Pearson et al. 10.1073/pnas.0712162105.
Fig. 5. Nrf2 was activated by CR in WT mice. Nrf2 activation was assessed by measuring mRNA levels of four downstream effectors by real-time PCR in mouse livers. The mean values were calculated for HO-1 (A), GCLC (B), GST A1 (C), and GPx-1 (D). n = 4 or 5 for all comparisons. Black, AL WT; red, CR WT; green, AL KO; blue, CR KO. There were no significant differences.
Fig. 6. Two-stage carcinogenesis model. (A) Calories were restricted in mice for 5-6 weeks before a single topical treatment with the chemical carcinogen DMBA. Mice were then treated twice weekly with the tumor promoter, TPA, until tumors were observed. (B) Photograph of an AL-fed KO mouse with a papilloma following treatment with DMBA and TPA. (C) H&E stained slide of a papilloma from an AL-fed KO mouse at 4´ magnification. In this particular papilloma, the collagen in the dermis is disrupted and fragmented. In addition, dilated cystic spaces and keratin pearls are present with hyperplastic and dysplastic keratinocytes along with an expanded lamina propria.
Fig. 7. AL and CR body weights from induced carcinogenesis studies. (A) WT and KO mice were separated into two groups, AL and 40% CR. The food was restricted to 40% less than that of the AL-fed WT or KO mice. (B and C) WT and KO mice were separated into three groups, AL and 20 or 30% CR. (B) The food was gradually restricted over 2 weeks to 30% less than that of the AL-fed WT or KO mice. (C) The food was gradually restricted over 2 weeks to 20% less than that of the AL-fed WT or KO mice. Black, AL WT; red, CR WT (20, 30, or 40% restriction); green, AL KO; blue, CR KO (20, 30, or 40% restriction).
Fig. 8. Tumor incidence and occurrence rate in AL- and 40% CR-fed WT, HT, and KO mice. Percentage of mice with at least one papilloma. (A) AL-fed mice presenting tumors after DMBA treatment at time 0. (B) CR-fed mice presenting tumors after DMBA treatment at time 0. Black, WT (AL or CR); red, HT (AL or CR); green, KO (AL or CR). (C) Tumor occurrence rate is shown as number of tumors per mouse per week of tumor development for mice on AL- and 40% CR-fed diets. The number of weeks was used because the mice were treated for different durations depending on when tumor development occurred. White, WT (AL, solid; CR, hatched); red, HT (AL, solid; CR, hatched); green, KO (AL, solid; CR, hatched).
Fig. 9. AL and 40% CR body weights, tumor incidence and survival of female mice. (A and B) Body weight of mice in grams. The food was restricted to 40% less than that of the AL-fed KO mice. (A) WT and KO mice were separated into AL- and CR-fed groups for two-stage carcinogenesis model. (B) KO mice were separated into two groups, AL and CR for survival analysis. (C) Percentage of female mice with at least one papilloma. AL- and CR-fed WT and KO mice presenting tumors after DMBA treatment at time 0. (D) Kaplan-Meier survival analyses of AL- and CR-fed KO mice were performed. n = 30 for AL- and CR-fed mice. The survival curves for the AL- and CR-fed KO mice differ significantly by the logrank test; (c2 = 18.0, P < 0.0001). CR increased median lifespan by 27.6% (134 vs. 105 weeks). Although maximum lifespan has not yet been recorded in the CR KO group, it does appear that it will be extended. At this point, none of the AL-fed Nrf2 mice are alive and if the remainder of the CR-fed mice (n = 10) die within the next week, maximum lifespan will have been significantly extended by 10% at a minimum. Black, AL WT; red, CR WT; green, AL KO; blue, CR KO.
Table 2. Primer sequences for real-time PCR
mRNA targets | Sense | Antisense |
NQO1 | TTCTCTGGCCGATTCAGAG | GGCTGCTTGGAGCAAAATAG |
GPx-1 | TCTGGGACCTCGTGGACT | CACTTCGCACTTCTCAAACAA |
HO-1 | CTGTGAACTCTGTCCAATG | AACTGTGTCAGGTATCTCC |
GST A1 | CCAGAGCCATTCTCAACTA | TGCCCAATCATTTCAGTCAG |
GCLC | AGCATCTGGAGAACTAATG | CAAGTAACTCTGGACATTCA |
GAPDH | CACCAACTGCTTAGCCCC | TCTTCTGGGTGGCAGTGATG |
HPRT | TGCTGCGTCCCCAGACTTT | AGATAAGCGACAATCTACCA |
SI Text
Real-Time PCR. RNA was isolated from frozen liver sections of WT and KO mice on AL and 40% CR diets from the two-stage carcinogenesis mice for NQO1 (n = 3) or untreated mice for HO-1, GPx-1, GST A1, and GCLC (n = 4-5 for each group), using an RNeasy kit (Qiagen) or Mini RNA isolation kit (Zymo Research). cDNA synthesis was completed by using the Invitrogen Superscript III First Strand protocol followed by Real Time PCR, using RT2Real TimeTM-SYBR Green protocol by SuperArray to observe expression of NQO1, HO-1, GPx-1, GST A1, and GCLC. Efficiency of the PCR was determined by using dilution series of a standard vascular sample. Quantification was performed by using the DDCT method. The housekeeping genes GAPDH or HPRT were used for internal normalization. Oligonucleotides used for real-time QRT-PCR are listed in SI Table 2. Fidelity of the PCR was determined by melting temperature analysis and visualization of product on a 2% agarose gel.
NQO1 Activity Assay. Frozen liver sections of 16-week-old WT and KO mice on AL and 40% CR diets for 6 weeks (n = 5 for each group) were homogenized in Tris-sucrose buffer [10 mM Tris×HCl (pH 7.4) and 25 mM sucrose] and lysates were centrifuged at 100,000 ´g for 40 min at 4°C. For NQO1 activity, the reaction mixtures contained, in a final volume of 1.0 ml: 25 mM Tris×HCl (pH 7.4), 0.01% Tween-20, 0.1% BSA, 80 mM 2,6-dichloroindophenol (DCIP), 0 or 40 mM dicumarol, 200 mM NADH, and an appropriate volume of cytosolic sample. Reduction of DCIP was determined spectrophotometrically at 600 nm for 3 min, using a Perkin-Elmer Lambda 25 spectrophotometer. Specific NQO1 activity is described as the dicumarol-sensitive decrease in absorbance of DCIP as a substrate (extinction coefficient 2,100 M-1cm-1) and is expressed in nanomoles of DCIP reduced per minute per microgram of protein. Protein concentrations were determined by Bradford method (1).
Serum Markers and Hormones. For single glucose, insulin, and IGF-1 measurements, blood samples were taken by submandibular bleed after a 16-h fast. Glucose was measured in whole blood using an Ascensia Elite glucose meter (Bayer). For insulin and IGF-1 measurements, whole blood was allowed to clot for 30 min and spun at 14,000 rpm in a benchtop centrifuge for 7 min to pellet blood cells. The serum was transferred to a fresh tube and placed on dry ice, after which it was stored at -80°C. Insulin and IGF-1 levels were measured in serum using ELISA kits (Crystal Chem and Immunodiagnostic Systems, respectively). Insulin resistance was estimated by using the HOMA2 Calculator software available from the Oxford Centre for Diabetes, Endocrinology and Metabolism Diabetes Trials Unit web site as described by Levy et al. (2). In addition, an insulin tolerance test was performed according to Bonkowski et al. (3). Mice were fed 100% of AL overnight and then were allowed to adjust to the surroundings of the procedure room for 1 h before the test. Food was removed and glucose was measured by using an Ascensia Elite glucose meter in whole blood taken from the tail vein at set time points just before and after i.p. insulin injection at 1.2 units per kilogram of body weight. Porcine insulin purchased from Sigma was used (I-5523). n = 5 for all groups except n = 3 for CR-fed WT mice. Corticosterone levels were measured according to the manufacturer's instructions using the 125-I RIA kit from MP Biomedicals.
Histology. Tumors were fixed in Streck fixative (Streck). Representative tumors were sectioned and stained with H&E by Histoserve. Representative slides were analyzed according to overall morphology.
1. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-254.
2. Levy JC, Matthews DR, Hermans MP (1998) Correct homeostasis model assessment (HOMA) evaluation uses the computer program. Diabetes Care 21:2191-2192.
3. Bonkowski MS, Rocha JS, Masternak MM, Al Regaiey KA, Bartke A (2006) Targeted disruption of growth hormone receptor interferes with the beneficial actions of calorie restriction. Proc Natl Acad Sci USA 103:7901-7905.