Wong et al. 10.1073/pnas.0702544104. |
Fig. 7. DNA sequencing data for the mutations. (a) C5060T (Pro1597Leu): normal sequence (i), SSCP band (ii), and direct sequence (iii) of tumor sample. (b) C5059T (Pro1597Ser) SSCP band. (c) G5074A (Gly1602R) complementary sequence: normal sequence (i), SSCP band (ii), and direct sequence (iii) of tumor sample. (d) A5359G (Thr1697Ala): normal sequence (i) and direct sequence (ii). (e) T5401A (Phe1711Ile) complementary sequence: normal sequence (i) and SSCP band (ii). (f) C5468T (Thr1733Ile): normal sequence (i), SSCP band (ii), and direct sequence (iii) of tumor sample. (g) A5474G (Asn1735Ser): normal sequence (i) and direct sequence (ii) of tumor sample. (h) A5596G (Thr1774A): normal sequence (i) and SSCP band (ii). (i) A5653G (Thr1795Ala): normal sequence (i), SSCP band (ii), and direct sequence (iii) of tumor sample. (j) C5662T (Pro1798Ser): normal sequence (i), SSCP band (ii), and direct sequence (iii) tumor sample. (k) A5674G(T1802A): normal sequence (i) and SSCP band (ii). (l) T5714C (Leu1815Pro) complementary sequences: normal sequence (i), SSCP band (ii), and direct sequence (iii) of tumor sample. (m) C5980T (Arg1904Trp) complementary sequences: normal sequence (ii), SSCP band (ii), and direct sequence (iii) of tumor sample.
Fig. 8. The frequent mutation A5653G (Thr1795Ala) in primary prostate tumours. (a) PCR products from seven primary prostate cancers digested with Hph1. The undigested bands (marked with an arrow) were cut out and sequenced as shown in Fig. 2b. (b) Sequence of Hph1 resistant band from PCR of primary tumor DNA. Arrow marks the position of the A5653G (Thr1795Ala) mutation.
Fig. 9. Mutations in the Plexin-B1 gene increase cell adhesion. (a) Adhesion of lentiviral-transduced HEK293 cells to fibronectin after 30 min. No Sema4D: P £ 0.05 (A5359G, A5653G), P £ 0.005 (C5060T), P £0.001(T5714C) vs. WT; with Sema4D: P £ 0.01 (A5359G, A5653G, T5714C), P £ 0.05(C5060T), vs. WT. (b). Adhesion of lentiviral transduced HEK293 cells expressing the indicated construct to fibronectin and polyL-Lysine after 10 min. (c). Constitutive activation of PlexinB1 by overexpression. (i and ii) lentiviral-transduced HEK293 cells expressing low (i) or high (ii) levels of PlexinB1 protein. iii,. Adhesion of lentiviral-transduced HEK293 cell lines to fibronectin expressing low (bars in 1) or high (bars in 2) levels of PlexinB1, in the absence or presence of sema4D. Constitutive activation of PlexinB1 is seen for cells expressing high levels of PlexinB1. Values are normalized to vector controls. Error bars = SEM.
Fig. 10. Mutations in the Plexin-B1 gene increase cell motility and cell spreading. (a) Transwell motility assays. The underside of transwell chambers (Costar) were coated with 15 mg/ml fibronectin. Serum starved lentiviral-transduced HEK293 cells (2 ´ 104 cells per insert) in DMEM were placed in the upper side of the chambers with or without purified Sema4D (100 ng/ml) and DMEM in the lower chamber. The chambers were incubated at 37°C for 6 h. Cells on the underside were fixed, stained with crystal violet and counted down a microscope. Assays were performed in triplicate three times. Error bars represent SEM. (b). Mutations in Plexin-B1 increase cell spreading. Average area of cells following plating on fibronectin for 10 min. The numbers shown are relative to vector control for each experiment (P £ 0.0001 for all mutants vs. WT, with and without Sema4D). Numbers represent the mean of four independent experiments performed in triplicate from two independent lentiviral infections from two different virus preparations, and a minimum of 320 cells were sized per data point.
SI Methods
Screening for Mutations
. Bands were cut from the gel, the DNA eluted and amplified by PCR and sequenced (Amplitaq DNA polymerase, ABI). Sequence changes in the aberrant SSCP bands were confirmed by restriction enzyme digestion and by sequencing in both directions. All samples containing a mutation were re-screened by SSCP to confirm the presence of the mutation. Sequence changes in the samples from prostate cancer metastases were also confirmed by direct sequencing of DNA extracted from the tumor tissue. Where extra tissue was available (11 cases), the laser capture microdissection and DNA extraction was repeated, and the same result was found. The presence of the T1795A mutation in the primary prostate cancer found by SSCP analysis and sequencing of DNA from the SSCP band was confirmed by restriction enzyme digestion of DNA extracted from the tumor tissue. The T1795A mutation destroys a Hph1 site. Amplified products were digested with Hph1, Hph1-resistant DNA bands were excised from the gel and sequenced, and the same result found (SI Fig. 8).Control DNA from unrelated individuals of Caucasian origin was screened for the presence of identified mutations by PCR and restriction enzyme digestion (NEB) using HaeIII (P1597L, P1597S, A1730T), AvaII (P1597S), StyI (G1602R), BstZ171 (T1697A), Bcl1 (F1711I), BstN1 (G1728S), StyI (T1733I), BsrB1 (N1735S), Hga1 (T1776A), Hph1 (T1795A), HaeIII (P1798S), HhaI (T1802A), MnlI (L1815P, L1815F), and TaqI (R1904W). Primers with a single base pair mismatch were used for Bcl1, BsrB1, BstN1, MnlI, StyI, and TaqI.
In Vitro
Mutagenesis. The A5359G, A5653G, T5714C and C5060T sequence changes were introduced using QuikChange kit (Stratagene) with the following primers: GTCCATCTGTCTGTATGCCTTCGTGAGGGTGAG and CTCACCCTCACGAAGGCATACAGACAGATGGAC (A5359G), GGAGTGCCTCTCG CCCAGCGGCCAGACCCTCG and CGAGGGTCTGGCCGCTGGGCGAGAGGCACTCC (A5653G), GGTGGCCGGGCACCC CATTCTTTCTGACGAGG and CCTCGTCAGAAAGAA TGGGGTGCCCGGCCACC (T5714C), GTGCCTGAGAGCAGACGGCTCACTGTGGAGCAAGGGCTGG and CCAGCCCTTGCTCCACAGTGAGCCGTCTGCTCTCAGGCAC (C5060T).GST-B1cyto Purification
. The region of Plexin-B1 cDNA encoding the intracellular domain (amino acids 1,512-2,135; GenBank accession no. X87904) was amplified by PCR using primers: AAAAAAGTCGACAGGAGGAAGAGCAAGCAGGC, AAACTCGAGCTATAGATCTGTGACCTTGT. The PCR product was cloned into pGEX-4T-3 (Amersham Pharmacia) by SalI and XhoI sites to produce pGEXB1cytoWT. Mutations were introduced into pGEXB1cytoWT by using QuikChange II XL in vitro mutagenesis kit (Stratagene) by using the primers: GTCCATCTGTCTGTATGCCTTCGTGAGGGACTC, GAGTCCCTCACGAAGGCATACAGACAGATGGAC, (A5359G), AGTGCCTCTCGCCCAGCGGCCAG, CTGGCCGCTGGGCGAGAGGCACT (A5653G), GGCCGGGCACCCATTCTTTCTGACGA, TCGTCAGAAAGAATGGGTGCCCGGCC (T5714C).Transwell Motility Assays.
The undersides of 24-well, 0.8-mm transwell chambers (Costar) were coated with 15 mg/ml fibronectin. Serum starved lentiviral-transduced HEK293 cells (2 ´ 104 cells per insert) in DMEM were placed in the upper side of the chambers with or without purified Sema4D (100 ng/ml) and DMEM was placed in the lower chamber. The chambers were incubated at 37°C for 6 h. Cells on the upper side of the transwell were removed and those on the underside were fixed, stained with crystal violet and counted using a microscope. Results shown are the mean of three independent experiments performed in triplicate three times.