Institution: NIH Library Sign In as Member / Individual

This Article Full Text Services Alert me to new issues of the journal Request Copyright Permission

Total RNA from human placenta samples, cytotrophoblast cells, and placenta fibroblast cells were gifts from D. Evain-Brion (1). Total RNA from BeWo choriocarcinoma cells (ATCC CCL98), T47D breast carcinoma cells (ATCC HTB133), and NT2/D1 teratocarcinoma cells (ATCC CRL1973) were extracted using TRI-Reagent (Sigma) following the manufacturer’s instructions. Quality of the RNA was assessed on an RNA LabChip (Agilent 2100 Bioanalyzer), and RNA concentration was quantified spectrophotometrically. Five micrograms of each RNA sample were submitted to DNase treatment (DNA-free, Ambion) to eliminate DNA contaminants. One microgram of RNA from each sample was reverse transcribed in a 20-µl volume reaction using 50 units of Moloney murine leukemia virus reverse transcriptase, 20 units of ribonuclease inhibitor (Applied Biosystems), 1 mmol/liter dA/T/G/C (Amersham Pharmacia Biotech), 5 mmol/liter MgCl₂, 10 mmol/liter Tris· HCl (pH 8.3), 10 mmol/liter KCl, and 2.5 m mol/liter random hexamers (Applied Biosystems). The complementary DNAs were then diluted 1/25 in nuclease-free H₂O (Promega). Real-time quantitative PCR was achieved with primers FRDf (GCCTGCAAATAGTCTTCTTT) and FRDr (ATAGGGGCTATTCCCATTAG) (which only amplify the coding envelope gene of the HERV-FRD family ; ref. 2), using a complementary DNA equivalent of 20 ng of total RNA. The reaction was performed in 25 µl using SYBR Green PCR Core Reagents (Applied Biosystems) according to the manufacturer’s instructions. PCR was developed with the ABI PRISM 7000 Sequence Detection System (Applied Biosystems). Amplification was performed using a 2-min step at 50°C, then a 10-min denaturation step at 95°C, followed by 40 cycles of 15 s denaturation at 95°C and a 1-min primer annealing and polymerization step at 60°C. To normalize for small variations in total RNA added to the reaction, amplification of 18S total ribosomal RNA was performed as an internal control. Primers and probe from 18S RNA were purchased from Applied Biosystems. Each sample was analyzed at least twice.

1. Frendo, J. L., Olivier, D., Cheynet, V., Blond, J. L., Bouton, O., Vidaud, M., Rabreau, M., Evain-Brion, D. & Mallet, F. (2003) Mol. Cell. Biol. 23, 3566–3574.

2. de Parseval, N. Lazar, V., Casella, J. F., Benit, L. & Heidmann, T. (2003) J. Virol. 77, 10414–10422.