Supporting Figure

File in this Data Supplement:

Fig. 6. (A) Semiquantitative RT-PCR on hip⁴¹ mutants reveals reduced expression levels of hip and CG8209. Total RNA from the equivalent of one salivary gland each of wild-type (lanes 1 and 3) or hip⁴¹ homozygous mutant larvae was probed with primer pairs for hip (lanes 1 and 2) or CG8209 (lanes 3 and 4). Primers to Actin 42A were added to each reaction as an internal standard. hip and CG8209 transcript levels are strongly reduced in the mutant (asterisks). Expected sizes of the amplicons were as follows: CG8209, 547 bp; Actin42A, 480 bp; hip, 321 bp. RT-PCR conditions: 50°C for 60 min, 94°C for 15 min, 30 cycles (94°C for 30 s, 50°C for 30 s, and 72°C for 45 s), 72°C for 10 min. Primer sequences: hip forward, atgtcaccgaagactaaaa; hip reverse, ctagattgtcagattagact; CG8209 forward, gcagacattgatggatatg; CG8209 reverse, gatcttcttcatctccaac; Actin42A forward, gtgtgcagcggataactag; Actin42A reverse, gatggcaacatacatggccg. (B) Hip protein levels are reduced in the hip⁴¹ homzygous mutant condition but not by loss of HP1. Immunoblots of salivary gland protein extracts of wild-type, Su(var)2-5-deficient (see Materials and Methods), and hip⁴¹ homozygous mutant larvae were probed with anti-Hip antiserum. As a loading control, we used anti-b-actin antibody (Abcam). Hip protein levels are not affected by loss of HP1. In mutant hip⁴¹ homozygous larvae no Hip protein could be detected. The faster-migrating band in each lane is most likely due to cross-reactivity with an unknown protein.