Supporting Information

Files in this Data Supplement:

Fig. 5. Evolutionary conserved residues mutated in C. elegans. (A) SDS/12% PAGE of purified wildtype and several mutant C. elegans lamin proteins. The missense mutations are indicated above the lanes. (B) Amino acid sequence alignment of C. elegans lamin and human lamin A. Residues that were mutated are marked in bold and the amino acid substitution is indicated below. Residues affecting lamin assembly or localization are highlighted.

Fig. 6. Immunostaining of Ce-emerin in wildtype C. elegans embryos (N2), or in embryos derived from transgenic strains expressing wildtype or mutant GFP::Ce-lamin. Scale bar, 10 mm.

Table 2. Filament assembly of the R64P protein was stopped after 5 sec, 15 sec, 5 min or overnight (ON) as described in the legend of Fig. 2

Length of negatively stained fibrils was measured by the analySIS software.

Table 3. WT and mutant GFP::Ce-lamin expression pattern in C. elegans at the young adult stage

++: GFP expression in essentially all cells.

+: GFP expression in a high number of cells.

+/-: GFP expression in some cells.

--: No GFP expression.

*: No viable strains obtained with BAF promoter.

One of the L215P mutant strains has a weaker expression.

Table 4. Cellular localization and nuclear morphology of WT and mutants GFP::Ce-lamin in vivo

Two D217K GFP::Ce-lamin mutant strains under heat shock promoter showed also a nucleoplasmic localization with some aggregates and some nuclei had abnormal morphology.

*Number of independent strains used for the analysis.

SI Materials

Primers used for mutagenesis.

Y59C fwd: 5'-cagtcgtcttgccacttgcatcgacaaagttcgtc-3'

Y59C Rev: 5'-gacgaactttgtcgatgcaagtggcaagacgactg-3'

R64P Fwd: 5'-gccacttacatcgacaaagttccgcaattggagcaagag-3' (primer for cDNA)

R64P Rev: 5'-ctcttgctccaattgcggaactttgtcgatgtaagtggc-3'

R64P Fwd: 5'-cacttttcagaaagttccgcaattggagcaagag-3' (primer for genomic DNA)

R64P Rev: 5'-ctcttgctccaattgcggaactttctgaaaagtg-3'

R103C Fwd: 5'-aggctcgtctctgtcgtgccctcgattcg-3'

R103C Rev: 5'-cgaatcgagggcacgacagagacgagcct-3'

Q159K Fwd: 5'-ctattgctgatcaaagtaaagcaaaacagaagacg-3'

Q159K Rev: 5'-cgtcttctgttttgctttactttgatcagcaatag-3'

T164P Fwd: 5'-caagcaaaacagaagccgttgcaggcacgcaac-3'

T164P Rev: 5'-gttgcgtgcctgcaacggcttctgttttgcttg-3'

N209K Fwd: 5'-gaacagccgccaacaaaaaaatcaaggctctg-3'

N209K Rev: 5'- cagagccttgatttttttgttggcggctgttc-3'

D217K Fwd: 5'-caaggctctggaagaaaagctcgcttttgctcttc-3'

D217K Rev: 5'-gaagagcaaaagcgagcttttcttccagagccttg-3'

Y281C Fwd: 5'-cagctttcgaagatgcctgcaaaaacaagctcaatgc-3'

Y281C Rev: 5'-gcattgagcttgtttttgcaggcatcttcgaaagctg-3'

E358K Fwd: 5'-cgagcgcatgatgagcaagttccacgatcttcttg-3'

E358K Rev: 5'-caagaagatcgtggaacttgctcatcatgcgctcg-3'

E381A Fwd: 5'-ctaccaagctctccttgcgggtgaggaggagcgtc-3'

E381A Rev: 5'-gacgctcctcctcacccgcaaggagagcttggtag-3'

R460W Fwd: 5'-gaaggaaagtgggtctgggttgcaaacaactc-3'

R460W Rev: 5'-gagttgtttgcaacccagacccactttccttc-3'

R460C Fwd: 5'-gaaggaaagtgggtctgtgttgcaaacaactc-3'

R460C Rev: 5'-gagttgtttgcaacacagacccactttccttc-3'

G472D Fwd: 5'-gaagaacaatccatcgatggatacaagttggtggt-3'

G472D Rev: 5'-accaccaacttgtatccatcgatggattgttcttc-3'

L535P Fwd: 5'-acccatcagctcgtcctgaggatagtgaagga-3'

L535P Rev: 5'-tccttcactatcctcaggacgagctgatgggt-3'

Lmn-T Rev: 5'-tcaggcggccgccaattacatgctggaacaacgatcggc-3'.

The GFP fragment was PCR amplified from pJKL380 (26) with the following primers: GFP Fwd 5'-agtcgagctcatgagtaaaggagaagaacttttcactgg-3'

GFP Rev 3'-actgccgcggttaactttgtatagttcatccatgaa-3'.

The baf-1 promoter was PCR amplified from genomic DNA with the following primers:

BAFp Fwd: 5'-gatcagatctgtcagcgacatacgaatgaatcg-3'

BAFp Rev: 5'-gatcgagctcggtttctgaaacacaaaataattac-3'.

The heat shock promoter was PCR amplified from pDP49.78 (kindly provided by Andy Fire) with the following primers:

HSp Fwd: 5'- gcctgcaggtcgacagatctagag -3'

HSp Rev: 5'- tatgagctcgattatagtttgaagatttc -3'

The heat shock conditions for the strains containing this promoter were 10 min at 34°C followed by 90 min at 20°C before visualization.