.58	0.0058	0.012
MER89	1365	4	0.29	0.0029	0.010
MER31B	1472	4	0.27	0.0027	0.009
LTR1	1411	4	0.28	0.0028	0.005
LTR49-int	1215	4	0.33	0.0033	0.007
MER4D0	483	4	0.83	0.0083	0.024
LTR52	1052	4	0.38	0.0038	0.014
MER84-int	164	4	2.44	0.0244	0.036
LTR77	148	3	2.03	0.0203	0.047
LTR13A	182	3	1.65	0.0165	0.021
HERVH	5785	3	0.05	0.0005	0.001
MER41-int	566	3	0.53	0.0053	0.010
MER57B-int	610	3	0.49	0.0049	0.007
LTR9	1962	3	0.15	0.0015	0.003
HERV3	243	3	1.23	0.0123	0.008
ERVL-B1	456	3	0.66	0.0066	0.007
MER21-int	397	3	0.76	0.0076	0.016
LTR18A	251	3	1.20	0.0120	0.038
MER66C-int	201	3	1.49	0.0149	0.022
MER11C	838	3	0.36	0.0036	0.004
LTR16A	6902	3	0.04	0.0004	0.002
LTR48	1250	3	0.24	0.0024	0.007
LTR16A1	3934	3	0.08	0.0008	0.003
MER101-int	826	3	0.36	0.0036	0.009
LTR9B	757	3	0.40	0.0040	0.010
MER72	758	3	0.40	0.0040	0.009
PRIMA4_LTR	340	3	0.88	0.0088	0.022
HERVS71	153	3	1.96	0.0196	0.010
MLT2B4	4352	3	0.07	0.0007	0.002
HERV15	85	3	3.53	0.0353	0.020
MER90a	1186	3	0.25	0.0025	0.008
MER83B-int	176	3	1.70	0.0170	0.029
MER92B	881	3	0.34	0.0034	0.011
MER52D	589	3	0.51	0.0051	0.006
MER51B-int	412	3	0.73	0.0073	0.010
LTR64	358	2	0.56	0.0056	0.019
LTR58	87	2	2.30	0.0230	0.069
HERVL	1137	2	0.18	0.0018	0.003
LTR8A	2701	2	0.07	0.0007	0.002
LTR1B	1157	2	0.17	0.0017	0.003
MLT2F	1979	2	0.10	0.0010	0.003
HERVK22	398	2	0.50	0.0050	0.004
MER110A	664	2	0.30	0.0030	0.012
MER57A-int	2221	2	0.09	0.0009	0.002
MER4-int	828	2	0.24	0.0024	0.006
MER4C	1209	2	0.17	0.0017	0.005
LTR37B	1988	2	0.10	0.0010	0.005
MER4E-int	172	2	1.16	0.0116	0.018
PRIMA4-int	2103	2	0.10	0.0010	0.005
LTR23	837	2	0.24	0.0024	0.012
LTR12_	664	2	0.30	0.0030	0.006
MER4A1-int	1436	2	0.14	0.0014	0.002
MER67B	456	2	0.44	0.0044	0.012
HERVL40	1233	2	0.16	0.0016	0.004
MER41B-int	570	2	0.35	0.0035	0.006
LTR53	662	2	0.30	0.0030	0.008
MER34B	1299	2	0.15	0.0015	0.005
MER4A	1104	2	0.18	0.0018	0.005
MER54B	429	2	0.47	0.0047	0.012
LTR40c	618	2	0.32	0.0032	0.010
MLT2C2	1380	2	0.14	0.0014	0.006
LTR12D	505	2	0.40	0.0040	0.005
MER73	279	2	0.72	0.0072	0.018
LTR10B	72	2	2.78	0.0278	0.066
HERVFH21	139	2	1.44	0.0144	0.012
MER52A-int	137	2	1.46	0.0146	0.020
ERVL-D	254	2	0.79	0.0079	0.011
LTR55	405	2	0.49	0.0049	0.014
LTR40a	2075	2	0.10	0.0010	0.003
MER90	675	2	0.30	0.0030	0.009
LTR1D	980	2	0.20	0.0020	0.003
MER65C	692	2	0.29	0.0029	0.009
ERVL	836	2	0.24	0.0024	0.006
MLT2B3	3284	2	0.06	0.0006	0.002
MER34	2402	2	0.08	0.0008	0.003
HERV35I	533	2	0.38	0.0038	0.007
MER21A	1860	2	0.11	0.0011	0.003
HERVIP10F	415	2	0.48	0.0048	0.004
MER4E	711	1	0.14	0.0014	0.003
MER4A1_-int	88	1	1.14	0.0114	0.015
MER51B	698	1	0.14	0.0014	0.005
ERVL-F	470	1	0.21	0.0021	0.004
MER4A-int	113	1	0.89	0.0088	0.011
LTR45C	392	1	0.26	0.0026	0.008
LTR39	1214	1	0.08	0.0008	0.002
MER61B-int	240	1	0.42	0.0042	0.005
MER51C	179	1	0.56	0.0056	0.014
LTR51	406	1	0.25	0.0025	0.006
HERV4_I	384	1	0.26	0.0026	0.004
LTR59	123	1	0.81	0.0081	0.024
LTR54	1108	1	0.09	0.0009	0.004
MER92A	149	1	0.67	0.0067	0.025
LOR1b	1103	1	0.09	0.0009	0.003
MER21B-int	190	1	0.53	0.0053	0.010
HERVL74	552	1	0.18	0.0018	0.004
LTR38-int	86	1	1.16	0.0116	0.034
LTR1C	249	1	0.40	0.0040	0.009
LTR43B	218	1	0.46	0.0046	0.014
HERV9	1077	1	0.09	0.0009	0.001
MER83C-int	43	1	2.33	0.0233	0.028
MER70-int	145	1	0.69	0.0069	0.018
LOR1-int	645	1	0.16	0.0016	0.004
MER61A-int	448	1	0.22	0.0022	0.002
MER51-int	202	1	0.50	0.0050	0.010
MER67C	1498	1	0.07	0.0007	0.002
MER61B	419	1	0.24	0.0048	0.015
MER41A	2514	1	0.04	0.0004	0.001
MER39-int	142	1	0.70	0.0070	0.019
HERVL-B3	99	1	1.01	0.0101	0.008
LTR33A	3531	1	0.03	0.0003	0.001
MER70A-int	101	1	0.99	0.0099	0.011
MER92C	341	1	0.29	0.0029	0.018
MER76	706	1	0.14	0.0014	0.004
MER67B-int	7	1	14.29	0.1429	0.209
PABL_B	363	1	0.28	0.0028	0.007
MER34-int	459	1	0.22	0.0022	0.005
MER54A	633	1	0.16	0.0016	0.004
LTR35	310	1	0.32	0.0032	0.011
LTR42	288	1	0.35	0.0035	0.010
LTR29	674	1	0.15	0.0015	0.005
MER50-int	503	1	0.20	0.0020	0.003
MER66B-int	169	1	0.59	0.0059	0.007
PABL_B-int	169	1	0.59	0.0059	0.007
LTR14A	112	1	0.89	0.0089	0.027
LTR25-int	284	1	0.35	0.0035	0.004
MER41D-int	71	1	1.41	0.0141	0.034
MER41G	109	1	0.92	0.0092	0.023
ERVL-A1	24	1	4.17	0.0417	0.024
LTR45	179	1	0.56	0.0056	0.019
LTR26B	445	1	0.22	0.0022	0.007
LTR14B	356	1	0.28	0.0028	0.006
MER4E1-int	79	1	1.27	0.0127	0.022
ERVL-B2	161	1	0.62	0.0062	0.006
MER89-int	678	1	0.15	0.0015	0.003
LTR12	981	1	0.10	0.0010	0.002
MER101B	239	1	0.42	0.0042	0.014
MER65D	432	1	0.23	0.0023	0.008
MER57B	1249	1	0.08	0.0008	0.002
HERVL-A2	527	1	0.19	0.0019	0.001
HUERS-P3b	381	1	0.26	0.0026	0.003
LTR48B	1073	1	0.09	0.0009	0.003
LTR62	316	1	0.32	0.0032	0.008
HERVFH19	143	1	0.70	0.0070	0.007
HERVL18	541	1	0.18	0.0018	0.003
PRIMA4_LTR-int	30	1	3.33	0.0333	0.033
LTR39-int	155	1	0.65	0.0065	0.018
MER93a	831	1	0.12	0.0012	0.005
MER41C-int	166	1	0.60	0.0060	0.006
MER31-int	1272	1	0.08	0.0008	0.002
HERVE	349	1	0.29	0.0029	0.001
MER31A	1332	1	0.08	0.0008	0.002
LOR1b-int	375	1	0.27	0.0027	0.004
MER54B-int	2	1	50.00	0.5000	6.024
HERVP71A	197	1	0.51	0.0051	0.004
HUERS-P2	244	1	0.41	0.0041	0.004
LTR71A	167	1	0.60	0.0060	0.016
MER110	753	1	0.13	0.0013	0.005
MER52-int	231	1	0.43	0.0043	0.004
MER65B	245	1	0.41	0.0041	0.021
ERVL-B3	211	1	0.47	0.0047	0.004
HERVH48	120	1	0.83	0.0083	0.005
MER52C	373	1	0.27	0.0027	0.003
MER66A-int	61	0	0	0	0
MER51A-int	64	0	0	0	0
MER95	155	0	0	0	0
LTR3B	91	0	0	0	0
LTR6B	152	0	0	0	0
HERV16-MLT2B1	2	0	0	0	0
HERV16-MLT2B2	2	0	0	0	0
LTR10G-int	1	0	0	0	0
LTR26B-int	1	0	0	0	0
LTR19A-int	59	0	0	0	0
LTR5B	427	0	0	0	0
LTR25	265	0	0	0	0
LTR46-int	80	0	0	0	0
LTR72-int	1	0	0	0	0
HERVL-C1	16	0	0	0	0
MER11B	556	0	0	0	0
LTR48B-int	57	0	0	0	0
MER61C-int	159	0	0	0	0
LTR11	17	0	0	0	0
LTR26	617	0	0	0	0
LTR40a-int	9	0	0	0	0
LTR8	3570	0	0	0	0
MLT2B2-int	3	0	0	0	0
LTR1C-int	1	0	0	0	0
LTR1D-int	28	0	0	0	0
MER34C_-int	31	0	0	0	0
HERVL-D	6	0	0	0	0
MER34D-int	29	0	0	0	0
LTR16B-int	1	0	0	0	0
LTR75_1-int	1	0	0	0	0
LTR31	246	0	0	0	0
MER57-int	404	0	0	0	0
LTR10C-int	1	0	0	0	0
MER4D1-int	54	0	0	0	0
LTR26E	303	0	0	0	0
LTR24C-int	10	0	0	0	0
HERV16-MLT2C2	2	0	0	0	0
MER70B-int	28	0	0	0	0
LTR9B-int	4	0	0	0	0
MER61F-int	48	0	0	0	0
LTR24B-int	28	0	0	0	0
ERVL-C1	335	0	0	0	0
MER4D	1264	0	0	0	0
LTR56-int	41	0	0	0	0
MER51D	155	0	0	0	0
MER67D	1161	0	0	0	0
MER65A-int	707	0	0	0	0
LTR19-int	120	0	0	0	0
HERVL-B4	20	0	0	0	0
LTR35-int	5	0	0	0	0
MER21C-int	127	0	0	0	0
LTR19C-int	14	0	0	0	0
MER90-int	13	0	0	0	0
LTR19C	213	0	0	0	0
LTR3A	157	0	0	0	0
LTR6A-int	3	0	0	0	0
LTR7Y	472	0	0	0	0
LTR77-int	13	0	0	0	0
LTR76-int	2	0	0	0	0
MER84	349	0	0	0	0
MER39B	1188	0	0	0	0
LTR45B	435	0	0	0	0
MER31B-int	174	0	0	0	0
MLT2B5	448	0	0	0	0
MER48	193	0	0	0	0
LTR70-int	1	0	0	0	0
MER61D-int	145	0	0	0	0
LTR7-int	4	0	0	0	0
MER93B-int	79	0	0	0	0
MER72B-int	3	0	0	0	0
LTR34	367	0	0	0	0
LTR75_1	130	0	0	0	0
LTR47A-int	5	0	0	0	0
MER83A-int	54	0	0	0	0
HERVK3	341	0	0	0	0
LTR38	316	0	0	0	0
LTR30	139	0	0	0	0
MLT2D-int	11	0	0	0	0
MER4A1	2190	0	0	0	0
LTR73-int	2	0	0	0	0
LTR5A	252	0	0	0	0
LTR2C-int	1	0	0	0	0
HERV1_LTRb	10	0	0	0	0
HERVL-B2	5	0	0	0	0
LTR4-int	1	0	0	0	0
LTR16C-int	3	0	0	0	0
LTR23-int	167	0	0	0	0
ERVL-B5	18	0	0	0	0
MER87-int	26	0	0	0	0
LTR40b	1239	0	0	0	0
LTR72	149	0	0	0	0
LTR9-int	17	0	0	0	0
LTR45B-int	2	0	0	0	0
MER101B-int	22	0	0	0	0
HERVIP10FH	643	0	0	0	0
MER4E1	1085	0	0	0	0
LTR44	209	0	0	0	0
HERV17	927	0	0	0	0
LTR46	240	0	0	0	0
HERVL-C2	4	0	0	0	0
LTR66	362	0	0	0	0
MER51E	245	0	0	0	0
LTR7A	18	0	0	0	0
LTR10A	307	0	0	0	0
LTR44-int	1	0	0	0	0
LTR19B	275	0	0	0	0
MER4C-int	325	0	0	0	0
LTR22B	224	0	0	0	0
MLT2C1-int	4	0	0	0	0
LTR51-int	1	0	0	0	0
MER68-int	342	0	0	0	0
LTR56	953	0	0	0	0
MER9	1151	0	0	0	0
LTR12B-int	2	0	0	0	0
LTR27-int	39	0	0	0	0
LTR14C	138	0	0	0	0
LTR37B-int	1	0	0	0	0
MER4A1_	397	0	0	0	0
MER66C	661	0	0	0	0
MER67A-int	20	0	0	0	0
MER66-int	270	0	0	0	0
MLT2D	4447	0	0	0	0
LTR19A	416	0	0	0	0
HERV1_LTRc	34	0	0	0	0
LTR12B	466	0	0	0	0
LOR1a	793	0	0	0	0
HERV16-MLT2B3	4	0	0	0	0
LTR13_	37	0	0	0	0
LTR2-int	2	0	0	0	0
LTR17	831	0	0	0	0
LTR2C	262	0	0	0	0
LTR73	212	0	0	0	0
LTR24	314	0	0	0	0
MER51C-int	10	0	0	0	0
MER67C-int	25	0	0	0	0
MER92A-int	7	0	0	0	0
MER65B-int	54	0	0	0	0
MER54A-int	2	0	0	0	0
MER61E-int	26	0	0	0	0
LTR21B	60	0	0	0	0
HERVKC4	67	0	0	0	0
MLT2B2	2228	0	0	0	0
LTR65	460	0	0	0	0
LTR32	1308	0	0	0	0
MER74C	228	0	0	0	0
HERVK14	318	0	0	0	0
LTR65-int	6	0	0	0	0
MER92B-int	1	0	0	0	0
PRIMA41-int	190	0	0	0	0
MER67A	493	0	0	0	0
LTR10F-int	1	0	0	0	0
MLT2A2-int	8	0	0	0	0
MER65D-int	81	0	0	0	0
LTR10F	436	0	0	0	0
LTR61-int	2	0	0	0	0
LTR14	85	0	0	0	0
LTR6A	256	0	0	0	0
MER39B-int	63	0	0	0	0
LTR24B	451	0	0	0	0
MER93a-int	46	0	0	0	0
LTR22C	378	0	0	0	0
LTR48-int	35	0	0	0	0
LTR27B-int	55	0	0	0	0
LTR24-int	29	0	0	0	0
LTR28-int	29	0	0	0	0
MER11A	941	0	0	0	0
HERV1_LTRa	27	0	0	0	0
MER4B-int	1116	0	0	0	0
HERVK13	66	0	0	0	0
LTR38C-int	5	0	0	0	0
MER41G-int	17	0	0	0	0
MER88	112	0	0	0	0
MER52C-int	57	0	0	0	0
LTR45-int	1	0	0	0	0
LTR16A-int	4	0	0	0	0
MER34C_	1058	0	0	0	0
MER61A	801	0	0	0	0
HERV1_LTRd	17	0	0	0	0
LTR61	157	0	0	0	0
LTR7B-int	6	0	0	0	0
LTR22	103	0	0	0	0
MER76-int	156	0	0	0	0
LTR8A-int	8	0	0	0	0
LTR38B-int	10	0	0	0	0
MER67D-int	16	0	0	0	0
MER101	382	0	0	0	0
LTR54-int	2	0	0	0	0
LTR10G	116	0	0	0	0
MER83C	150	0	0	0	0
LTR5	22	0	0	0	0
ERVL-C2	55	0	0	0	0
MER61-int	196	0	0	0	0
LTR29-int	31	0	0	0	0
LTR10A-int	2	0	0	0	0
MER65-int	333	0	0	0	0
LTR47B	381	0	0	0	0
MER83-int	68	0	0	0	0
ERVL-A2	9	0	0	0	0
MER4D-int	67	0	0	0	0
LTR40b-int	4	0	0	0	0
HERVL-B1	5	0	0	0	0
HERVL66	109	0	0	0	0
LTR15	259	0	0	0	0
LTR72B	178	0	0	0	0
LTR21A	93	0	0	0	0
LTR41	2383	0	0	0	0
LTR33-int	3	0	0	0	0
MLT2C2-int	3	0	0	0	0
LTR34-int	5	0	0	0	0
LTR26E-int	1	0	0	0	0
MER66A	345	0	0	0	0
MER83	438	0	0	0	0
LTR22A	188	0	0	0	0
LTR75-int	3	0	0	0	0
MER110-int	313	0	0	0	0
LTR43B-int	1	0	0	0	0
MER92C-int	11	0	0	0	0
MER90a-int	10	0	0	0	0
LTR1B-int	8	0	0	0	0
LTR60	253	0	0	0	0
HERV1_LTRe	32	0	0	0	0
HERVK11	301	0	0	0	0
MER74A-int	4	0	0	0	0
MER34C	261	0	0	0	0
MER9B	62	0	0	0	0
LTR54B	845	0	0	0	0
LTR72B-int	2	0	0	0	0
LTR57-int	321	0	0	0	0
MER61F	153	0	0	0	0
MER52D-int	60	0	0	0	0
LTR68	347	0	0	0	0
LOR1a-int	219	0	0	0	0
MER65C-int	123	0	0	0	0
LTR36-int	22	0	0	0	0
HERVL-F	5	0	0	0	0
LTR33A-int	1	0	0	0	0
LTR54B-int	4	0	0	0	0
MER34D	330	0	0	0	0
LTR12C-int	8	0	0	0	0
LTR26-int	3	0	0	0	0
LTR38B	227	0	0	0	0
LTR75	410	0	0	0	0
MER41E-int	15	0	0	0	0
LTR52-int	264	0	0	0	0
MER65A	1344	0	0	0	0
LTR41-int	1	0	0	0	0
LTR59-int	5	0	0	0	0
LTR71B	215	0	0	0	0
HERV30	68	0	0	0	0
HERVL-B5	4	0	0	0	0
MER41C	824	0	0	0	0
LTR31-int	1	0	0	0	0
LTR70	133	0	0	0	0
MLT2B1-int	11	0	0	0	0
MER83B	147	0	0	0	0
LTR12E	121	0	0	0	0
HERVL32	102	0	0	0	0
LTR7B	880	0	0	0	0
LTR2B-int	3	0	0	0	0
MER31A-int	214	0	0	0	0
LTR3B_	241	0	0	0	0
MER72-int	71	0	0	0	0
LTR8-int	16	0	0	0	0
MER93B	489	0	0	0	0
MER4D0-int	51	0	0	0	0
LTR37A	1979	0	0	0	0
MER77-int	13	0	0	0	0
MER49-int	108	0	0	0	0
LTR69	143	0	0	0	0
MER50B-int	61	0	0	0	0
MER41E	355	0	0	0	0
LTR19B-int	12	0	0	0	0
MER34B-int	552	0	0	0	0
MER11D	260	0	0	0	0
LTR3	84	0	0	0	0
HERVK11D	53	0	0	0	0
PRIMAX-int	225	0	0	0	0
LTR57	236	0	0	0	0
LTR24C	381	0	0	0	0
LTR60-int	7	0	0	0	0
LTR15-int	4	0	0	0	0
MER21A-int	169	0	0	0	0
LTR17-int	2	0	0	0	0
LTR13	475	0	0	0	0
MER41D	449	0	0	0	0
LTR38C	133	0	0	0	0
MER51E-int	3	0	0	0	0
LTR5_Hs	610	0	0	0	0
MER110A-int	47	0	0	0	0
LTR36	479	0	0	0	0
LTR16A1-int	1	0	0	0	0
MER34C-int	16	0	0	0	0
LTR43-int	67	0	0	0	0
LTR2	894	0	0	0	0
LTR10D-int	3	0	0	0	0
LTR7	2357	0	0	0	0
LTR37A-int	3	0	0	0	0
LTR47B-int	4	0	0	0	0

Predicted p53 sites within repetitive sequences of the human genome. The columns contain the following: names of selected LTR families defined in RepBase; total number of fragments identified in the human genome; total number of fragments that contain a predicted p53 site; percentage of fragments that contain a p53 site; average number of site per fragment; average number of site per thousand bases.

Table 5. Distribution of repetitive elements

Type of repeats	Human Genome (hg18), %	PET3+ Loci, %
Total Repeats	48	52
SINEs	13.62	10.2
LINEs	21.33	9.14
Total LTRs	8.7	18.28
MaLRs	3.79	2.45
ERVL	1.6	1.22
ERV Class I	3	14.25
ERV Class II	0.31	0
DNA elements	3.01	2.54

Human genome (hg18) and PET3+ loci are annotated with RepeatMasker. Percentage is of total sequence length. Entries in bold exhibit significant enrichment in PET3+ loci.

Table 6. Genes that are associated with ERV-derived p53 sites.

Gene symbol	Chromosome	txStart	txEnd	Strand	Description	p53 target	Distance	LTR
FLJ20972	1	42720951	42776227	+	Hypothetical protein LOC80098	Known	0	LTR10D/chr1:42771315-42771680:-
ERBB4	2	211955059	213111532	-	V-erb-a erythroblastic leukemia viral oncogene	Known	0	MER61C/chr2:211986687-211987122:-
CCNG2	4	78297401	78573564	+	CCNG2 protein.	Known	0	LTR10B1/chr4:78482472-78482941:-
CCNG2	4	78297401	78573564	+	CCNG2 protein.	Known	0	LTR10B1/chr4:78472974-78473434:-
PHF14	7	10980040	11109807	+	PHD finger protein 14 isoform 1,PHD finger protein 14 isoform 2,	Known	0	LTR10D/chr7:11088965-11089457:+
PTHB1	7	33135676	33612205	+	Parathyroid hormone-responsive B1 isoform 2	Known	0	MER61C/chr7:33357770-33358027:-
PTHB1	7	33135676	33612205	+	Parathyroid hormone-responsive B1 isoform 2	Known	0	MER61E/chr7:33293971-33294543:+
TP53AP1	7	86792476	86812767	-	TP53 activated protein 1	Known	0	MER61E/chr7:86798001-86798562:-
TP53AP1	7	86792476	86812767	-	TP53 activated protein 1	Known	1843	MER61E/chr7:86790079-86790633:-
FRMD4A	10	13725717	14412889	-	FERM domain containing 4A,FERM domain containing 4A,	Known	0	MER61C/chr10:13840517-13840823:+
TRIM22	11	5667630	5688668	+	Tripartite motif-containing 22	Known	0	LTR10D/chr11:5667981-5668489:-
CNAP1	12	6473519	6511381	+	CDNA FLJ43165 fis, clone FCBBF3002163, highly similar to Homo sapiens chromosome condensation-related SMC-associated protein 1.	Known	0	LTR10D/chr12:6486783-6487369:-
CHD2	15	91244422	91366396	+	Chromodomain helicase DNA binding protein 2	Known	0	LTR10E/chr15:91293970-91294588:-
DTWD1	15	47700530	47709446	+	DTWD1 protein.	Known	0	LTR10B1/chr15:47705024-47705471:-
NEO1	15	71131927	71382835	+	Neogenin homolog 1	Known	0	MER61E/chr15:71244967-71245539:-
PIAS2	18	42646058	42751464	-	Protein inhibitor of activated STAT X isoform	Known	0	LTR10B1/chr18:42702154-42702735:+
PIAS2	18	42646058	42751464	-	Protein inhibitor of activated STAT X isoform	Known	0	LTR10B1/chr18:42711259-42711833:+
PTPRM	18	7557816	8396852	+	Protein tyrosine phosphatase, receptor type, M	Known	0	MER61C/chr18:7723654-7723955:-
PTPRM	18	7557816	8396852	+	Protein tyrosine phosphatase, receptor type, M	Known	0	MER61C/chr18:7718236-7718536:-
GPC3	X	132497443	132947332	-	Glypican 3	Known	0	MER61C/chrX:132748146-132748578:+
PCCA	13	99539337	99980687	+	Propionyl Coenzyme A carboxylase, alpha	Known	3906	LTR10C/chr13:99535181-99535431:-
PCCA	13	99539337	99980687	+	Propionyl Coenzyme A carboxylase, alpha	Known	38205	MER61C/chr13:99500756-99501132:+
IFNAR1	21	33650878	33654038	+	Hypothetical protein FLJ41819.	Known	7383	LTR10B1/chr21:33661421-33661888:+
MTHFD1L	6	151228383	151464713	+	Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (Fragment).	Known	7961	LTR10E/chr6:151219799-151220422:-
VIM	10	17311303	17319598	+	Vimentin	Known	9708	MER61E/chr10:17329306-17329873:+
DENND2D	1	111531325	111548554	-	Hypothetical protein FLJ22457.	Known	9860	MER61E/chr1:111558414-111558972:-
UBP1	3	33404834	33456874	-	Upstream binding protein 1 (LBP-1a)	Known	17931	MER61C/chr3:33474805-33475187:-
UBP1	3	33404834	33456874	-	Upstream binding protein 1 (LBP-1a)	Known	27409	MER61C/chr3:33484283-33484604:-
BCAT1	12	24855547	24993499	-	Branched chain aminotransferase 1, cytosolic	Known	20628	MER61E/chr12:25014127-25014664:-
ANK1	8	41629901	41774297	-	Ankyrin 1 isoform 3,ankyrin 1 isoform 4,ankyrin 1 isoform 2,	Known	21132	MER61E/chr8:41795429-41795974:+
KCNMA1	10	78299369	79067583	-	Potassium large conductance calcium-activated channel, subfamily M, alpha member 1	Known	21295	LTR10E/chr10:79088878-79089435:-
TRIM24	7	137795618	137920870	+	Transcriptional intermediary factor 1 alpha	Known	28459	MER61E/chr7:137766589-137767159:-
PDCD1LG2	9	5500569	5560398	+	Programmed cell death 1 ligand 2	Known	28599	MER61E/chr9:5588997-5589420:+
BCL2A1	15	78040289	78050698	-	BCL2-related protein A1,BCL2-related protein A1,	Known	31952	LTR10B1/chr15:78082650-78082888:-
BNIP3	10	133631193	133645425	-	BCL2/adenovirus E1B 19kD-interacting protein 3	Known	33856	LTR10C/chr10:133679281-133679628:-
PCDH7	4	30331134	30753832	+	Protocadherin 7 isoform c precursor	Known	91272	MER61C/chr4:30845104-30845504:-
PCDH7	4	30331134	30753832	+	Protocadherin 7 isoform c precursor	Known	289468	MER61C/chr4:31043300-31043693:+
ASCC3	6	101269729	101435961	-	ASCC3 protein.	Known	151235	MER61C/chr6:101587196-101587624:+
CTNNA3	10	67349936	69125933	-	Catenin, alpha 3	Known	304538	LTR10E/chr10:67044866-67045398:-
AF277188	1	141560417	142073831	+	PNAS-130.	Novel	0	MER61C/chr1:141647238-141647642:+
							0	MER61C/chr1:141775568-141775972:-
							0	MER61C/chr1:142043710-142044114:+
AK128336	1	233897607	233901002	-	Hypothetical protein FLJ46478.	Novel	0	LTR10B1/chr1:233900027-233900368:+
INADL	1	61980736	62353170	+	InaD-like protein isoform 4	Novel	0	MER61C/chr1:62111917-62112344:+
LYST	1	233890970	234096843	-	Lysosomal trafficking regulator isoform 1	Novel	0	LTR10B1/chr1:233900027-233900368:+
NEGR1	1	71641213	72339202	-	Hypothetical protein DKFZp686P14120 (Fragment).	Novel	0	MER61E/chr1:72239096-72239624:+
PCNXL2	1	231267831	231460521	-	PCNXL2 protein.	Novel	0	LTR10C/chr1:231379413-231379999:+
PCNXL2	1	231267831	231460521	-	PCNXL2 protein.	Novel	0	LTR10E/chr1:231381989-231382549:+
PKN2	1	88922843	89072010	+	Protein kinase N2	Novel	0	LTR10E/chr1:89039935-89040496:-
PKN2	1	88922843	89072010	+	Protein kinase N2	Novel	648640	MER61C/chr1:88273814-88274203:-
RASAL2	1	176330252	176710178	+	RAS protein activator like 2,RAS protein activator like 2 isoform 1,RAS protein activator like 2 isoform 2,	Novel	0	MER61E/chr1:176513685-176514245:-
RGS7	1	239005437	239587008	-	Regulator of G-protein signalling 7	Novel	0	LTR10B1/chr1:239166717-239167291:+
AGPS	2	177965748	178111251	+	Alkylglycerone phosphate synthase precursor	Novel	0	MER61C/chr2:178047231-178047638:-
ALS2CR19	2	205118760	206188782	+	Hypothetical protein ALS2CR19 (Fragment). amyotrophic lateral sclerosis 2 (juvenile),	Novel	0	MER61E/chr2:205336959-205337513:-
DKFZP566N034	2	134929800	135241804	-	Hypothetical protein DKFZp666J217 (Fragment).	Novel	0	MER61E/chr2:135064828-135065369:+
PDE11A	2	178201057	178645728	-	Cyclic nucleotide phosphodiesterase 11A1.	Novel	0	MER61C/chr2:178406762-178407192:+
TSGA10	2	98980788	99124467	-	Testis specific, 10	Novel	0	LTR10E/chr2:99023711-99024262:+
ACAD11	3	133759675	133861616	-	Hypothetical protein FLJ16200.,putative acyl-CoA dehydrogenase,	Novel	0	MER61C/chr3:133828615-133828942:+
AF458053	3	6877926	7711138	+	Metabotropic glutamate receptor 7 variant (Fragment).	Novel	0	LTR10C/chr3:7075270-7075854:-
AF458054	3	6877926	7711138	+	Metabotropic glutamate receptor 7 variant (Fragment).	Novel	0	LTR10C/chr3:7075270-7075854:-
CLSTN2	3	141136896	141769320	+	Calsyntenin 2	Novel	0	LTR10D/chr3:141625114-141625622:+
EPHA6	3	98641163	98850105	+	EPH receptor A6,EPH receptor A6,	Novel	0	MER61E/chr3:98705711-98706250:-
GRM7	3	6877926	7758217	+	Glutamate receptor, metabotropic 7 isoform a,glutamate receptor, metabotropic 7 isoform b,	Novel	0	LTR10C/chr3:7075270-7075854:-
HRH1	3	11269399	11279415	+	Histamine receptor H1	Novel	0	LTR10B1/chr3:11271411-11271862:-
HRH1	3	11269399	11279415	+	Histamine receptor H1	Novel	5006	LTR10B1/chr3:11263944-11264393:-
NPHP3	3	133759675	133923993	-	Nephronophthisis 3 (adolescent)	Novel	0	MER61C/chr3:133828615-133828942:+
ABLIM2	4	8017940	8211438	-	Hypothetical protein ABLIM2 (Fragment).	Novel	0	LTR10B1/chr4:8116375-8116881:+
AK098536	4	6106386	6253183	-	Hypothetical protein FLJ25670.,multiple coiled-coil GABABR1-binding protein,	Novel	0	LTR10E/chr4:6110839-6111437:+
BC057761	4	24418907	24523669	-	Hypothetical protein.	Novel	0	LTR10E/chr4:24474282-24474827:+
DKFZp761B107	4	24437678	24590924	-	Hypothetical protein LOC91050	Novel	0	LTR10E/chr4:24474282-24474827:+
MARLIN1	4	6106386	6253183	-	Hypothetical protein FLJ25670.,multiple coiled-coil GABABR1-binding protein,	Novel	0	LTR10E/chr4:6110839-6111437:+
RBPSUH	4	25930429	26042376	+	Recombining binding protein suppressor of	Novel	0	LTR10E/chr4:26017181-26017715:-
ZNF718	4	43276	146488	+	Hypothetical protein LOC255403	Novel	0	MER61C/chr4:84853-85041:+
IL31RA	5	55182963	55240723	+	Interleukin 31RA splice variant x2	Novel	0	MER61C/chr5:55216862-55217287:-
MYO10	5	16718412	16989372	-	Hypothetical protein FLJ90236.	Novel	0	MER61C/chr5:16831494-16831797:+
AK131269	6	20209002	20320637	-	Hypothetical protein FLJ36675.	Novel	0	MER61E/chr6:20296615-20297170:-
BC011600	6	31529509	32034664	-	RD RNA binding protein.	Novel	0	MER61E/chr6:31562964-31563532:-
BC036553	6	118893160	119079747	-	OTTHUMP00000017094.	Novel	0	LTR10B1/chr6:119001900-119002359:+
C6orf204	6	118919310	119080376	-	Chromosome 6 open reading frame 204	Novel	0	LTR10B1/chr6:119001900-119002359:+
C6orf97	6	151856918	151981830	+	Hypothetical protein FLJ14394.	Novel	0	MER61E/chr6:151886683-151887173:-
GPR126	6	142664758	142809078	+	G protein-coupled receptor 126 alpha 1	Novel	0	MER61C/chr6:142739948-142740369:-
LOC389429	6	127940011	127954651	+	Hypothetical protein LOC389429	Novel	0	MER61C/chr6:127949099-127949464:-
OACT1	6	20208926	20320608	-	O-acyltransferase (membrane bound) domain containing 1	Novel	0	MER61E/chr6:20296615-20297170:-
SYNE1	6	152484515	152999679	-	Spectrin repeat containing, nuclear envelope 1	Novel	0	LTR10B1/chr6:152584683-152585151:+
TMEM30A	6	76019368	76051200	-	Hypothetical protein DKFZp686K1722.,transmembrane protein 30A,	Novel	0	LTR10E/chr6:76038622-76039154:+
ACN9	7	96584955	96649009	+	ACN9 homolog	Novel	0	MER61C/chr7:96635108-96635498:+
BC075797	7	12562711	12583336	+	Hypothetical protein.	Novel	0	LTR10D/chr7:12563384-12563890:-
C7orf10	7	40141099	40866882	+	Protein C7orf10 (Dermal papilla derived protein 13).	Novel	0	MER61C/chr7:40723319-40723742:-
CFTR	7	116907252	117095951	+	Cystic fibrosis transmembrane conductance	Novel	0	MER61C/chr7:117057713-117058116:-
COBL	7	51051403	51351990	-	Cordon-bleu homolog	Novel	0	LTR10C/chr7:51182488-51182933:-
EXOC4	7	132588362	133401051	+	SEC8 protein isoform a	Novel	0	MER61C/chr7:132925180-132925512:-
ZPBP	7	49947584	50103372	-	Zona pellucida binding protein	Novel	0	MER61C/chr7:49995834-49996251:+
AK130913	8	145889279	146016955	-	Hypothetical protein FLJ27403.	Novel	0	LTR10E/chr8:145897851-145898497:-
TSNARE1	8	143291348	143482444	-	Hypothetical protein LOC203062	Novel	0	LTR10E/chr8:143407351-143407908:+
UNQ9433	8	53609252	53640565	-	Hypothetical protein LOC389658	Novel	0	LTR10E/chr8:53621476-53622008:+
XKR4	8	56177570	56601262	+	X Kell blood group precursor-related family,	Novel	0	MER61E/chr8:56285741-56286285:-
AF338194	9	94029001	94633205	+	FKSG56 (Hepatocellular carcinoma-associated antigen HCA25b).	Novel	0	LTR10D/chr9:94097288-94097782:-
ANKRD18A	9	38561362	38610305	-	Ankyrin repeat domain 18A	Novel	0	MER61C/chr9:38573824-38574252:+
FGD3	9	94776601	94838332	+	FYVE, RhoGEF and PH domain containing 3	Novel	0	MER61C/chr9:94790122-94790562:-
IFT74	9	26946409	27052802	+	Coiled-coil domain containing 2	Novel	0	LTR10D/chr9:26966271-26966758:-
LOC441459	9	33514212	33565593	+	Hypothetical protein LOC441459	Novel	0	MER61C/chr9:33550109-33550537:-
PTGES3	9	68713875	68771498	+	Prostaglandin E synthase 3 (cytosolic),unactive progesterone receptor, 23 kD,	Novel	0	MER61C/chr9:68724105-68724516:-
PTGES3	9	43017657	43081468	-	Prostaglandin E synthase 3 (cytosolic),unactive progesterone receptor, 23 kD,	Novel	0	MER61C/chr9:43070818-43071229:+
FLJ46300	10	133454757	133472525	-	Hypothetical protein LOC399827	Novel	0	LTR10B1/chr10:133459941-133460022:-
PPAPDC1A	10	122206455	122339357	+	PPAPDC1A protein.,phosphatidic acid phosphatase type 2 domain,	Novel	0	LTR10E/chr10:122253602-122254161:-
PRKG1	10	52421123	53723827	+	cGMP-dependent protein kinase 1, alpha isozyme (EC 2.7.1.37) (CGK 1 alpha) (cGKI-alpha).	Novel	0	MER61E/chr10:53195795-53196382:-
DKFZp686O24166	11	17329884	17355444	+	Hypothetical protein LOC374383	Novel	0	MER61E/chr11:17347965-17348496:+
DKFZp686O24166	11	17329884	17355444	+	Hypothetical protein LOC374383	Novel	1367	MER61E/chr11:17356811-17357381:+
RIC3	11	8084224	8147127	-	Hypothetical protein DKFZp451C1317.,resistance to inhibitors of cholinesterase 3,	Novel	0	LTR10C/chr11:8116671-8117249:+
CLEC2A	12	9942538	9976213	-	C-type lectin domain family 2, member A	Novel	0	LTR10B1/chr12:9954779-9955276:-
CLEC2A	12	9942538	9976213	-	C-type lectin domain family 2, member A	Novel	811	MER61C/chr12:9941297-9941727:-
U80760	12	6304598	6648609	+	CAGH1 alternate open reading frame.	Novel	0	LTR10D/chr12:6486783-6487369:-
ZNF384	12	6304598	6648609	+	CAGH1 alternate open reading frame.	Novel	0	LTR10D/chr12:6486783-6487369:-
B3GTL	13	30672131	30803657	+	Beta 3-glycosyltransferase-like	Novel	0	MER61C/chr13:30742938-30743387:-
SPATA13	13	23632860	23696936	+	Hypothetical protein FLJ35435.	Novel	0	MER61C/chr13:23664004-23664410:-
MNAT1	14	60271222	60505149	+	Menage a trois 1 (CAK assembly factor)	Novel	0	MER61C/chr14:60472320-60472703:-
NRXN3	14	77706680	79398129	+	Neurexin 3	Novel	0	MER61E/chr14:78576645-78577166:-
ATPBD4	15	33450374	33625656	-	Hypothetical protein LOC89978	Novel	0	MER61C/chr15:33520149-33520261:+
CR627426	15	40655148	40752587	+	Hypothetical protein DKFZp686O248.	Novel	0	LTR10D/chr15:40750777-40751280:-
OCA2	15	25673615	26018053	-	Oculocutaneous albinism II (pink-eye dilution homolog, mouse)	Novel	0	LTR10C/chr15:25926904-25927497:+
OCA2	15	25673615	26018053	-		Novel	59681	LTR10D/chr15:25613436-25613934:+
SNRPN	15	22619886	22774822	+	Small nuclear ribonucleoprotein polypeptide N	Novel	0	LTR10D/chr15:22655038-22655539:+
CDH13	16	81218078	82387698	+	Cadherin 13 preproprotein	Novel	0	LTR10B1/chr16:81717237-81717811:-
MGC18079	16	27709712	27982323	-	KTSR5831.	Novel	0	MER61E/chr16:27912452-27913011:+
BC110608	17	25320326	25459595	+	Hypothetical protein FLJ46247.,hypothetical protein LOC374786 isoform 1,	Novel	0	MER61C/chr17:25355043-25355374:-
BC110608	17	25320326	25459595	+		Novel	0	LTR10E/chr17:25391823-25392319:+
CA10	17	47062680	47590422	-	Carbonic anhydrase X,carbonic anhydrase X,	Novel	0	MER61C/chr17:47552910-47553327:+
FLJ43826	17	34439684	34462984	+	Hypothetical protein LOC342666	Novel	0	LTR10E/chr17:34456527-34457037:+
FLJ46247	17	25320326	25459595	+	Hypothetical protein FLJ46247.,hypothetical protein LOC374786 isoform 1,	Novel	0	MER61C/chr17:25355043-25355374:-
FLJ46247	17	25320326	25459595	+		Novel	0	LTR10E/chr17:25391823-25392319:+
PPM1E	17	54188230	54417314	+	Hypothetical protein DKFZp781F1422.,protein phosphatase 1E,	Novel	0	LTR10B1/chr17:54344005-54344474:-
SEC14L1	17	72648616	72724774	+	SEC14 (S. cerevisiae)-like 1 isoform a	Novel	0	LTR10B1/chr17:72682415-72682886:-
AK124155	19	12064150	12071475	+	Hypothetical protein FLJ42161.	Novel	0	LTR10C/chr19:12069949-12070140:-
AK128700	19	12064077	12086499	+	Hypothetical protein FLJ46867.	Novel	0	LTR10C/chr19:12069949-12070140:-
DKKL1	19	54558853	54570183	+	Dickkopf-like 1 (soggy) precursor	Novel	0	LTR10E/chr19:54563716-54564311:+
IGFL2	19	51274061	51356385	+	Hypothetical protein FLJ43766.	Novel	0	LTR10C/chr19:51328304-51328890:-
MADCAM1	19	447489	456342	+	Mucosal vascular addressin cell adhesion	Novel	0	LTR10E/chr19:453613-454171:-
ZNF560	19	9438181	9470244	-	Hypothetical protein.	Novel	0	LTR10E/chr19:9458446-9459002:+
C20orf133	20	13924268	15981839	+	Hypothetical protein LOC140733 isoform 1	Novel	0	LTR10D/chr20:15233123-15233632:+
AK125338	21	26700132	26863442	+	Hypothetical protein FLJ43348.	Novel	0	MER61E/chr21:26735216-26735657:-
C21orf29	21	44742202	44955923	-	Chromosome 21 open reading frame 29	Novel	0	LTR10D/chr21:44842328-44842835:+
C21orf29	21	44742202	44955923	-	Chromosome 21 open reading frame 29	Novel	4807	LTR10C/chr21:44736821-44737395:+
BC012876	22	21094123	21568011	+	Hypothetical protein.	Novel	0	LTR10B1/chr22:21137054-21137608:+
BC030983	22	21003081	21578874	+	Hypothetical protein DKFZp667J0810 (Fragment)	Novel	0	LTR10B1/chr22:21137054-21137608:+
BC071725	22	21003081	21578874	+	Hypothetical protein DKFZp667J0810 (Fragment)	Novel	0	LTR10B1/chr22:21137054-21137608:+
IGLC1	22	20783109	21578968	+	Immunoglobulin lambda constant 1 (Mcg marker)	Novel	0	LTR10B1/chr22:21137054-21137608:+
X57820	22	21003081	21578874	+	Hypothetical protein DKFZp667J0810 (Fragment)	Novel	0	LTR10B1/chr22:21137054-21137608:+
FLJ20105	X	71341230	71375506	-	FLJ20105 protein.,hypothetical protein LOC54821 isoform b,hypothetical protein LOC54821 isoform a,	Novel	0	LTR10C/chrX:71364321-71364909:+
HS6ST2	X	131589163	131920557	-	Heparan sulfate 6-O-sulfotransferase 2	Novel	0	MER61C/chrX:131839780-131840203:-
LOC90167	X	131038703	131089729	-	Novel protein.,hypothetical protein LOC90167,	Novel	0	MER61C/chrX:131080005-131080391:-
SPANXE	X	140163264	140500736	-	SPANX-C.	Novel	0	LTR10E/chrX:140169160-140169541:+
UTX	X	44617724	44856787	+	Ubiquitously transcribed tetratricopeptide	Novel	0	MER61C/chrX:44719903-44720336:+
PRKY	Y	7202335	7295458	+	Protein kinase, Y-linked	Novel	0	LTR10D/chrY:7207387-7207898:-
TBL1Y	Y	6838726	7019723	+	Transducin beta-like 1Y	Novel	0	LTR10B1/chrY:6941150-6941640:+
ZNF561	19	9580139	9592899	-	Hypothetical protein FLJ90306.	Novel	461	LTR10C/chr19:9593360-9593927:-
AF229804	17	602649	605326	+	Endozepine-like protein type 2 mutant.	Novel	665	LTR10D/chr17:605991-606486:-
AK126077	15	60337442	60340906	+	Hypothetical protein FLJ44089.	Novel	1000	LTR10E/chr15:60341906-60342562:-
CNOT8	5	154218390	154236544	+	CCR4-NOT transcription complex, subunit 8	Novel	1345	LTR10B1/chr5:154237889-154237970:+
HERC5	4	89597329	89646333	+	Hect domain and RLD 5	Novel	1536	MER61C/chr4:89595400-89595793:-
GEMIN5	5	154247168	154297941	-	Gem (nuclear organelle) associated protein 5	Novel	1607	LTR10B1/chr5:154245480-154245561:+
C1orf99	1	185876980	185879609	+	Hypothetical protein LOC339476	Novel	1922	LTR10B1/chr1:185874561-185875058:+
							10034	LTR10B1/chr1:185866567-185866946:+
							232666	MER61E/chr1:185643770-185644314:-
TREML2	6	41267966	41276903	-	Triggering receptor expressed on myeloid cells-like 2	Novel	2033	MER61E/chr6:41265361-41265933:-
ZNF33A	10	38339619	38396287	+	Zinc finger protein 33a (KOX 31) (Hypothetical protein FLJ23404).	Novel	2148	LTR10B1/chr10:38336982-38337471:+
ZNF11B	10	42404560	42453998	-	Zinc finger protein 33B,zinc finger protein 11B,	Novel	2184	LTR10B1/chr10:42456182-42456631:-
ARSA	22	49410321	49413442	-	Arylsulfatase A precursor	Novel	2588	LTR10C/chr22:49407162-49407733:-
ADH5	4	100211154	100228954	-	Class III alcohol dehydrogenase 5 chi subunit	Novel	2953	LTR10C/chr4:100231907-100232418:-
MED4	13	47548092	47567241	-	Mediator of RNA polymerase II transcription,	Novel	3188	MER61C/chr13:47544507-47544904:+
							8892	MER61C/chr13:47538776-47539200:+
							61467	MER61C/chr13:47628708-47629043:+
BIRC8	19	58484667	58486687	-	Baculoviral IAP repeat-containing 8	Novel	3297	LTR10E/chr19:58489984-58490610:-
GCC2	2	108432067	108492285	+	GRIP and coiled-coil domain-containing 2 isoform,	Novel	3471	MER61C/chr2:108428166-108428596:+
FAM12A	14	20283938	20286378	+	Human epididymis-specific 3 alpha precursor	Novel	3632	LTR10B1/chr14:20290010-20290441:+
GSTM1	1	110031964	110037889	+	Glutathione S-transferase M1 isoform 1	Novel	3650	LTR10C/chr1:110027792-110028314:+
OR52K2	11	4427145	4428090	+	Olfactory receptor, family 52, subfamily K,	Novel	3766	LTR10B1/chr11:4431856-4432400:+
OR52K2	11	4427145	4428090	+	Olfactory receptor, family 52, subfamily K,	Novel	14015	LTR10B1/chr11:4442105-4442294:+
LOC343066	1	12627152	12649683	+	Hypothetical protein LOC343066	Novel	3784	LTR10B1/chr1:12623287-12623368:-
TMEM14C	6	10831323	10839344	+	Transmembrane protein 14C	Novel	4206	LTR10E/chr6:10826687-10827117:-
CPA2	7	129693959	129716871	+	Carboxypeptidase A2 (pancreatic)	Novel	4271	MER61C/chr7:129689265-129689688:+
AKR1B10	7	133862938	133876698	+	Aldo-keto reductase family 1, member B10	Novel	4771	LTR10D/chr7:133881469-133881975:+
SPANXB1	X	139912421	139913536	+	Sperm protein associated with the nucleus, X	Novel	4818	LTR10E/chrX:139907222-139907603:-
SPANXB1	X	139912421	139913536	+	Sperm protein associated with the nucleus, X	Novel	40630	MER61C/chrX:139871388-139871791:+
CLCA2	1	86662412	86694826	+	Calcium activated chloride channel 2	Novel	4911	MER61E/chr1:86699737-86700133:-
GLT6D1	9	137655322	137671207	-	Galactosyltransferase family 6 domain containing 1.	Novel	5027	LTR10B1/chr9:137676234-137676798:+
AK123794	1	110052236	110054435	+	Hypothetical protein FLJ41800.	Novel	5477	LTR10C/chr1:110046237-110046759:+
AK131420	19	20768459	20787695	+	DNA-binding protein (Fragment).	Novel	6142	LTR10C/chr19:20793837-20794414:-
AK026467	19	40511929	40519980	+	Hypothetical protein FLJ22814.	Novel	6146	LTR10C/chr19:40505195-40505783:-
KIAA1128	10	86078389	86268256	+	Granule cell antiserum positive 14	Novel	6571	MER61E/chr10:86274827-86275106:+
MFSD2	1	40193396	40208214	+	Novel protein (Fragment).,major facilitator superfamily domain containing,	Novel	6716	LTR10D/chr1:40214930-40215444:-
SEMA3C	7	80209790	80386603	-	Semaphorin 3C	Novel	6763	LTR10D/chr7:80202521-80203027:-
IMPAD1	8	58034918	58037024	-	Hypothetical protein FLJ33669.	Novel	6947	MER61C/chr8:58027570-58027971:+
GAS7	17	9754650	10042593	-	Growth-arrest-specific protein 7 (GAS-7).,growth arrest-specific 7 isoform b,growth arrest-specific 7 isoform c,	Novel	7067	MER61E/chr17:10049660-10050237:+
JMJD4	1	225985557	225989735	-	Jumonji domain containing 4	Novel	7387	LTR10E/chr1:225977717-225978170:-
BTBD15	11	129608336	129689791	-	BTBD15 protein.	Novel	7554	LTR10C/chr11:129697345-129697935:-
GLYAT	11	58232806	58256023	-	Glycine-N-acyltransferase isoform a	Novel	7838	MER61C/chr11:58263861-58264290:+
AK123968	12	123997323	124003933	-	DHX37 protein (Fragment).	Novel	7853	LTR10E/chr12:123988989-123989470:+
CHD1	5	98218808	98290138	-	Chromodomain helicase DNA binding protein 1	Novel	8419	MER61C/chr5:98210068-98210389:-
CHD1	5	98218808	98290138	-	Chromodomain helicase DNA binding protein 1	Novel	15351	MER61C/chr5:98203339-98203457:-
ANKRD20A3	9	67516580	67560111	+	Hypothetical protein LOC441425	Novel	8799	MER61C/chr9:67568910-67569321:-
ANKRD20A3	9	42358298	42401857	+	Hypothetical protein LOC441425	Novel	8808	MER61C/chr9:42410665-42411076:-
FLJ25369	2	88605283	88610217	+	Hypothetical protein LOC200523	Novel	8816	LTR10B1/chr2:88619033-88619457:+
SCGB2A1	11	61732715	61737984	+	Secretoglobin, family 2A, member 1	Novel	8871	LTR10E/chr11:61746855-61747475:+
AK095499	20	1403235	1420042	-	OTTHUMP00000029984.	Novel	9070	LTR10D/chr20:1429112-1429611:+
AKAP10	17	19749343	19821721	-	A-kinase anchor protein 10 precursor	Novel	9136	LTR10D/chr17:19830857-19831019:-
SAP130	2	128415266	128501337	-	mSin3A-associated protein 130	Novel	9525	LTR10B1/chr2:128510862-128511302:+
SAP130	2	128415266	128501337	-	mSin3A-associated protein 130	Novel	15577	LTR10B1/chr2:128516914-128517369:+
AK092379	10	29783276	29786234	+	Hypothetical protein FLJ35060.	Novel	9904	MER61C/chr10:29772995-29773372:-
ADAM21	14	69993969	69996374	+	ADAM metallopeptidase domain 21 preproprotein	Novel	10050	MER61C/chr14:69983585-69983919:-
SCGB1D4	11	61820329	61823112	-	Secretoglobin family 1D member 4	Novel	10108	LTR10D/chr11:61809726-61810221:+
OR1N1	9	124328457	124329393	-	Olfactory receptor, family 1, subfamily N,	Novel	10411	MER61E/chr9:124339804-124340383:-
CTBS	1	84791394	84812751	-	CTBS protein.	Novel	11300	MER61C/chr1:84824051-84824367:-
KIAA1576	16	76379983	76571502	+	Hypothetical protein LOC57687	Novel	11511	LTR10B1/chr16:76583013-76583559:+
KIAA1576	16	76379983	76571502	+	Hypothetical protein LOC57687	Novel	15768	LTR10B1/chr16:76587270-76587732:+
C1orf88	1	111690744	111697156	+	C1orf88 protein.	Novel	11560	LTR10D/chr1:111708716-111709215:-
ASCL4	12	106692291	106694544	+	Achaete-scute complex-like 4	Novel	11979	MER61C/chr12:106706523-106706930:-
HCG27	6	31278125	31279723	+	Hypothetical protein.	Novel	12320	LTR10B1/chr6:31292043-31292549:+
CCL23	17	31364209	31369118	-	Small inducible cytokine A23 isoform CKbeta8	Novel	12486	LTR10D/chr17:31381604-31382116:+
CR609923	6	31479364	31491040	+	Stress inducible class I homolog (OTTHUMP00000035033) (MHC class I polypeptide-related sequence A).	Novel	12747	MER61E/chr6:31466049-31466617:-
AF172850	1	142240478	142242715	-	Melanoma antigen.	Novel	12812	MER61C/chr1:142227283-142227666:-
AK097266	22	34392151	34394399	+	Hypothetical protein FLJ39947.	Novel	13177	MER61C/chr22:34407576-34408021:-
AK127178	3	188397571	188408111	-	Receptor-transporting protein 1.	Novel	13391	MER61C/chr3:188383770-188384180:+
TMEM12	10	129566103	129581201	-	Transmembrane protein 12	Novel	14147	LTR10B1/chr10:129551479-129551956:+
OPRK1	8	54300828	54326747	-	Opioid receptor, kappa 1	Novel	15145	LTR10B1/chr8:54341892-54342434:-
OPRK1	8	54300828	54326747	-	Opioid receptor, kappa 1	Novel	21136	LTR10B1/chr8:54347883-54348429:-
HLA-B	6	31429629	31432914	-	Major histocompatibility complex, class I, B	Novel	16276	LTR10E/chr6:31412741-31413353:-
HLA-B	6	31429629	31432914	-	Major histocompatibility complex, class I, B	Novel	24796	LTR10E/chr6:31404210-31404833:-
ARL6IP6	2	153283375	153325669	+	ADP-ribosylation-like factor 6 interacting	Novel	16919	LTR10B1/chr2:153266099-153266456:+
LOC401357	7	56844310	56847923	-	Hypothetical protein FLJ46235.,hypothetical protein LOC401357,	Novel	17215	LTR10E/chr7:56826529-56827095:-
AK128836	7	62855791	62865099	+	Hypothetical protein FLJ46348.	Novel	17241	LTR10E/chr7:62882340-62882906:+
RNASE1	14	20339355	20340876	-	Pancreatic ribonuclease precursor	Novel	17314	MER61E/chr14:20358190-20358706:-
THOC3	5	175319139	175327886	-	THO complex 3	Novel	17397	LTR10C/chr5:175345283-175345867:-
ZNF141	4	321623	359045	+	Zinc finger protein 141 (clone pHZ-44)	Novel	17521	LTR10C/chr4:376566-377136:+
C8orf22	8	50147459	50151195	+	Hypothetical protein LOC492307	Novel	18411	LTR10E/chr8:50169606-50170153:+
							34345	MER61E/chr8:50185540-50186107:+
							27776	LTR10E/chr8:50178971-50179518:+
C14orf101	14	56116263	56184038	+	Protein C14orf101.	Novel	18737	MER61E/chr14:56202775-56203310:+
BDNF	11	27633017	27637249	-	brain-derived neurotrophic factor isoform b,brain-derived neurotrophic factor isoform c,brain-derived neurotrophic factor isoform a,	Novel	18792	MER61E/chr11:27613684-27614225:-
BC045756	9	123257139	123301965	-	Hypothetical protein.	Novel	18998	MER61E/chr9:123320963-123321456:-
CACNG3	16	24174376	24281237	+	Voltage-dependent calcium channel gamma-3	Novel	19175	LTR10B1/chr16:24300412-24300907:-
AB037902	10	4917673	4924167	-	Truncated aldo-keto reductase (Fragment).	Novel	19195	MER61C/chr10:4943362-4943782:+
AB037902	10	4917673	4924167	-	Truncated aldo-keto reductase (Fragment).	Novel	26172	MER61C/chr10:4950339-4950759:-
PASD1	X	150482749	150595865	+	Hypothetical protein (Fragment).,PAS domain containing 1,	Novel	19576	MER61C/chrX:150462906-150463173:-
PASD1	X	150482749	150595865	+	Hypothetical protein (Fragment).,PAS domain containing 1,	Novel	24853	MER61C/chrX:150457511-150457896:-
C21orf81	21	14237966	14274631	-	Hypothetical protein LOC114035	Novel	20113	MER61C/chr21:14217443-14217853:+
AK127450	10	43266236	43270106	+	Hypothetical protein FLJ45542.	Novel	20269	MER61C/chr10:43290375-43290649:-
MS4A13	11	60039461	60066765	+	Testis-expressed transmembrane-4 protein splice variant b.,testis-expressed transmembrane-4 protein,	Novel	20757	MER61C/chr11:60087522-60087964:-
ALDH3B2	11	67186209	67198678	-	Aldehyde dehydrogenase 3B2	Novel	20962	LTR10E/chr11:67219640-67220243:-
LOC144097	11	63337498	63351765	+	Hypothetical protein LOC144097	Novel	21375	LTR10E/chr11:63315566-63316123:+
MRGPRE	11	3205617	3206636	-	MAS-related GPR, member E	Novel	21560	LTR10E/chr11:3228196-3228755:-
IGBP1	X	69270042	69302896	+	Immunoglobulin binding protein 1	Novel	21734	LTR10E/chrX:69247916-69248308:+
PPP2R5E	14	62911107	63079832	-	Epsilon isoform of regulatory subunit B56,	Novel	21827	MER61E/chr14:63101659-63102218:-
TEX10	9	102104192	102154995	-	Testis expressed sequence 10	Novel	22740	MER61C/chr9:102177735-102178119:-
ZAK	2	173648810	173840982	+	MLK-related kinase isoform 1	Novel	23206	MER61E/chr2:173864188-173864741:-
SPTA1	1	156847119	156923112	-	Spectrin, alpha, erythrocytic 1 (elliptocytosis 2)	Novel	23245	LTR10C/chr1:156823294-156823874:+
SYBL1	X	154764212	154826614	+	Synaptobrevin-like 1	Novel	24213	MER61E/chrX:154850827-154851388:-
SYBL1	Y	57623412	57685814	+	Synaptobrevin-like 1	Novel	24213	MER61E/chrY:57710027-57710588:-
BC040290	X	84075812	84076551	+	MGC42638 protein.	Novel	24296	LTR10C/chrX:84100847-84101463:+
BC026058	7	66405093	66422821	+	Hypothetical protein FLJ13195.	Novel	24416	MER61E/chr7:66447237-66447799:+
BC026058	7	66405093	66422821	+	Hypothetical protein FLJ13195.	Novel	36892	MER61E/chr7:66459713-66459937:-
ACTR3B	7	152087811	152183396	+	Actin-related protein 3-beta	Novel	25811	LTR10E/chr7:152061391-152062000:-
ACTR3B	7	152087811	152183396	+	Actin-related protein 3-beta	Novel	134530	LTR10D/chr7:152317926-152318434:+
PCMTD1	8	52895285	52974211	-	Protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	Novel	25909	MER61C/chr8:53000120-53000537:-
MGC44505	2	27213226	27215782	-	Hypothetical protein LOC339779	Novel	26037	LTR10B1/chr2:27241819-27242164:+
C1orf121	1	242882996	242938955	+	Hypothetical protein LOC51029	Novel	26423	MER61E/chr1:242965378-242965935:+
CUL1	7	148026865	148129134	+	cullin 1	Novel	26563	MER61C/chr7:147999968-148000302:-
UBE2F	2	238540438	238615415	+	NEDD8-conjugating enzyme	Novel	26981	MER61E/chr2:238513057-238513457:-
BC034966	1	181025494	181062778	+	Hypothetical protein.	Novel	27992	MER61E/chr1:180997049-180997502:-
UBE2G2	21	45013383	45046166	-	Ubiquitin-conjugating enzyme E2G 2 isoform 1	Novel	28338	MER61C/chr21:44984637-44985045:+
ZNF322B	9	98999357	99001731	-	Zinc finger protein 322B	Novel	28573	MER61C/chr9:98970356-98970784:+
TFDP3	X	132178362	132180042	-	Transcription factor Dp family, member 3	Novel	28736	MER61E/chrX:132208778-132209314:+
POLE4	2	75039282	75050366	+	DNA polymerase epsilon subunit 4	Novel	28779	MER61C/chr2:75079145-75079555:-
LOC399900	11	61491841	61493538	+	Hypothetical protein LOC399900	Novel	29464	LTR10E/chr11:61523002-61523592:+
NHLRC1	6	18228696	18230830	-	Malin	Novel	29771	MER61E/chr6:18198405-18198925:-
OR10H1	19	15778890	15779847	-	Olfactory receptor, family 10, subfamily H,	Novel	29896	LTR10C/chr19:15809743-15810265:+
SEC11L3	18	54958104	54977041	+	SEC11-like 3	Novel	30146	MER61C/chr18:55007187-55007475:-
DDHD1	14	52582492	52689750	-	DDHD domain containing 1	Novel	30675	LTR10C/chr14:52720425-52721008:-
SACS	13	22800966	22840626	-	Sacsin	Novel	30741	LTR10B1/chr13:22871367-22871916:+
CDC16	13	114018475	114056252	+	CDC16 cell division cycle 16 homolog (S. cerevisiae),	Novel	31047	MER61C/chr13:113987067-113987428:-
SERINC2	1	31658549	31680111	+	Tumor differentially expressed 2-like	Novel	32008	LTR10E/chr1:31712119-31712753:+
LALBA	12	47247734	47250096	-	Lactalbumin, alpha- precursor	Novel	32177	LTR10B1/chr12:47282273-47282730:+
CR603663	5	138310310	138561964	-	SIL1 protein precursor (BiP-associated protein precursor) (Hypothetical protein FLJ90696) (Endoplasmic reticulum chaperone SIL1, homolog of yeast).	Novel	33742	MER61E/chr5:138595706-138596169:-
FLJ11193	5	31568150	31590671	+	FLJ11193 protein.,hypothetical protein LOC55322,	Novel	34034	LTR10B1/chr5:31624705-31625243:-
SIPA1L1	14	71065794	71275871	+	Signal-induced proliferation-associated 1 like 1	Novel	34596	MER61E/chr14:71310467-71311023:+
FLJ45974	7	53690695	53847118	-	Hypothetical protein LOC401337	Novel	35237	LTR10C/chr7:53654869-53655458:-
FLJ45974	7	53690695	53847118	-	Hypothetical protein LOC401337	Novel	357384	MER61E/chr7:54204502-54205073:+
LHX8	1	75366706	75399804	+	LIM homeobox 8	Novel	36139	MER61C/chr1:75330267-75330567:-
PLSCR1	3	147715657	147745186	-	Phospholipid scramblase 1	Novel	37427	MER61E/chr3:147782613-147783120:+
AK127327	7	48857907	48861767	+	Hypothetical protein FLJ45398.	Novel	38123	MER61C/chr7:48899890-48900289:+
ELMO1	7	36860491	37454981	-	Engulfment and cell motility 1	Novel	39372	LTR10E/chr7:37494353-37494900:-
LOC388910	22	43343882	43346993	+	Hypothetical protein LOC388910	Novel	39536	LTR10E/chr22:43386529-43387156:-
SLITRK4	X	142543610	142550685	-	Slit and trk like 4 protein	Novel	40073	LTR10E/chrX:142502983-142503537:-
MAGEA9	X	148671401	148677201	+	Melanoma antigen family A, 9	Novel	41370	LTR10C/chrX:148718571-148719078:+
BC045575	17	41053758	41071107	+	MGC57346 protein.	Novel	43401	LTR10C/chr17:41009774-41010357:+
AUTS2	7	68702254	69895790	+	Autism susceptibility candidate 2	Novel	43586	LTR10E/chr7:69939376-69939764:+
AUTS2	7	68702254	69895790	+	Autism susceptibility candidate 2	Novel	56866	LTR10E/chr7:69952656-69953047:+
TRPC4	13	37109001	37341939	-	Transient receptor potential cation channel, subfamily C, member 4.	Novel	44990	MER61E/chr13:37386929-37387480:-
C6orf155	6	72180869	72187169	-	Hypothetical protein LOC79940	Novel	46230	MER61C/chr6:72134260-72134639:+
AKR1D1	7	137411735	137453590	+	Aldo-keto reductase family 1, member D1	Novel	46237	MER61E/chr7:137499827-137500394:-
AKR1D1	7	137411735	137453590	+	Aldo-keto reductase family 1, member D1	Novel	70073	LTR10B1/chr7:137523663-137524149:-
KCNK9	8	140693985	140784481	-	Potassium channel, subfamily K, member 9	Novel	47591	LTR10B1/chr8:140645843-140646394:-
CEACAM21	19	46774370	46785033	+	CEACAM3.,carcinoembryonic antigen-related cell adhesion,	Novel	47614	LTR10E/chr19:46726178-46726756:-
OSBPL8	12	75269710	75477720	-	MSTP120.	Novel	48209	MER61C/chr12:75525929-75526344:-
BC058286	15	29148880	29181221	-	Hypothetical protein.	Novel	49007	MER61E/chr15:29230228-29230726:+
TTTY14	Y	19553974	19698690	-	Testis-specific transcript, Y-linked 14	Novel	49624	LTR10B1/chrY:19748314-19748751:+
C5orf3	5	153351457	153398619	-	Hypothetical protein LOC10827	Novel	50142	LTR10B1/chr5:153300742-153301315:+
MGC46496	4	98699056	99283414	-	Hypothetical protein LOC285555	Novel	50338	LTR10E/chr4:99333752-99334374:-
PNOC	8	28230567	28256785	+	Prepronociceptin	Novel	50505	LTR10C/chr8:28179465-28180062:-
ZNF431	19	21116727	21160645	+	Zinc finger protein 431	Novel	50758	LTR10C/chr19:21211403-21211987:+
C12orf35	12	32029258	32037306	+	Hypothetical protein FLJ10652.	Novel	50941	LTR10B1/chr12:32088247-32088708:-
MGC26718	18	14169095	14175368	+	Hypothetical protein LOC440482	Novel	50952	MER61C/chr18:14226320-14226730:-
AF338194	21	18012926	18014603	+	FKSG56 (Hepatocellular carcinoma-associated antigen HCA25b).	Novel	51224	MER61C/chr21:17961366-17961702:-
AK122798	12	22995326	22997930	+	Hypothetical protein FLJ16370.	Novel	51535	MER61E/chr12:22943221-22943791:-
AK122798	12	22995326	22997930	+	Hypothetical protein FLJ16370.	Novel	119833	MER61C/chr12:22875136-22875493:-
CTGF	6	132311017	132314147	-	Connective tissue growth factor,connective tissue growth factor,	Novel	52391	LTR10B1/chr6:132366538-132366910:+
LOC139886	X	62483832	62487936	-	Hypothetical protein.,hypothetical protein LOC139886,	Novel	52743	MER61E/chrX:62540679-62541234:-
ZXDB	X	57634993	57640631	+	Zinc finger, X-linked, duplicated B	Novel	53106	MER61C/chrX:57693737-57694159:+
RALA	7	39629686	39714240	+	Ras related v-ral simian leukemia viral oncogene	Novel	53472	LTR10B1/chr7:39767712-39767942:+
TXNRD1	12	103204856	103268188	+	Thioredoxin reductase 1	Novel	53605	LTR10E/chr12:103150646-103151251:-
BC007251	14	31614386	31615519	-	Hypothetical protein C14orf128.	Novel	54133	MER61E/chr14:31559678-31560253:-
EPM2AIP1	3	37004234	37009799	-	EPM2A interacting protein 1	Novel	54308	LTR10D/chr3:36949436-36949926:+
GAS8	16	88616508	88638880	+	Growth arrest-specific 8	Novel	54325	LTR10C/chr16:88693205-88693797:+
PPP1R2P9	X	42521562	42522356	-	Protein phosphatase 1, regulatory (inhibitor) subunit 2 pseudogene 9	Novel	55376	LTR10C/chrX:42577732-42578322:+
							191404	MER61E/chrX:42713760-42714108:-
							198359	MER61E/chrX:42720715-42721236:-
KIAA1383	1	231007394	231010586	-	KIAA1383	Novel	55654	LTR10B1/chr1:230951168-230951740:+
KIAA0274	6	110119160	110253327	+	Sac domain-containing inositol phosphatase 3	Novel	56521	LTR10E/chr6:110309848-110310415:-
TGFBR2	3	30622997	30710635	+	TGF-beta type II receptor isoform A precursor,TGF-beta type II receptor isoform B precursor,	Novel	57456	MER61C/chr3:30565107-30565541:+
C9orf47	9	90795597	90798068	+	Protein C9orf47 precursor.	Novel	57762	MER61C/chr9:90737449-90737835:-
SLITRK1	13	83349344	83354529	-	Slit and trk like 1 protein	Novel	59305	MER61E/chr13:83413834-83414381:+
IMMP2L	7	110389603	110989774	-	Hypothetical protein IMMP2L (Fragment).	Novel	59727	MER61E/chr7:111049501-111050068:+
SEMA3E	7	82831157	83116260	-	Semaphorin 3E	Novel	59845	MER61E/chr7:83176105-83176684:+
ZNF195	11	3335733	3356929	-	Hypothetical protein DKFZp666D035.	Novel	61175	LTR10E/chr11:3273999-3274558:-
C18orf2	18	1244389	1349440	-	Putative C18orf2 variant 3.,hypothetical protein LOC56651,	Novel	62443	LTR10B1/chr18:1181470-1181946:-
BC042429	2	94898148	94976810	-	Hypothetical protein.	Novel	63858	MER61C/chr2:94833879-94834290:+
MCPH1	8	6251529	6488548	+	Microcephaly, primary autosomal recessive 1,microcephalin,	Novel	67097	MER61C/chr8:6183988-6184432:+
KIAA1729	4	10050601	10068130	-	CDNA FLJ25343 fis, clone TST01040.,hypothetical protein LOC85460,	Novel	67747	MER61C/chr4:9982463-9982854:-
LOC348840	3	199269336	199291988	-	Hypothetical protein FLJ43952.	Novel	69552	LTR10C/chr3:199361540-199362132:+
TBX3	12	113592441	113606352	-	T-box 3 protein isoform 2	Novel	69956	MER61C/chr12:113522175-113522485:+
AK127532	20	46126627	46129816	+	Hypothetical protein FLJ45625.	Novel	71056	MER61E/chr20:46055049-46055571:-
RANBP6	9	6001019	6005618	-	RAN binding protein 6	Novel	71730	LTR10D/chr9:6077348-6077859:+
CNTN1	12	39372624	39750361	+	Contactin 1 isoform 1 precursor	Novel	71990	MER61C/chr12:39822351-39822771:-
LOC442247	6	112775224	112779191	+	Hypothetical protein LOC442247	Novel	75222	LTR10C/chr6:112854413-112854805:+
KIF5B	10	32340076	32385221	-	Kinesin family member 5B	Novel	76031	MER61C/chr10:32461252-32461647:-
NY-REN-7	5	177082971	177140283	-	Hypothetical protein LOC285596	Novel	76867	LTR10C/chr5:177217150-177217734:+
THRAP1	17	57377823	57497425	-	Thyroid hormone receptor associated protein 1	Novel	78854	MER61E/chr17:57576279-57576682:+
YTHDC2	5	112877308	112958878	+	YTH domain containing 2,YTH domain containing 2,	Novel	79654	MER61E/chr5:113038532-113039089:-
AK125309	X	6154398	6158332	+	Hypothetical protein FLJ43319.	Novel	80482	MER61E/chrX:6238814-6239343:-
BC047021	11	114545165	114880451	-	Secretory isoform of TSLC-1.	Novel	82911	MER61E/chr11:114963362-114963912:-
RCBTB2	13	47961101	48005317	-	Regulator of chromosome condensation and BTB	Novel	85921	MER61E/chr13:48091238-48091800:+
CACNA1B	9	139892061	140136452	+	Calcium channel, voltage-dependent, L type,	Novel	87912	LTR10C/chr9:140224364-140224956:+
FGF10	5	44340853	44424541	-	Fibroblast growth factor 10 precursor	Novel	90479	MER61E/chr5:44515020-44515577:+
CR604753	14	65548904	65550391	-	RcNSEP1 (Fragment).	Novel	90647	MER61C/chr14:65641038-65641418:+
TRIM36	5	114488365	114543755	-	HAPRIN-a2 (Fragment).	Novel	91493	MER61E/chr5:114396375-114396872:+
TRIM36	5	114488365	114543755	-	HAPRIN-a2 (Fragment).	Novel	199507	MER61C/chr5:114288427-114288858:+
SH2D4B	10	82287637	82396296	+	SH2 domain containing 4B	Novel	100971	LTR10D/chr10:82497267-82497773:+
							158921	LTR10B1/chr10:82555217-82555617:+
							531222	LTR10E/chr10:82927518-82928045:-
							797722	MER61C/chr10:83194018-83194437:+
ZFP64	20	50133957	50241931	-	Zinc finger protein 64 isoform d	Novel	105480	MER61E/chr20:50028054-50028477:+
PABPCP2	2	147061730	147065027	+	Poly(A) binding protein, cytoplasmic, pseudogene 2	Novel	106005	MER61E/chr2:147171032-147171598:-
FLJ21908	12	46343341	46386041	-	Hypothetical protein LOC79657	Novel	106457	MER61E/chr12:46236356-46236884:+
PVRL3	3	112273415	112335509	+	PVRL3 protein.	Novel	106829	LTR10C/chr3:112166014-112166586:-
FAM3C	7	120776140	120823577	-	Predicted osteoblast protein	Novel	109382	LTR10B1/chr7:120932959-120933434:-
FAM3C	7	120776140	120823577	-	Predicted osteoblast protein	Novel	114705	LTR10B1/chr7:120938282-120938743:-
C18orf21	18	31806585	31813238	+	Chromosome 18 open reading frame 21	Novel	109948	MER61E/chr18:31696086-31696637:+
AF217970	8	8135302	8139795	+	Hypothetical protein.	Novel	113723	LTR10E/chr8:8253518-8254097:-
AF217970	8	8135302	8139795	+	Hypothetical protein.	Novel	117748	LTR10E/chr8:8257543-8258196:-
BPY2	Y	25586439	25607639	-	Variable charge, Y chromosome, 2 protein	Novel	114273	LTR10E/chrY:25721912-25722492:+
BPY2	Y	25173538	25194738	+	Variable charge, Y chromosome, 2 protein	Novel	114276	LTR10E/chrY:25058673-25059262:-
BPY2	Y	23539797	23560996	+	Variable charge, Y chromosome, 2 protein	Novel	114284	LTR10E/chrY:23424933-23425513:-
SOCS6	18	66107242	66145328	+	Suppressor of cytokine signaling 6	Novel	115946	LTR10B1/chr18:66261274-66261742:-
SMC2L1	9	105896427	105941758	+	Structural maintenance of chromosomes 2-like 1	Novel	116396	LTR10E/chr9:106058154-106058717:+
C18orf34	18	28771586	29274683	-	Hypothetical protein LOC374864	Novel	119902	MER61C/chr18:29394585-29394973:-
C18orf34	18	28771586	29274683	-	Hypothetical protein LOC374864	Novel	125810	MER61C/chr18:29400493-29400904:-
HS3ST4	16	25610847	26056509	+	Heparan sulfate D-glucosaminyl	Novel	122677	MER61E/chr16:25487609-25488170:-
HS3ST4	16	25610847	26056509	+	Heparan sulfate D-glucosaminyl	Novel	137947	MER61E/chr16:25472353-25472900:-
PAMCI	12	84722461	84754214	-	Peptidylglycine alpha-amidating monooxygenase	Novel	122769	LTR10C/chr12:84599118-84599692:+
PHF17	4	129950307	130004685	+	Jade1 protein short isoform	Novel	123270	MER61E/chr4:129826501-129827037:-
TMTC4	13	100054188	100125050	-	OTTHUMP00000018649.	Novel	124063	MER61E/chr13:100249113-100249504:-
ZNF664	12	123023622	123065920	+	Zinc finger protein 664	Novel	127141	MER61E/chr12:123193061-123193632:+
BC020894	11	111636197	111637327	+	Placenta expressed transcript 1 (Fragment).	Novel	127205	MER61E/chr11:111764532-111765062:+
AL832377	22	16336627	16413032	+	Hypothetical protein DKFZp451I027 (Hypothetical protein DKFZp451G017)	Novel	127547	LTR10D/chr22:16208893-16209080:+
C12orf28	12	68606703	68638770	+	Hypothetical protein LOC196446	Novel	132113	MER61E/chr12:68770883-68771441:-
FLJ11151	16	12664437	12805225	-	Hypothetical protein LOC55313	Novel	136473	LTR10B1/chr16:12941698-12942092:+
ITM2A	X	78502536	78509703	-	Integral membrane protein 2A	Novel	138586	MER61C/chrX:78648289-78648717:+
ITM2A	X	78502536	78509703	-	Integral membrane protein 2A	Novel	148338	MER61C/chrX:78658041-78658464:+
FLJ25422	5	36284861	36337761	-	Hypothetical protein LOC202151	Novel	140265	MER61E/chr5:36478026-36478546:-
NEUROD4	12	53706622	53710065	+	NEUROD4 protein.	Novel	142744	MER61C/chr12:53852809-53853211:+
EDIL3	5	83273881	83716367	-	EGF-like repeats and discoidin I-like	Novel	154743	LTR10C/chr5:83871110-83871700:+
EDIL3	5	83273881	83716367	-	EGF-like repeats and discoidin I-like	Novel	935637	MER61C/chr5:84652004-84652413:-
FLJ36004	12	25520311	25597453	-	FLJ36004 protein.,hypothetical protein FLJ36004,	Novel	157834	LTR10E/chr12:25755287-25755821:-
AK125281	7	291780	294704	+	Hypothetical protein FLJ43291.	Novel	158227	LTR10C/chr7:132964-133553:-
STXBP5	6	147566567	147748584	+	Tomosyn	Novel	159118	LTR10C/chr6:147406898-147407449:-
FLJ41649	6	40420061	40431723	-	Hypothetical protein LOC401260	Novel	159846	LTR10B1/chr6:40259618-40260215:-
AL833119	11	22798432	22807957	-	Small VCP/p97-interacting protein.	Novel	162836	LTR10B1/chr11:22970793-22971241:-
AL833119	11	22798432	22807957	-	Small VCP/p97-interacting protein.	Novel	170444	LTR10B1/chr11:22978401-22978851:-
RNF190	17	58132407	58239437	-	Ring finger protein 190,ring finger protein 190,hypothetical protein LOC162333,	Novel	168236	LTR10C/chr17:58407673-58408286:+
LSAMP	3	117011839	117647068	-	Limbic system-associated membrane protein	Novel	172637	MER61E/chr3:117819705-117820271:+
NDUFA4	7	10939339	10946338	-	NADH dehydrogenase (ubiquinone) 1 alpha	Novel	173387	LTR10B1/chr7:10765411-10765952:-
FSTL5	4	162524500	163304636	-	Follistatin-like 5,follistatin-like 5,	Novel	174133	LTR10D/chr4:163478769-163479120:-
FSIP2	2	186318511	186339521	+	Fibrous sheath interacting protein 2	Novel	177237	MER61C/chr2:186140845-186141274:-
MAGEB6	X	26120477	26123683	+	Melanoma antigen family B, 6	Novel	178106	MER61C/chrX:26301789-26302220:-
LARGE	22	31999062	32646410	-	Like-glycosyltransferase	Novel	179218	LTR10C/chr22:32825628-32826208:+
ZNF521	18	20895888	21186114	-	Hypothetical protein FLJ11390.	Novel	181074	MER61E/chr18:21367188-21367732:+
BCKDHB	6	80873082	81112709	+	Branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease)	Novel	189780	LTR10E/chr6:81302489-81303019:-
CPXCR1	X	87888911	87896435	+	Hypothetical protein LOC53336	Novel	189896	MER61E/chrX:88086331-88086883:+
PEX5L	3	181001547	181237419	-	Peroxisomal biogenesis factor 5-like	Novel	190610	MER61C/chr3:181428029-181428470:+
PEX5L	3	181001547	181237419	-	Peroxisomal biogenesis factor 5-like	Novel	198573	MER61C/chr3:181435992-181436423:+
ANXA10	4	169250281	169345466	+	Annexin A10	Novel	195092	MER61C/chr4:169054859-169055189:-
HDHD1A	X	6976960	7076189	-	Haloacid dehalogenase-like hydrolase domain	Novel	195615	MER61E/chrX:6780792-6781345:-
OLFM3	1	102040722	102235136	-	NOELIN3_V3.	Novel	197481	MER61C/chr1:102432617-102432991:+
GK2	4	80546531	80548396	-	Glycerol kinase 2	Novel	199426	LTR10C/chr4:80346517-80347105:+
ZPLD1	3	103636548	103681375	+	Hypothetical protein LOC131368	Novel	212775	MER61C/chr3:103894150-103894571:-
FIGN	2	164173068	164300763	-	Hypothetical protein FLJ22094.,fidgetin,	Novel	217187	MER61E/chr2:164517950-164518512:-
C20orf19	20	21054662	21163377	+	OTTHUMP00000030398.	Novel	225379	MER61C/chr20:20828862-20829283:-
KU-MEL-3	6	4555844	4557151	+	KU-MEL-3 protein	Novel	226284	LTR10B1/chr6:4329116-4329560:+
AK026367	Y	21954251	22023120	-	Hypothetical protein FLJ22714.	Novel	230929	LTR10B1/chrY:21722856-21723322:-
TRIM61	4	166095049	166118268	-	Tripartite motif-containing 61	Novel	233089	MER61E/chr4:165861385-165861960:+
PAPSS1	4	108754271	108860741	-	Hypothetical protein PAPSS1 (Fragment).	Novel	233633	LTR10D/chr4:108520140-108520638:+
PTER	10	16518972	16595742	+	Phosphotriesterase related	Novel	239626	LTR10B1/chr10:16278784-16279346:+
VCX	X	7770302	7772183	+	Variable charge, X chromosome	Novel	240298	LTR10C/chrX:7529624-7530004:+
ARPP-21	3	35657513	35810953	+	ARPP-21 protein.	Novel	247698	MER61C/chr3:35409370-35409815:+
AK124203	12	58292689	58294872	+	Hypothetical protein FLJ42209.	Novel	254369	MER61C/chr12:58037896-58038320:+
RGS18	1	190394214	190421566	+	Regulator of G-protein signalling 18	Novel	256351	MER61C/chr1:190137561-190137863:+
JAG1	20	10566333	10602590	-	Jagged 1 precursor	Novel	259987	MER61C/chr20:10862577-10862995:-
COL22A1	8	139669660	139995418	-	Collagen, type XXII, alpha 1	Novel	265346	MER61E/chr8:140260764-140261320:-
CTNNA2	2	79593633	80729415	+	Catenin (cadherin-associated protein), alpha 2	Novel	277342	MER61C/chr2:81006757-81007186:-
GLULD1	6	64047518	64087841	-	Glutamate-ammonia ligase (glutamine synthase)	Novel	280018	LTR10D/chr6:63766992-63767500:-
CR625823	13	81162046	81163187	+	OTTHUMP00000018545.	Novel	294216	MER61C/chr13:80867532-80867830:-
TRHDE	12	70952729	71345688	+	Thyrotropin-releasing hormone degrading enzyme	Novel	309399	LTR10B1/chr12:71655087-71655653:-
SUCLA2	13	47414792	47473427	-	Hypothetical protein DKFZp564P2062 (Fragment).	Novel	310664	MER61C/chr13:47103713-47104128:-
IL7	8	79807560	79880313	-	Interleukin 7 precursor	Novel	314234	LTR10B1/chr8:80194547-80195104:+
IL7	8	79807560	79880313	-	Interleukin 7 precursor	Novel	318575	LTR10B1/chr8:80198888-80199442:+
GRAMD3	5	125786999	125857945	+	Hypothetical protein LOC65983	Novel	314498	MER61C/chr5:125472105-125472501:+
POU1F1	3	87391472	87408427	-	POU domain, class 1, transcription factor 1	Novel	330535	LTR10B1/chr3:87738962-87739513:-
PDGFC	4	157902213	158111996	-	Platelet-derived growth factor C precursor	Novel	343451	MER61C/chr4:157558372-157558762:+
TUBA2	13	18645919	18653936	-	Tubulin, alpha 2 isoform 2	Novel	348607	MER61C/chr13:18296902-18297312:+
IMMP2L	7	110090345	110989583	-	IMP2 inner mitochondrial membrane protease-like	Novel	353887	MER61C/chr7:109736058-109736458:-
KHDRBS2	6	62447823	63054091	-	KH domain-containing, RNA-binding, signal	Novel	357752	MER61E/chr6:63411843-63412370:-
LPHN3	4	62045433	62620762	+	Latrophilin 3 precursor	Novel	358959	MER61C/chr4:62979721-62980154:-
KCTD12	13	76355305	76358371	-	Potassium channel tetramerisation domain containing 12	Novel	360812	MER61C/chr13:75994060-75994493:-
TTTY11	Y	8711362	8745423	-	Testis-specific transcript, Y-linked 11	Novel	361162	LTR10E/chrY:8349613-8350200:-
LRP1B	2	140705465	142605740	-	Low density lipoprotein-related protein 1B	Novel	366017	MER61E/chr2:140338912-140339448:+
CBLB	3	106859799	107070577	-	Cas-Br-M (murine) ecotropic retroviral	Novel	367524	MER61C/chr3:107438101-107438454:+
SQRDL	15	43714547	43770770	+	Sulfide dehydrogenase like	Novel	378170	LTR10B1/chr15:44148940-44149513:-
ZWINT	10	57787204	57791040	-	ZW10 interactor isoform a	Novel	384331	MER61C/chr10:58175371-58175700:+
ZNF659	3	21437672	21767820	-	Zinc finger protein 659	Novel	392411	MER61C/chr3:21044841-21045261:-
USP9Y	Y	13322553	13482162	+	Ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila),	Novel	394784	MER61E/chrY:12927214-12927769:+
USP9Y	Y	13322553	13482162	+		Novel	793316	LTR10E/chrY:12528686-12529237:+
NCAM2	21	21292503	21833085	+	Neural cell adhesion molecule 2 precursor	Novel	405508	MER61E/chr21:20886462-20886995:-
NMUR2	5	151751302	151765017	-	Neuromedin U receptor 2	Novel	406761	LTR10B1/chr5:152171778-152172248:+
MAN1A1	6	119540967	119712625	-	Mannosidase, alpha, class 1A, member 1	Novel	415015	LTR10D/chr6:120127640-120128136:-
SORCS1	10	108323411	108914282	-	SORCS receptor 1 isoform b	Novel	420801	MER61E/chr10:109335083-109335653:-
SORCS1	10	108323411	108914282	-	SORCS receptor 1 isoform b	Novel	875193	LTR10B1/chr10:109789475-109789907:-
CSMD3	8	113304332	114518418	-	CUB and Sushi multiple domains 3,CUB and Sushi multiple domains 3 isoform 1,CUB and Sushi multiple domains 3 isoform 2,	Novel	422084	MER61C/chr8:114940502-114940919:+
BC024198	6	66554492	66555911	+	Hypothetical protein.	Novel	425406	MER61C/chr6:66981317-66981668:+
FLJ21511	4	48683021	48758850	+	Hypothetical protein LOC80157	Novel	432882	MER61C/chr4:49191732-49192135:+
CDH9	5	26916465	27074431	-	Cadherin 9, type 2 (T1-cadherin)	Novel	433507	MER61C/chr5:27507938-27508351:+
CDH9	5	26916465	27074431	-	Cadherin 9, type 2 (T1-cadherin)	Novel	438976	MER61C/chr5:27513407-27513859:+
TMEFF2	2	192522993	192767889	-	Transmembrane protein with EGF-like and two follistatin-like domains 2	Novel	460932	MER61C/chr2:193228821-193229249:-
TUSC3	8	15442100	15666364	+	Tumor suppressor candidate 3 isoform a	Novel	461931	MER61C/chr8:14979766-14980169:+
LRRC7	1	69806720	70113275	+	OTTHUMP00000065338.	Novel	512632	MER61E/chr1:69293523-69294088:+
AK094187	3	75861802	75864437	-	Hypothetical protein FLJ36868.	Novel	520444	MER61C/chr3:75341027-75341358:+
LOC119710	11	36572644	36637396	+	LOC119710 protein (HEPIS).	Novel	521457	LTR10C/chr11:37158853-37159443:-
HTR2C	X	113724806	114050880	+	5-hydroxytryptamine (serotonin) receptor 2C	Novel	523352	MER61E/chrX:113200890-113201454:+
CDH11	16	63538185	63713420	-	Cadherin 11, type 2 preproprotein	Novel	524536	MER61E/chr16:63013116-63013649:-
CNTN3	3	74394411	74653033	-	Contactin 3	Novel	527274	MER61E/chr3:75180307-75180867:-
C14orf106	14	44742143	44792146	-	Chromosome 14 open reading frame 106	Novel	532139	MER61E/chr14:45324285-45324840:+
C14orf106	14	44742143	44792146	-	Chromosome 14 open reading frame 106	Novel	539914	MER61E/chr14:45332060-45332677:+
AK097143	6	141944498	142393247	-	Hypothetical protein FLJ39824.	Novel	541292	MER61C/chr6:141402974-141403206:+
CENTD1	4	35744016	35837758	-	Centaurin delta 1 isoform b	Novel	545610	MER61C/chr4:35197979-35198406:-
CTNND2	5	11024951	11957110	-	Catenin (cadherin-associated protein), delta 2	Novel	556857	LTR10E/chr5:12513967-12514574:+
AK127969	13	63300980	63315575	-	Hypothetical protein FLJ46084.	Novel	578754	MER61C/chr13:62721936-62722226:+
DUSP26	8	33568392	33576981	-	DUSP26 protein.,dual specificity phosphatase 26,	Novel	597007	MER61C/chr8:34173988-34174411:-
CDH5	16	64958063	64996189	+	Cadherin 5, type 2 preproprotein,cadherin 5, type 2, VE-cadherin (vascular epithelium),	Novel	597233	MER61E/chr16:64360267-64360830:-
MAT2B	5	162865197	162878911	+	Hypothetical protein Nbla02999.	Novel	600394	MER61C/chr5:163479305-163479721:-
DMD	X	31047265	33267647	-	Dystrophin Dp427c isoform,dystrophin Dp427m isoform,dystrophin Dp427p1 isoform,dystrophin Dp427p2 isoform,dystrophin (muscular dystrophy, Duchenne and Becker types),	Novel	616598	MER61E/chrX:33884245-33884822:-
FLJ40296	13	56613052	56616074	+	Hypothetical protein LOC122183	Novel	628035	LTR10E/chr13:55984487-55985017:+
RP1-32F7.2	X	92815860	92853917	+	Hypothetical protein LOC286499	Novel	648495	MER61C/chrX:93502412-93502847:-
SLITRK5	13	87122870	87129869	+	SLIT and NTRK-like family, member 5	Novel	651005	LTR10D/chr13:87780874-87781380:+
LOC203413	X	115506879	115508165	-	Hypothetical protein LOC203413	Novel	682661	MER61C/chrX:116190826-116191248:+
RWDD3	1	95472354	95485361	+	RWD domain containing 3	Novel	685826	MER61C/chr1:96171187-96171618:-
AF116706	3	147265047	147266852	+	PRO2533.	Novel	706595	LTR10B1/chr3:146558068-146558452:-
AF116706	3	147265047	147266852	+	PRO2533.	Novel	710115	LTR10D/chr3:146554439-146554932:-
TSN	2	122229590	122241896	+	Translin	Novel	752017	MER61E/chr2:122993913-122994478:+
NUDT12	5	102912455	102926389	-	Nudix -type motif 12	Novel	753901	LTR10E/chr5:103680290-103680808:+
BC040320	13	90798074	90804830	+	Chromosome 13 open reading frame 25 variant 1 (OTTHUMP00000018549).	Novel	755383	MER61E/chr13:90042154-90042691:+
BC068609	19	33618134	33910427	-	Hypothetical protein.	Novel	775480	LTR10E/chr19:32842071-32842654:-
DPP10	2	114916368	116318406	+	Dipeptidyl peptidase 10 isoform long	Novel	814725	MER61C/chr2:117133131-117133397:-
KCNC2	12	73720123	73888051	-	Kv3.2d voltage-gated potassium channel.,Shaw-related voltage-gated potassium channel,	Novel	835464	MER61E/chr12:72883942-72884659:+
HACE1	6	105282660	105414451	-	Hypothetical protein DKFZp434M0621.	Novel	848041	MER61C/chr6:104434189-104434619:+
DKFZp564N2472	7	53070842	53072111	+	Hypothetical protein LOC285877	Novel	851069	LTR10E/chr7:52219160-52219773:+
NDST4	4	115968379	116254481	-	N-deacetylase/N-sulfotransferase	Novel	855823	MER61C/chr4:117110304-117110643:-
FRK	6	116369386	116488614	-	Fyn-related kinase	Novel	870157	LTR10B1/chr6:115498692-115499229:+
MYOM2	8	1980654	2080779	+	Myomesin 2	Novel	933893	LTR10D/chr8:3014672-3015125:+
TRIB2	2	12774658	12800307	+	Tribbles homolog 2	Novel	939249	LTR10E/chr2:13739556-13740110:+
GRIK2	6	101953674	102623474	+	Glutamate receptor, ionotropic, kainate 2,glutamate receptor 6 isoform 1 precursor,glutamate receptor 6 isoform 2 precursor,	Novel	971980	MER61C/chr6:103595454-103595782:-
CDY2B	Y	18499533	18501493	-	Y chromosome chromodomain protein 2B	Novel	990805	MER61E/chrY:17508181-17508728:-
PRKX	X	3532412	3641649	-	Protein kinase, X-linked	Novel	997027	MER61E/chrX:4638676-4639232:+

Genes that are closest to but no further than 1 Mb from p53 site-containing LTRs. The Gene symbol column contains names of genes used in the University of California Santa Cruz Genome Browser Database; Chromosome column contains the chromosome on which the gene resides; txStart indicates transcription start site; txEnd indicates transcription termination site; strand indicates on which strand the gene resides; Description contains a general description of the gene; p53 target column indicates if the gene is a known target of p53 or a novel predicted target; distance indicates the genomic interval between the ERV element and the gene, with 0 indicating that the element is within gene boundary (in introns); LTR column gives the name of the ERV that contains p53 sites as well as its genomic location and strand orientation.

Table 7. Primers used

Primer name	Sequence	Purpose	Target	Target genomic location
DHX37f	GGGTGGGAGGAGTGACTTTT	ChIP-qPCR	DHX37	chr12:123989165-123989620
DHX37r	ACATGCTCACAGGCACGTAG
NEOf	AAATAGTCAACAAGCATGGTAAAAA	ChIP-qPCR	Neogenin	chr15:71244907-71245405
NEOr	AAGACATGTCCACAGCCACA
PTPRMf	CACCATGCAGGAGTTGAAGA	ChIP-qPCR	PTPRM	chr18:7718203-7718546
PTPRMr	GCTGATGTGTGCCAGCTTTA
TMEM12f	CAGGGAGGGGGCAGGAGTG	ChIP-qPCR	TMEM12	chr10:129551335-129551676
TMEM12r	GAGGCCCAAAGAGGAAGAGTCAAA
TWo1	GCTGGCAGGTCTGAGTAACC	qRT-PCR	TP53AP1	chr7:86808814-86808912
TWo2	TGCCACTCTCTGCTGTCATC
TWo5	CTGGAGACTCTCAGGGTCGAA	qRT-PCR	p21	chr6:36760257-36761642
TWo6	ACACACAAACTGAGACTAAGGCAGA
TWo11	GCTCGGTGCATCCTTCGTTTTT	qRT-PCR	TMEM12	chr10:129566461-129566682
TWo12	CGCTGGTATCTGGCCTTCTGGT
TWo13	CTACTGCCTGCTGCTGCTC	qRT-PCR	Neogenin	chr15:71132123-71195975
TWo14	CCACCAGAAAATAAAATGGAGTG
TWo17	CGGCGCTACAACATCAAG	qRT-PCR	DHX37	chr12:124036741-124039506
TWo18	CAACTCCCTTCAACGTGTCC
TWo21	GGTGAACATGGTGCAAACAG	qRT-PCR	PTPRM	chr18:8366574-8368324
TWo22	ACAGAGGTGTCCCCACAAAG
TWo53	AAAAGGTACCTGCTTCAATCCTGTTGGTGT	Cloning	MER61E (TP53AP1)	chr7:86797981-86798595
TWo54	AAAAGATCTTGCACCAAAATGTTAGTCTTGC
TWo55	AAAAGGTACCAACTTTCCTGCGTAGTCCACA	Cloning	LTR10B1 (TMEM12)	chr10:129551442-129551991
TWo56	AAAAGATCTGAACAGAAAGAAGACACCAAGGA
TWo57	AAAAGGTACCAGCAGGTATGGGGGTGGTATCACAGT	Cloning	MER61E (Neogenin)	chr15:71244860-71245577
TWo58	AAAAGATCTAGCAGGTGAATTCAAACCATCCAGT
TWo59	AAAAGGTACCAAAAATTAAAAGGGAAGGAAA	Cloning	LTR10E (DHX37)	chr12:123988958-123989525
TWo60	AAAAGATCTTTTTTATCAAAATGATACGTCTA
TWo61	AAAAGGTACCTGCCTTTTAACCAATGGAATG	Cloning	MER61C (PTPRM)	chr18:7718173-7718582
TWo62	AAAAGATCTTTTCAGTATGTTTAATTCTGGTTTTG

qRT-PCR, quantitative RT-PCR.

SI Text

Sequence Data Sources

The University of California Santa Cruz assemblies and RepeatMasker libraries we used per species are: human (Mar2006/hg18/RM051101), chimp (Mar2006/panTro2/RM060120), macaque (Jan2006/rheMac2/RM20060120), mouse (Feb2006/mm8/RM060120), and rat (Nov2004/rn4/RM060314).

A database of nucleotide sequences of the entire tree of life was assembled by collecting all public nucleotide sequences from the National Center for Biotechnology Information databases including gss (genome survey sequence database), htgs (high-throughput genomic sequence database), nt (nucleotide database), refseq (RefSeq database), wgs (whole genome short gun sequence database), env_nt (environmental nucleotide database), and trace achieves. Description of these databases can be obtained at ftp://ftp.ncbi.nih.gov/blast/db/blastdb.html. Location of traces is at ftp.ncbi.nih.gov/pub/TraceDB/, and location of databases is at ftp.ncbi.nih.gov/blast/db/. Sequences were replaced with the most recent genome assembly for all species with currently assembled genomes. The database contains a total of half a trillion bases of sequence.

Cell Culture

HCT116 cells (p53+/+) and p53-null derivatives, provided by Bert Vogelstein (John Hopkins University, Baltimore), were grown in McCoy's 5A medium supplemented with 10% FBS at 37°C.

ChIP

ChIP assays were performed according to the Upstate Biotechnology protocol with some modifications. A total of 5 ´ 10⁶ HCT116 p53+/+ cells in 10-cm dishes were treated with 375 mM 5-FU for 6 h, then fixed in 1% formaldehyde for 10 min. Cross-linking was stopped with the addition of 125 mM glycine for 10 min at room temperature. Cross-linked cells were washed twice with cold PBS and resuspended in 1% SDS, 50 mM Tris (pH 8.1), and 10 mM EDTA on ice for 10 min. Cross-linked DNA was sonicated under conditions optimized to generate DNA fragments between 200 and 1,000 nt, diluted with ChIP dilution buffer (Upstate), and then precleared with 50% protein A-agarose/Salmon Sperm DNA gel slurry (Upstate) for 1 h at 4°C. Precleared DNA was incubated overnight at 4°C with 10 mg anti-p53 antibody (DO-1; Santa Cruz) or normal mouse IgG antibody as negative control. The next day, 50% protein A-agarose/Salmon Sperm DNA gel slurry (Upstate) was added. After 1 h, beads were collected by centrifugation at 1,000 × g for 2 min and then washed according to the Upstate ChIP protocol. Proteins were eluted from the beads with 500 ml of elution buffer (1% NaHCO 3, 1% SDS) at room temperature for 30 min. Elutes were de-crosslinked with 20 ml of 5 M NaCl, incubated at 65°C for 4 h and digested for 1 h with 40 mg of proteinase K, 20 ml of 1M Tris-HCl (pH 6.5) and 10 ml of 0.5 M EDTA for 1 h at 45°C. DNA was isolated with the Qiagen gel purification kit and analyzed by PCR amplification with primers designed for the ERV LTRs in the proximity of the following genes: DHX37, Neogenin, PTPRM, TMEM12. Please see SI Table 7.

SYBR Green-Based Real-Time Quantitative PCR (qRT-PCR)

A total of 3 ´ 10⁶ HCT116 p53+/+ and p53-/- cells in 60-mm plates were treated with 375 mM 5-FU for 24 h, 0.6 mg/ml doxorubicin for 24 h or 60 J/m² of UV irradiation with 24 h of recovery. RNA was isolated with Trizol reagent (Invitrogen) and cDNA was generated with SuperScriptIII reverse transcriptase (Invitrogen) and random hexanucleotide primer. cDNAs were added to 20-ml reaction mixtures containing 10 ml of 2´ Bio-Rad SYBR Green supermix and gene-specific primers. Please refer to SI Table 7 for primer sequences. The cDNAs were analyzed by real-time quantitative PCR on a Rotor Gene 6000 machine (Corbett Research). A melting curve was used to identify a temperature where only the amplicon, and not primer dimers, accounted for the SYBR green-bound fluorescence. C_T values (threshold cycle values) were determined by Rotor Gene 6000 Series software. Each experiment was performed independently three times (biological triplicates), and each biological sample was assayed three times (technical triplicates). All data were normalized to an internal standard (b-actin). Specifically, DC_T values were calculated for each sample with respect to the internal standard. Mean and variance were calculated, and 95% confidence intervals were determined by assuming normal distribution of data. The mean and confidence intervals were then exponentiated to reflect relative expression levels. The displayed relative expression levels were scaled relative to the mean of p53 (-/-) with no treatment (designated as 1).

Reporter Gene Assays

The firefly luciferase reporter plasmid pp53-TA-Luc (Clontech) was used for the cloning of all LTR reporter constructs (1). Five genomic LTR fragments were chosen for the reporter gene assay. Primers were designed for PCR amplification of individual LTR fragments from the human genomic DNA (Promega), and a KpnI site and a BglII site were introduced to either end of the PCR products. Please refer to SI Table 7 for primer sequences. PCR products were digested by KpnI and BglII (NEB) and ligated to pp53-TA-Luc backbone (digested with KpnI and BglII) which provides a minimal TA promoter, the TATA box from the herpes simplex virus thymidine kinase promoter. Each experiment was performed with biological triplicates. HCT116 p53+/+ and p53-/- cells were incubated in 96-well plates at a concentration of 8,000 cells per well. FuGENE 6 (Roche) was used to cotransfect cells with LTR firefly luciferase plasmid and a Renilla luciferase control plasmid following the manufacturer's instruction. Cells were treated 24 h after transfection. Three treatments, 375 mM 5-FU for 24 h, 0.6 mg/ml doxorubicin for 24 h, or 60 J/m² of UV-irradiation with 24 h of recovery, were performed. Dual luciferase assays were performed according to manufacturer's instruction (Promega), using the Renilla luciferase construct to normalize results. Experiments were performed on a VICTOR Light 1420 Luminescence Counter (PerkinElmer). Mean and variance were calculated, and 95% confidence intervals were determined by assuming normal distribution of data. The displayed relative expression levels were scaled relative to the mean of p53 (-/-) with no treatment (designated as 1).

p53 Binding Sites and Matrix

The consensus p53 DNA binding site is two half-sites of RRRCWWGYYY separated by 0-13 bp (2). This consensus tends to overpredict p53 binding to sites that conform to the consensus, but are not bound well by p53. The TRANSFAC (3) weight matrix for p53 is based on few sequences and does not distinguish well between real p53 DNA binding sites and false-positives. We built a new matrix from a larger dataset of 162 p53 DNA binding sites (including sites contained in TRANSFAC matrix database and site database, as well as a manual collection of published binding sites based on ref. 1) and the following key observations. A symmetric binding motif for the half-site is statistically more significant than an asymmetric one considering the number of parameters in the model. The spacing of 0 between the p53 half-sites is much preferred over any other spacing. This result was confirmed in yeast assays (1), and we find that, with few exceptions, all p53 DNA binding sites positive in yeast have a score higher than the negative p53 binding sites from the previous work. This indicates that our quantitative model was useful in detecting and predicting high-affinity p53 DNA binding sites.

A logo of this half-site model is:

The corresponding positional specific weight matrix is:

The criteria we used to predict a full p53 site require that a site contains at least two consecutive 10-bp half sites that both pass a lower cutoff value (0.5 of the maximum possible score) and at least one passes a higher cutoff value (0.7 of the maximum possible score). The score of individual half site was determined by the program PATSER (4), and an ad hoc perl script was used to enforce the selection rules. Predicted sites agree well with the canonical p53 site (two half sites of RRRCWWGYYY) with at most two mismatches in either half site, none of which occurs in the middle four bases (CWWG).

Genomewide Distribution of LTR10s and MER61s

We examined the genomic distribution properties of LTRs of the LTR10 and MER61 subfamilies. We compared them to each other as two classes, those with a p53 site and those without, and also to the global distribution of ERVs. The two classes show moderate differences in their overall relative locations with respect to known genes. For example, consistent with previous reports, ERVs in general are distant from genes (5, 6). LTRs with a p53 binding site are even less represented in the vicinity of genes (SI Fig. 4A). For those that do overlap with a gene (mostly in introns), LTRs with p53 sites tend to stay away from both transcriptional start sites and termination sites much more than those that do not have any p53 site (SI Fig. 4B). For LTRs that fall within 100 kb of any transcription start site, the ones with a p53 site are lesser represented when they are closer to the start site (SI Fig. 4C). ERVs show a strong strand bias, such that when they are close to a gene, they usually reside on the opposite strand of the gene. LTRs with a p53 site tend to show a stronger strand bias than those without (SI Fig. 4D). We extended the strand bias analysis to also include EPBS that do not overlap with genes (i.e., not in introns) but are relatively close to genes, which is represented as strand bias at longer distance. These data remain observational. The observed bias at 80-100 kb and >1mb may simply be due to limited sample size. Nevertheless, the observed differences consistently indicate that, as a whole, p53 site containing LTRs were more strongly selected against, suggesting that they bear more deleterious potential that may influence regulation of nearby genes than LTRs without p53 DBS. The difference is, however, not striking; suggesting that the p53 binding site is probably not the only regulatory signal differentiating these LTRs.

1. Qian H, Wang T, Naumovski L, Lopez CD, Brachmann RK (2002) Oncogene 21:7901-7911.

2. el-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW, Vogelstein B (1992) Nat Genet 1:45-49.

3. Matys V, Fricke E, Geffers R, Gossling E, Haubrock M, Hehl R, Hornischer K, Karas D, Kel AE, Kel-Margoulis OV, et al. (2003) Nucleic Acids Res 31:374-378.

4. Hertz GZ, Stormo GD (1999) Bioinformatics 15:563-577.

5. van de Lagemaat LN, Medstrand P, Mager DL (2006) Genome Biol 7:R86.

6. Medstrand P, van de Lagemaat LN, Mager DL (2002) Genome Res 12:1483-1495.