Zhang et al. 10.1073/pnas.0711625105. |
Fig. 4. Schematic comparison of the domain organization of PKSE and PUFA synthase subunit A (PfaA). The numbers represent comparisons between SgcE (GenBank accession number AAK72879) and Schizochytrium sp. ATCC_20888 PfaA with x = 9 (GenBank accession number AAK72879).
Fig. 5. Model of C-terminal domain of SgcE with Sfp (PDB no. 1qr0A). The C-terminal domain consisting of 225 aa of SgcE was submitted to ModWeb for comparative protein structure modeling (http://alto.compbio.ucsf.edu/modweb-cgi/main.cgi). The results were analyzed using Chimera from the University of San Francisco. (A) Overall predicted structure similarity between the Sfp PPTase and SgcE C-terminal domain. Shown in purple is Sfp with active site residues aspartate and glutamate shown in blue. SgcE is depicted in white with the corresponding active site residues aspartate and glutamate in red. (B) Close-up view of the PPTase active site.
SI Text
Methods
Vectors, plasmids, and strains
. Vectors pGEM-T Easy, pGEM-3zf (+), pGEM-7zf (+) were from Promega (Madison, WI); vectors pCDFDuet-1, pCDF-2 Ek/LIC, pRSF-2 Ek/LIC, and pET-30 Xa/LIC were from Novagen (Madison, WI). Plasmids pOJ260 (1), pWHM3 (2), pWHM79 (3), pBS1006 (4), pBS5004 (5), pBS5020 (5), pBS18 (6), pSET152 (7), and pANT841 (8) were previously described. Plasmid pACPS1 (9) was provided by M. Burkhart, University of California at San Diego. PKSE mutant strains SB1005 (10) and SB5002 (5) were previously described.General DNA manipulations.
PCRs were performed using Expand Long Template PCR System from Roche (Indianapolis, IN) or Platinum Pfx DNA polymerase from Invitrogen (Carlsbad, CA). Unless stated, reaction mixtures contained 1X supplied buffer, 15 mM forward and reverse primer, 250 mM dNTPs, 5% DMSO, 10-100 ng indicated template, and 5 U DNA polymerase. The PCR program included an initial hold at 96°C for 2 min., followed by 30 cycles of 96°C for 10 s, 56°C for 30 s, and 68°C for 40 s per kb of desired product. The amplified PCR product was gel purified with 1% agarose before overnight ligation at 16°C with T4 DNA ligase from Promega.Construction of Streptomyces vector pBS1044 for conjugal transfer.
Plasmid pOJ260 was digested with BglII and treated with DNA polymerase Klenow fragment in the presence of dATP and dGTP. DNA polymerase was heat inactivated, and the DNA digested with KpnI to yield a 0.8-kB fragment containing oriT. Plasmid pWHM3 was digested with SalI and treated with DNA polymerase Klenow fragment in the presence of dTTP and dCTP. DNA polymerase was heat inactivated and the DNA digested with XbaI-BclI to yield a 2.5-kB fragment. Plasmid pWHM3 was digested with KpnI and XbaI to yield a 4.2-kB fragment. After gel purification, the 0.8-kB fragment, the 2.5-kB fragment, and the 4.2-kB fragment were ligated in a single reaction using T4 DNA ligase to yield pBS1044.Subcloning sgcE for complementation.
Plasmid pBS1006 was digested with KpnI-EcoRI, and the 7-kB DNA fragment purified and ligated to the identical sites of pGEM-7zf(+) to give pBS1045. A 0.6-kB fragment was amplified by PCR from pBS1006 using the forward primer 5'-AGAATTCGGTGGCGTCACCGA-3', and the reverse primer-5'-ATTCTAGATGACGGCCGCCCC-3' (the XbaI site is underlined). The resultant PCR product was digested with XbaI and PstI (internal site) and the 0.8-kb fragment cloned into the XbaI-PstI sites of pBS1045 to yield pBS1046. Plasmid pBS1046 was digested with XbaI-HindIII, and the 6.0-kB DNA fragment purified and ligated to the identical sites of pWHM79 to yield pBS1047.Generation of DsgcE complementation plasmid pBS1049.
To create the pBS1047 derivative for expression of sgcE in Streptomyces, a 1-kb DNA fragment was amplified by PCR from plasmid pBS1006 using the forward primer 5'- CGATCCTCCCAGATCTTCTTCGGAGCC (the BglII site is underlined) and the reverse primer 5'-CGAGGTCGCCGCTCTGCAGCGAGG-3' (the PstI site is underlined) and co-ligated with the 5.2-kb PstI-HindIII fragment from pBS1047 and the 5.5-kB BamHI-HindIII fragment from pWHM79 to yield pBS1048. Plasmid pBS1048 was digested with EcoRI-HindIII, and the 6.7-kB fragment purified and ligated to the identical sites of pBS1044 to yield pBS1049. The resultant plasmid pBS1049 contains the ErmE* promoter, ~400 bp upstream sgcE, and the entire sgcE gene.Generation of E. coli expression constructs.
The genes for sgcE, ncsE, sgcE10, and ncsE10 were amplified by PCR using pBS1006 as a template for sgcE and sgcE10 and pBS5004 for ncsE and ncsE10. Reactions were performed using the following primers: sgcE (forward) 5'-GGTATTGAGGGTCGCATGAGCCGCATAGCCATCGT-3'/(reverse) 5'-AGAGGAGAGTTAGAGTCACGCGCGGGCGCTCC-3'; ncsE (forward) 5'-GGTATTGAGGGTCGCATGACCAGAATCGCCATCGTCGGC-3'/(reverse) 5'-AGAGGAGAGTTAGAGCCTCATCCGACATAGTCCTTAACCAAAG-3'; sgcE10 (forward) 5'-GACGACGACAAGATTATGACCGCGACGAATCCTGAC-3'/(reverse) 5'-GAGGAGAAGCCCGGTCActaggcggcgcgtcccg-3'; and ncsE10 (forward) 5'- GCATGCCATGGCATCGGATGACTACTTCGAG-3'/(reverse) 5'- GGGGTACCCCTCATGCCGTCCGCCC-3'. The gel-purified PCR product was inserted into pET-30 Xa/LIC (sgcE and ncsE) or pCDF-2 Ek/LIC (sgcE10) using ligation-independent cloning as described by Novagen (Madison, WI), affording pBS1050 (for sgcE), pBS5036 (for ncsE), and pBS1051 (for sgcE10); and sequenced to confirm PCR fidelity. The PCR product for ncsE10 was cloned into pGEM-T Easy to yield pBS5037, and the gene integrity was confirmed by sequencing. Plasmid pBS5037 was digested with EcoRI-NcoI, and the 0.5-kb DNA fragment was ligated into the same site of pCDFDuetTM-1 yielding pBS5038.Subcloning segments of sgcE.
A 2.3-kb DNA fragment containing the AT and putative ACP domain was amplified by PCR from pBS1049 using a forward primer 5'-tgaattcaactgctgctcctggacgggg-3' (the EcoR1 site is underlined) and a reverse primer 5'-CCTtgcatgcgtatcccgctctccctcatccgtc -3' (the SphI site is underlined). The resultant PCR product was digested and cloned into the EcoRI-SphI sites of pGEM-3zf(+) to yield pBS1052. A point mutation in pBS1052 was eliminated by swapping the 0.5-kb SfiI-BsmI fragment of pBS1050 into the identical sites of pBS1052 to yield pBS1053. A 2.5-kb DNA fragment containing the C-terminal domain containing the putative PPTase was amplified by PCR from pBS1049 using a forward primer 5'-tgaattcggtgggttccggagttctggtgt-3' (the EcoR1 site is underlined) and a reverse primer 5'-atgtgcatgccgtgccggcggtgagga-3' (the SphI site is underlined). The resultant PCR product was digested and cloned into the EcoRI-SphI sites of pGEM3zf(+) to yield pBS1054. A 1.7-kb DNA fragment containing the N-terminal domain containing the KS domain was amplified by PCR from pBS1049 using a forward primer 5'-tgaattcgacaccttctacgcccgcaatgc-3' (the EcoR1 site is underlined) and a reverse primer 5'-ccatgcatgctagacctcggcggcctcgg-3' (the SphI site is underlined). The resultant PCR product was digested and cloned into the EcoRI-SphI sites of pGEM3zf(+) to yield pBS1055. The integrity of the regions of interest in the final constructs were confirmed by DNA sequencing.Generation of point mutations.
The QuikChange site-directed mutagenesis protocol (Stratagene; La Jolla, CA) was used to introduce mutations into putative active site residues C211, S659, S860, S974, D1827, and E1829. Reactions were performed using pBS1055 (for C211), pBS1053 (for S659, S860, and S974) or pBS1054 (for D1827 and E1829) as a template with the following primers: C211A (forward) 5'-GTCGACGGCGCCGCCTCGTCCTCGCT-3'/(reverse) 5'-AGCGAGGACGAGGCGGCGCCGTCGAC-3' (with the engineered alanine codon underlined); S659A (forward) 5'-CATCGCACTCGGCCACGCTCTCGGCGAGCTCTCC-3'/(reverse) 5'-ggagagctcgccgagagcgtggccgagtgcgatg-3'; S860 (forward) 5'-CCGACGACGAGGCGCTGCGCGGGC-3'/(reverse) 5'-GCCCGCGCAGCGCCTCGTCGTCGG-3'; S974 (forward); 5'-CTGCACATCAGCGCGATCACCGTCGG-3'/(reverse) 5'-CCGACGGTGATCGCGCTCATGTGCAG-3'; D1827 (forward) 5'-GGTGGCCTGCGCCATCGAGGCGGT-3'/(reverse) 5'-ACCGCCTCGATGGCGCAGGCCACC-3'; E1829 (forward) 5'-CTGCGACATCGCGGCGGTCACCGC-3'/(reverse) 5'-GCGGTGACCGCCGCGATGTCGCAG-3'. Successful reaction mixtures consisted of 20 ng of template DNA, 300 nM each primer, 500 mM dNTPs, 5% (vol/vol) DMSO, 1´ buffer, and 2.5 U of cloned Expand Long Template polymerase in a final volume of 50 ml. The PCR program was as follows: initial denaturing at 96°C for 2 min, followed by 20 cycles at 96°C for 10 s, 56°C for 30 s, and 68°C for 3 min, and completed by an additional 7 min at 68°C. Upon completion, 10 units of DpnI was added directly to the PCR mixture and digested at 37°C for 1 h. The mixture (1 ml) was directly transformed into DH5a and plated on LB supplemented with 30 mg/ml kanamycin. The mutant constructs were confirmed by sequencing to give pBS1056 (C211A), pBS1057 (C659A), pBS1058 (S860A), pBS1059 (S974A), pBS1060 (D1827A), and pBS1061 (D1829).Generation of KS mutant plasmids for DsgcE complementation and E. coli expression.
The 6.7-kb EcoRI-HindIII fragment of pBS1049 was cloned into the identical sites of pGEM-3zf(+) to generate pBS1062. Plasmid pBS1056 was digested with BsiWI/BbsI, and the 1.3-kb fragment ligated into the 8.2-kb BsiWI/BbsI fragment of pBS1062 to give pBS1063. Plasmid pBS1063 was digested with EcoR1-HindIII, and the 6.7-kb fragment was ligated to the identical sites of pBS1049 to yield pBS1064. For E. coli expression, the 3.0-kb BsiWI/SfiI fragment of pBS1063 was inserted into the identical sites of pBS1050 to yield pBS1065.Generation of AT and ACP mutant plasmids for DsgcE complementation and E. coli expression.
The 1.8-kb SfiI-StuI fragment of pBS1057, pBS1058, and pBS1059 was cloned into the identical sites of pBS1062 to give pBS1066, pBS1067, and pBS1068, respectively. Each plasmid was digested with EcoR1-HindIII, and the 6.7-kb fragment was ligated to the identical sites of pBS1049 to yield pBS1069, pBS1070, and pBS1071, respectively. For E. coli expression, the 1.8-kb SfiI-StuI fragment of pBS1057, pBS1058, or pBS1059 was cloned into the identical sites of pBS1050 to pBS1072, pBS1073, and pBS1074, respectively.Generation of PPTase mutant plasmids for DsgcE complementation and E. coli.
The 1.7-kb SfiI-Bsu36I fragment of pBS1060 and pBS1061 was cloned into the identical sites of pBS1062 to give pBS1075 and pBS1076, respectively. Each plasmid was digested with EcoR1-HindIII, and the 6.7-kb fragment was ligated to the identical sites of pBS1049 to yield pBS1077 and pBS1078, respectively. For E. coli expression, the 1.9-kb SfiI-Bsu36I fragment of pBS1060 or pBS1061 was cloned into the identical sites of pBS1050 to give pBS1079 and pBS1080, respectively.ACP constructs for E. coli expression.
Five different versions of the ACP domain of SgcE were prepared, all of which minimally encompass the ACP domain boundary that was previously described10. The regions were amplified by PCR using pBS1050 as a template. Reactions were performed using the following primers: ACP81 (forward) 5'-GACGACGACAAGATGGAGGAGTCGGCGCTGGAC-3'/(reverse) 5'-GAGGAGAAGCCCGGTTCACGTCTCGACCAGGGTCGTG-3'; ACP108 (forward) 5'- GACGACGACAAGATGGAGGAGTCGGCGCTGGAC-3'/(reverse) 5'- GAGGAGAAGCCCGGTcaCagttcgtcgaggtcgacg-3'; ACP136 (forward) 5'- GACGACGACAAGATTgagttcacgcttcccgccg-3'/(reverse) 5'- GAGGAGAAGCCCGGTcaCagttcgtcgaggtcgacg-3'; ACP109 (forward) 5'- GACGACGACAAGATTgagttcacgcttcccgccg-3'/(reverse) 5'- GAGGAGAAGCCCGGTTCACGTCTCGACCAGGGTCGTG-3', and ACP212 (forward) 5'- GACGACGACAAGATGGAGGAGTCGGCGCTGGAC-3'/(reverse) 5'- GAGGAGAAGCCCGGTcacggagtgtggacgacggt-3'. The gel-purified PCR product was inserted into pRSF-2 Ek/LIC (sgcE10) using ligation-independent cloning as described by Novagen, affording pBS1081 (ACP81), pBS1082 (ACP108), and pBS1083 (ACP136), pBS1084 (ACP109), and pBS1085 (ACP212); and sequenced to confirm PCR fidelity.The QuikChange® site-directed mutagenesis protocol (Stratagene; La Jolla, CA) was used to introduce a mutation into active site residue S974. Reactions were performed as described above using pBS1081 as a template and the forward and reverse primers listed above. After DpnI treatment, the mixture (1 ml) was directly transformed into DH5a and plated on LB supplemented with 150 mg/ml kanamycin. The mutant construct was confirmed by sequencing to give pBS1086.
Purification of His-6-SgcE and His-6-SgcE mutants
. To overexpress sgcE and sgcE mutants in E. coli, pBS1050 (wild-type), pBS1065 (C211A), pBS1072 (S659A), pBS1073 (S860A), pBS1074 (S974A), pBS1079 (D1827A), and pBS1080 (E1829A) were introduced into E. coli BL21(DE3), and the resultant recombinant strains were plated on LB medium supplemented with 50 mg/ml kanamycin. A single colony was used to inoculate 3 ml of LB medium supplemented with 50 mg/ml kanamycin and incubated at 37°C for 12 h. A 0.5 ml aliquot was transferred to 50 ml of LB medium supplemented with 50 mg/ml kanamycin and grown an additional 12 h at 37°C before the transfer of 5 ml to 500 ml of LB medium supplemented with 50 mg/ml kanamycin. The cultures were incubated at 18°C and induced with IPTG (final concentration of 0.1 mM) when OD600 reached ~0.5 (~10 h). After incubation at 18°C for an additional 15 h, cells were harvested and lysed by sonication. Affinity purification was performed using Ni-NTA agarose as described by Qiagen (Valencia, CA) using a 10 mM imidazole wash and elution buffer containing 200 mM imidazole. Protein was desalted into 20 mM Tris-HCl pH 8 and 0.5 mM DTT using PD-10 columns (GE Healthcare). Protein purity was assessed as >80% by 8% acrylamide SDS/PAGE. His-6-NcsE was produced and purified using the identical protocol as SgcE. His-6-tagged constructs were used without further modifications.Active site mapping of SgcE and NcsE.
NcsE and SgcE (~200 mg) were digested with 20 mg of trypsin (Promega) for 5 min at pH 8.0. The resulting peptides/protein domains were separated by HPLC with a Jupiter 5m C4 300 Å column (Phenomenex) in a water-acetonitrile gradient as described (11). Fractions of 1 ml were collected, frozen and lyophilized. Each HPLC fraction was redissolved in 100-400 ml of 49% methanol:1% formic acid and analyzed by ESI-FTMS using a custom 8.5 Tesla ESI-FTMS mass spectrometer equipped with a front-end quadrupole (12). Protein samples were introduced into the FTMS using a NanoMate 100 for automated nanospray (Advion Biosciences, Ithaca, NY). The instrument was externally calibrated using ubiquitin (8560.65 Da monoisotopic Mr value) from Sigma-Aldrich (St. Louis, MO). Peptide masses were calculated with the MIDAS analysis data-station (13), and mass lists were imported into PAWS (Genomic Solutions Inc., Ann Arbor, MI) to localize the active sites. Using these conditions, the SgcE-ACP active site was present in fractions 25 and 26 while the NcsE-ACP active site was located in fractions 42 and 43.The masses corresponding to ACP active site for both NcsE and SgcE were isolated in the quadruple and subjected to collisionally induced dissociation (CAD) or to infrared multiphoton dissociation tandem MS (IRMPD). The resulting fragment ions were analyzed using ProsightPTM (https://prosightptm.scs.uiuc.edu/). Using CAD, the resulting fragment ions for both samples matched the sequence of the active site peptide within 20 ppm. In addition the holo form of SgcE was subjected to IRMPD as described (14) and resulted in the phosphopantetheinyl ejection, confirming the presence of the phosphopantetheinyl cofactor.
Purification of His-6-ACP versions.
All five versions of the ACP were prepared identically to His-6-SgcE except cells were grown with media supplemented with 150 mg /ml kanamycin and using a 20 mM imidazole wash during purification. Protein purity was assessed as >90% by 13.5% acrylamide SDS-PAGE; His-6-tagged constructs were used without further modifications.Purification of PPTases.
Svp was prepared as described (6). The plasmid pACPS1 was introduced into E. coli BL21(DE3), and the resultant recombinant strain was plated on LB medium supplemented with 100 mg/ml ampicillin. Cell cultures were grown as described for SgcE and NcsE overproduction strains. Cells were lysed in 50 mM Tris-HCl pH 8.0, 10 mM MgCl2, and 1 mM DTT, and ACPS was partially purified using a 20-40% (NH4)2SO4 cut. The pellet from 40% (NH4)2SO4 was gently resuspended in a minimal amount of lysis buffer followed by the addition of an equal volume of glycerol and stored at -25°C. Activity was accessed using E. coli ACP (Sigma-Aldrich, St. Louis, MO) and HPLC analysis (vide infra). Under these conditions, ACPS was stable for at least one month.Detection of apo- and holo-ACPs.
Activity assays were carried out at 30°C in 50 mM Tris-HCl pH 8.0, 10 mM MgCl2, 2 mM DTT, 20 mg/ml BSA, 5 mM CoA, 0.5 mM ACP, and ~10 mM Svp or ACPS. Samples were quenched with an equal volume of 0.1% trichloroacetic acid in 10% acetonitrile (Solvent A) and centrifuged to remove insoluble material. The sample was subjected to C4 reverse-phase HPLC with an analytical Jupiter C4 300Å column (250 ´4.6 mm, 5 mm; Phenomenex, La Jolla, CA). A series of linear gradients was developed from Solvent A to 0.1% trichloroacetic acid in 90% acetonitrile (Solvent B) in the following manner (beginning time and ending time with linear increase to % B): 0-5 min, 5% B; 5-32 min, 95% B; 32-40 min, 95% B, and 40-45, 0% B. The flow rate was kept constant at 1.0 ml/min and elution was monitored at 220 nm. Individual protein peaks were collected and lyophilized for ESI-MS analysis using an Agilent (Palo Alto, CA) 1000 HPLC-MSD SL instrument.Co-expression of E/E10 for polyene production in E. coli.
Thioesterase plasmids pBS1051 or pBS5038 were introduced into E. coli BL21(DE3) competent cells already containing either pBS1050 or pBS5036. Cells were grown in LB medium as described above except supplemented with 50 mg/ml kanamycin and 50 mg/ml streptomycin. To produce the polyene compound, incubations were performed as above except the IPTG-induced cells were grown for additional 36 h before harvesting the cells.Co-expression of E/E10 for polyene production in Streptomyces.
For Streptomyces expression, constructs were transformed into S. lividans TK-64 or S. albus by PEG mediated protoplast transformation following standard procedure. After 20 h, the transformation plates were overlaid with soft R2YE medium supplemented with 50 mM thiostrepton. Single colonies were picked 3 days after overlay and transferred to fresh ISP2 plate containing 50 mM thiostrepton for a second round of antibiotic selection. For production of the polyene compound, a loopful of mycelium was inoculated into 3 ml TSB medium supplemented with 25 mg/ml thiostrepton and grown for 2 days at 28°C. The mycelium were harvested, homogenized and used to inoculate 50 ml TSB medium in a 250-mL flask with 25 mg/ml thiostrepton, and the resulting culture was incubated at 28°C for 3 days before harvesting.[1-13C]-, [2-13C]-, or [1,2-13C2]Sodium acetate incorporation
. E. coli was cultured as described above. At the time of induction, 0.5 mg [1-13C]-, [2-13C]-, or [1,2-13C2]sodium acetate was added to 500 ml of fermentation culture, and after an additional 12 h, a second aliquot of 13C-labeled sodium acetate was added (final 13C-labeled sodium acetate concentration 2 g/L). The cultures were grown at 18°C for 24 h before harvesting.Preparation of the polyene compound.
Isolation of the polyene compound from both E. coli and Streptomyces followed the same procedure. After harvesting, the cells were re-suspended in water to a density of ~200 mg/ml. Lysozyme was added to 1 mg/ml and cells were incubated at room temperature for 30 min. After lysis, cells were sonicated until homogeneity. The cell lysate was centrifuged at 15,000 rpm for 1 h at 4°C. The supernatant was discarded and the cell debris was washed sequentially with 0.1 M sodium acetate pH 6.0 and ethanol followed by centrifugation at 15,000 rpm for 15 min. Cells were treated with ethyl acetate (1:100 wt/vol), and the extract was evaporated to dryness under reduced pressure. The dried sample was dissolved in a minimal amount of chloroform and subjected to polyamide 6 (Sigma-Aldrich, St. Louis, MO) column chromatography and elution with chloroform. The fraction containing the polyene compound was concentrated and subjected to silica gel column chromatography and elution with hexane/chloroform (9:1) followed by semipreparative C18 reverse phase HPLC (Apollo, 250 ´10 mm, 5 mm; Grace Davison, Deerfield, IL). The collected HPLC fraction was evaporated to dryness and dissolved in minimum amount of CDCl3 for NMR and high resolution-LC-APCI spectroscopic analysis. For 13C-labeled sample, spectroscopic analysis was performed after extraction and polyamide 6 chromatography.HPLC and MS of the Polyene Compound.
HPLC and LC-MS analysis was carried out on a Phenomenex Kromasil 5 mM C4 analytical column (150 ´ 4.6 mm). The column was equilibrated with 50% Solvent C (H2O) and 50% Solvent D (acetonitrile) and eluted with the follow program (0-10 min, from 50% D to 100% D, 10-15 min, 100% D) at a flow rate of 0.8 ml/min. UV detection was at 390 nm using a Varian Prostar 330 diode array detector. The target polyene eluted at 12.8 min. Routine LC-APCI-MS was carried out on a Agilent 1000 HPLC-MSD SL instrument using same gradient program but H2O with 0.1% formic acid as Solvent C and methanol with 0.1% formic acid as Solvent D. Under these conditions, the compound also eluted between 12.8 and 12.9 min. High-resolution LC-APCI-MS was done at the Mass Spectrometry Core of the Research Technology Support Facility at Michigan State University.Generation of mutant PKSE complementation plasmids.
To construct the complementation plasmid containing the maduropeptin (MDP) PKSE, the 9.5-kb PstI-BamHI fragment from cosmid pBS10004 (15,16) was cloned into pANT841 to yield pBS10006. The 9.5-kb HindIII-BamHI fragment from pBS10006 was co-ligated with the 0.45-kb EcoRI-HindIII fragment of pWHM79 into pSET152 to yield pBS10005 (17). The plasmid pBS5020 was used as the complementation plasmid containing the neocarzinostatin (NCS) PKSE, and pBS1049 was used as the complementation plasmid containing the C-1027 PKSE. To construct pBS1088, the 0.5-kb EcoRI-SmaI fragment of pWHM79 containing the ErmE* promoter was ligated into pANT841 to give pBS1087. The 1.8-kb NcoI-StuI fragment and 6 kb StuI-SpeI fragment from cosmid 4a (18) containing calE8, the calicheamicin PKSE, were co-ligated with the 0.5-kb EcoRI-NcoI fragment of pBS1087 into the EcoRI-SpeI sites of pSET152 to give pBS1088. Appropriate plasmids were introduced into S. globisporus strain SB1005 using intergeneric conjugation or introduced into S. carzinostaticus strain SB5002 using PEG-assisted protoplast transformation.Analysis of C-1027 and NCS production
. Plasmids were introduced into S. globisporus strain SB1005 by intergeneric conjugation using E. coli ET12567/pUZ8002 following a described protocol (4, 7). Fermentation and isolation of C-1027 were as described10. Plasmids were introduced into S. carzinostaticus strain SB5002 using PEG-assisted protoplast transformation (5, 7). NCS production was monitored as described (7). All fermentations involving C-1027 complementation were performed minimally in triplicate using pBS1049 as a positive control.1. Bierman M et al. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116:43-49.
2. Vara J, Lewandowski-Skarbek M, Wang Y, Donadio s, Hutchinson CR (1989) Cloning of genes governing the deoxysugar portion of the erythromycin biosynthesis pathway in Saccharopolyspora erythraea (Streptomyces erythreus). J Bacteriol 171:5872-5881.
3. Shen B, Hutchinson CR (1993) Enzymatic synthesis of a bacterial polyketide from acetyl and malonyl CoA by a type II polyketide synthase. Science 262:1535-1540.
4. Liu W, Shen B (2000) Genes for production of the enediyne antitumor antibiotic C-1027 in Streptomyces globisporus are clustered with the cagA gene that encodes the C-1027 apoprotein. Antimicrob Agents Chemother 44:382-392.
5. Liu W et al. (2005) The neocarzinostatin biosynthetic gene cluster from Streptomyces carzinostatitus ATCC 15944 involving two iterative type I polyketide synthases. Chem Biol 12:293-302.
6. Sánchez C, Du L, Edwards DJ, Toney MD, Shen B (2001) Cloning and characterization of a phosphopantetheinyl transferase from Streptomyces verticillus ATCC15003, the producer of the hybrid peptide-polyketide antitumor drug bleomycin. Chem Biol 8:725-738.
7. Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA (2000) Practical Streptomyces Genetics (The John Innes Foundation, Norwich, UK).
8. Rajgarhia VB, Strohl WR (1997) Minimal Streptomyces sp. strain C5 daunorubicin polyketide biosynthesis genes required for aklanonic acid biosynthesis. J Bacteriol 179:2690-2696.
9. Lambalot RH, Walsh CT (1997) Holo-[acyl-carrier-protein] synthase of Escherichia coli. Methods Enzymol 279:254-262.
10. Liu W, Christenson SD, Standage S, Shen B (2002) Biosynthesis of the enediyne antitumor antibiotic C-1027. Science 297:1170-1173.
11. Aron ZD, Dorrestein PC, Blackhall JR, Kelleher NL, Walsh CT (2005) Characterization of a new tailoring domain in polyketide biogenesis: the amine transferase domain of MycA in the mycosubtilin gene cluster. J Am Chem Soc 127:14986-14987.
12. Patrie SM et al. (2004) Construction of a hybrid quadrupole/fourier transform ion cyclotron resonance mass spectrometer for versatile MS/MS above 10 kDa. J Am Soc Mass Spec 15:1099-1108.
13. Senko MW, Canterbury JD, Guan S, Marshall AG (1996) A high-performance modular data system for Fourier Transform ion cyclotron resonance mass spectrometry. Rapid Commun Mass Spectrom 10:1839-1844.
14. Dorrestein PC et al. (2006) Activity screening of carrier domains within nonribosomal peptide synthetases using complex substrate mixtures and large molecule mass spectrometry. Biochemistry 45:1537-1546.
15. Zazopoulos E et al. (2003) A genomics-guided approach for discovering and expressing cryptic metabolic pathways. Nat Biotechnol 21:187-190.
16. Liu W et al. (2003) Rapid PCR amplification of minimal enediyne polyketide synthase cassettes leads to a predictive familial classification model. Proc Natl Acad Sci USA 100:11959-11963.
17. Van Lanen SG, Oh T, Liu W, Wendt-Pienkowski E, Shen B Characterization of the maduropeptin biosynthetic gene cluster from Actinomadura madurae ATCC 39144 supporting a unifying paradigm for enediyne biosynthesis. J Am Chem Soc /I> 129:13082-13094, 2007.
18. Whitwam RW, Ahlert J, Holman TR, Ruppen M, Thorson JS (2000) The gene calC encodes for a non-heme iron metalloprotein responsible for calicheamicin self-resistance in Micromonospora. J Am Chem Soc 122:1556-1557.
Fig. 6. Characterization of recombinant SgcE and NcsE. (A) SDS/PAGE of purified NcsE (lane 2) and SgcE (lane 3) migrating at the expected molecular weight of ~208 kDa. (B) The UV-Vis profile of SgcE with indicated maxima and the yellow phenotype of pure SgcE in comparison to the ACP mutant SgcE(S974A).
Fig. 7. Mapping the NcsE ACP active site. (A) Fourier transform ion cyclotron resonance-MS analysis of the combined HPLC fractions 42 and 43 showing the active site ACP of NcsE in both the apo and holo forms. (B) The verification of the active site by mapping the fragment ions onto the active site sequence using prosightPTM within 25 ppm. The fragment ions were generated via quadrupole and SWIFT isolation of the active site fragment ion from the spectrum shown in A and subsequently subjected to IRMPD.
Fig. 8. In vitro 4'-phosphopantetheinylation of the ACP domain of SgcE. (A) The reaction catalyzed by PPTase to generate holo-ACP. (B) SDS-PAGE of the five ACP versions used in this study and HPLC analysis of the purified apo-ACP [ACP81 (I), ACP108 (II), ACP136 (III), ACP109 (IV), and ACP212 (V)] and reactions with E. coli ACPS or Svp to generate holo-ACP (¨). (C) Time course analysis using ACP81 showing conversion of the apo-ACP to holo-ACP upon incubation with Svp.
Table 1. Mass analysis of ACPs derived from SgcE
Version | Apo-ACP | Holo-ACP | ||
Observed | Calculated | Observed | Calculated | |
ACP81 | 10120 | 10118 | 10461 | 10458 |
ACP81(S974A) | 10104 | 10102 | N/A | N/A |
ACP108 | 12817 | 12814 | 13156 | 13154 |
ACP136 | 15616 | 15614 | 15956 | 15954 |
ACP109 | 12919 | 12919 | 13260 | 13259 |
ACP212 | 23695 | 23694 | 24034 | 24034 |
Fig. 9. 1H NMR spectrum of 1,3,5,7,9,11,13-pentadecaheptaene. The two peaks between d 0.8-1.3 ppm are impurities from the polyamide chromatography.
Fig. 10. 1H-1H COSY spectrum of 1,3,5,7,9,11,13-pentadecaheptaene.
Table 2. 1H (500 MHz) and 13C (125 MHz) NMR spectral data for 1,3,5,7,9,11,13-pentadecaheptaene in CDCl3
Position |
|
|
1 | 117.5* | 5.09 (1 H, dd, J=10.0, 2.0 ), 5.22 (1 H, dd, J=16.5, 2.0) |
2 | 137.4** | 6.39 (1 H, dt, J=17.0, 10.0) |
3 | 133.6*,[a] | 6.18-6.34 (m) |
4 | 134.1**,[b] | 6.18-6.34 (m) |
5 | 132.8*[a] | 6.18-6.34 (m) |
6 | 134.0**,[b] | 6.18-6.34 (m) |
7 | 132.8*,[a] | 6.18-6.34 (m) |
8 | 134.0**,[b] | 6.18-6.34 (m) |
9 | 132.5*,[a] | 6.18-6.34 (m) |
10 | 133.9**,[b] | 6.18-6.34 (m) |
11 | 130.8*,[a] | 6.18-6.34 (m) |
12 | 133.8**,[b] | 6.18-6.34 (m) |
13 | 132.2* | 6.10 (m) |
14 | 130.7** | 5.74 (1 H, dq, J=19.0, 7.0) |
15 | 18.7* | 1.80 (3 H, d, J=7.0) |
*Data acquired using [2-13C]sodium acetate-enriched sample.
**Data acquired using [1-13C]sodium acetate-enriched sample.
a
Assignments are interchangeableb
Assignments are interchangeable.Fig. 11. HPLC-APCI-MS analysis of 13C labeled 1,3,5,7,9,11,13-pentadecaheptaene. Top: [1-13C]Sodium acetate-enriched compound; bottom: [2-13C]sodium acetate-enriched compound. Shown in the Inset is the statistical distribution with the indicated percentage of 13C incorporation and number of carbons.
Fig. 12. 13C NMR spectrum of 1,3,5,7,9,11,13-pentadecaheptaene from (A) [1-13C]sodium acetate (the broad peak at d 133.9 represents two carbons) and (B) [2-13C]sodium acetate (the broad peak at d 132.8 represents two carbons).
Table 3. Complementation of PKSE mutant strains
Host strain (genotype) | Plasmid | Description | Production | |
C-1027 | [M+H]+ observed | |||
SB1005 (sgcE) | pBS1049 | C-1027 PKSE | + | 844.259 & 846.272 |
pBS5020 a | NCS PKSE | + | 844.255 & 846.271 | |
pBS10005 | MDP PKSE | + | 844.259 & 846.272 | |
pBS1088 | CAL PKSE | - | N/A | |
NCS | [M+H]+ observed | |||
SB5002 (ncsE) | pBS1049 | C-1027 PKSE | + | 660.3 |
pBS5020 | NCS PKSE | + | 660.3 | |
pBS10005 | MDP PKSE | + | 660.3 | |
pBS1088 | CAL PKSE | - | N/A | |
a
Plasmid construction described in ref. 5.