Progenitor/stem cells give rise to liver cancer due to aberrant TGF-β and IL-6 signaling

Table 1. Microarray results showing expression of genes involved in Wnt and IL-6/Stat3 signaling pathways in elf^+/-, itih4^-/- and elf^+/-/itih4^-/- mouse liver tissues compared to wild-type liver tissues

Wnt3a expression is increased in elf^+/- liver tissue while it is decreased in itih4^-/- and elf^+/-/itih4^-/- mouse liver tissues compared with wild type liver tissues. IL-6 expression is also suppressed in itih4^-/- and elf^+/-/itih4^-/- mouse liver tissues compared with wild-type liver tissues.

SI Text

Experimental Procedures

Construction of the targeting vector and generation of mice carrying mutations. Targeting Vector: Recombinant phage containing genomic DNA of the itih4 locus was isolated from a 129/SvEv mouse library by using PK7R, a piece of itih4 cDNA, as a probe. The finished construct, p-itih4Neo, is shown in Fig. 3C. This targeting strategy deletes a 1.8-kb SmaI-ClaI fragment that contains the second and third exons of the itih4 gene. Homologous Recombination in ES Cells and Generation of Germline Chimeras: TC1 ES cells were transfected with NotI digested p-itih4Neo, and selected with G418 and FIAU. ES cell clones that were resistant to both G418 and FIAU were selected and analyzed by Southern blotting for homologous recombination events within the itih4 locus (Fig. 3D). ES cells heterozygous for the targeted mutation were microinjected into C57BL/6 blastocysts to obtain germline transmission. The injected blastocysts were implanted into the uteri of pseudopregnant Swiss Webster (Taconic, NY) foster mothers and allowed to develop to term. Male chimeras (identified by the presence of agouti coat color) were crossed with C57B6 and NIH Black Swiss females (Taconic, NY). Germline transmission was confirmed by agouti coat color in the F1 animals, and all agouti offspring were tested for the presence of the mutated itih4 allele by Southern blot analysis using the same conditions for the detection of the homologous recombination event in the ES cells.

Genotype analysis. Genotypes were determined by Southern blotting or PCR. For PCR analysis, the wild-type itih4 allele was detected using primer 1 (5' CTCATACTAGGCAGATCTC 3') and primer 2 (5' GTAGCTCTACTTGGAAGGTC 3'). Primer 1 is located 5' to the deletion and primer 2 is located within the deletion. This primer pair amplifies a fragment of 481 bp from wild-type and itih4 heterozygous, but not from itih4^-/- mutant mice. DNA was also amplified using primer 1 and primer 3, which is located in the Neo locus (5' CAGCTCATTCCTCCCACTCATGAT 3') to detect the mutant itih4 allele. In this case, a 620-bp fragment was detected in mice heterozygous or homozygous for the mutant itih4 allele, while no signal was detected in wild-type mice.

Confocal laser-scanning immunofluorescence microscopy. Colocalization studies were performed with anti-ELF and anti-Stat3, and anti-Oct4 using human regenerating liver and HCC tissues. Normal wild-type, elf^+/-, itih4^-/-, and elf^+/-/itih4^-/- mutant livers and HCC tissues were also used for the confocal microscopy. Peptide specific monoclonal mouse and rabbit polyclonal primary antibodies were visualized with Tetramethyl rhodamine isothiocyanate (TRITC)-conjugated goat anti-rabbit IgG or Fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG. The samples were analyzed with a Bio-Rad MRC-600 confocal microscope (Bio-Rad, Cambridge, MA), with an ILT model 5470K laser (Ion Laser Technology, Salt Lake City, UT) as the source for the crypton-argon ion laser beam. FITC-stained samples were visualized by excitation at 488 nm and with a 505- to 540-bandpass emission filter, and Rhodamine-stained samples were visualized by excitation at 568 nm with a 598- to 621-bandpass emission filter using a 60x (numerical aperture 1.3) objective and 20x objective. Digital images were analyzed using Metamorph (Universal Imaging) and figures were prepared using Adobe Photoshop.

Generation of mouse embryo-derived fibroblasts. Mouse embryo-derived fibroblasts (MEFs) harboring the null allele elf and itih4 as well as wild-type were derived as described (1). Briefly, embryos E14.5 were triturated in 0.25% trypsin/1 mM EDTA and genotyped. The lines were propagated in Dulbecco's modified Eagle's medium supplemented with 10% FBS, 100 units/ml penicillin, and 50 mg/ml streptomycin to establish fibroblasts that were cultured over several passages to obtain enough cells to perform the experiments. The fibroblasts used for the experiments were at passage 3-5. Wild-type and itih4^-/- fibroblast lines were used in experiments, and the results obtained were also independent of passage number. Representative data are shown.

Immunoblot assay. For assaying endogenous TBRII, ELF, ITIH4, IL-6, Stat3, pStat3, protein lysates of human HCC cells (SNU-182 (CRL-2235), SNU-398 (CRL-2233), and SNU-449 (CRL-2234) ATCC, VA), MEFs, and normal wild-type, elf^+/-, itih4^-/-, and elf^+/-/itih4^-/- mutant liver and HCC tissues were immunoblotted with the indicated anti-peptide or anti-phospho-specific antibodies (Santa Cruz Biotechnology, CA; Invitrogen, CA, and Abcam, MA). The loading control was performed under the same conditions using mouse monoclonal anti-Actin (Sigma, MO). MEFs cultured in the presence or absence of IL-6 (5 ng/ml, Sigma, MO) for 24 h were washed with PBS and lysed (150 mM NaCl, 50 mM Tris, 1% Nonidet P-40, and complete mini protease inhibitors (Roche Molecular Biochemicals)). 50-100 mg of total protein in 1x Lamaelli buffer was heated to 95° for 10 min and then loaded onto a PAGE GEL for Western blotting.

Histological analysis and antibody staining. Mice exhibiting overt pathological signs were killed and underwent autopsy. Liver and HCC tissues were dissected, fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin and sectioned at 6 mm. Sections were stained with hematoxylin and eosin (H&E), or subjected to immunohistochemical analysis with antibodies. Immunohistochemical staining was performed with primary antibodies against ELF, Oct4, ITIH4, Stat3, pStat3, pHistone H3 (Ser-10), and Caspase-3 (Santa Cruz Biotechnology, CA; Invitrogen, CA, Promega, OR, and Abcam, MA). Sections were then incubated with peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories, PA) of appropriate specificity and processed for immunostain using diaminobenzidine (Sigma, MO) and counterstaining was performed with modified Harris hematoxylin solution (Sigma, MO).

Detection of proliferating cells. Proliferating cells were labeled with BrdU labeling and detection kit (Invitrogen, CA). BrdU (1 ml/100 g body weight) was injected (i.v.) into 18.5 dpc pregnant mice, and 4 h later the fetal stomachs were fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned at 6 mm. The proliferating cell was also identified by anti-pHistone H3 (Ser-10) mitotic marker labeling.

Detection of apoptotic cells. Apoptotic cells were detected by the TUNEL method with a MEB STAIN Apoptosis Kit Direct (MBL, 8445) as well as with anti-Caspase-3 antibody (Promega, OR). Tissues were then fixed and analyzed by using immunofluorescence microscopy.