Files in this Data Supplement:
Fig. S1. Mouse and zebrafish Rfx proteins. (A) Alignment of mouse Rfx DNA binding domains using ClustalW. (B) Comparison of mouse Rfx proteins and zebrafish orthologues. The dendrogram was generated by comparing mouse and zebrafish Rfx proteins using ClustalW and Treeview. Mouse sequences used for comparison: Rfx1 Mm (NP_033081), Rfx2 Mm (NP_033082), Rfx3 Mm (NP_035395), Rfx4 Mm (NP_001020089), Rfx5 Mm (NP_059091), Rfx6 Mm (NP_001152861), Rfx7 Mm (NP_001028708). Zebrafish sequences used for comparison: Rfx1 Dr (ENSDARP00000039332), Rfx2 Dr (ENSDARP00000010260), Rfx3 Dr (ENSDARP00000041235), Rfx4 Dr (ENSDARP00000032295), Rfx5 Dr (ENSDARP00000086706), Rfx6 Dr (ENSDART00000061122), Rfx7 Dr (ENSDARP00000102179). Dr, Danio rerio; Mm, Mus musculus.
Fig. S2. Rfx6-expressing cells are postmitotic in the mouse pancreas. Double immunofluorescence for Rfx6 and Ki-67 on cryosections of mouse pancreata at different developmental stages showing that Rfx6 is mainly expressed in non-dividing Ki-67-negative cells. Arrows point to rare double-positive cells.
Fig. S3. rfx6 is exclusively expressed in the pancreas area during early zebrafish development. (A) General view of embryo stained by fluorescent wholemount in situ hybridization (WISH) for the expression of rfx6. (B-H) Pancreatic expression starts around 17 hpf, peaks around 24 hpf and persists at least until 72 hpf. Ventral views, anterior to the left. Scale bars:10µm. Panels A and D are the same as panels A and B in Fig. 6.
Fig. S4. rfx6 is expressed in all of the hormone-expressing cells in zebrafish. Ventral views of the pancreas area from 30 hpf embryos analysed by double-fluorescent wholemount in situ hybridization (WISH), anterior to the left. The right column presents the overlay of the left and middle panels.
Fig. S5. Targeting efficiency of rfx6 morpholinos. (A) Partial genomic structure of the rfx6 gene. Splice sites targeted by morpholinos (MOs) are shown in red. The arrows indicate the location of the primers used for PCR (0169: CATCAAGGACAAGAAGAAGCAGAC and 0170: TTCCCGGAGTAAACAGAGTGATAA). (B) RT-PCR analysis of rfx6 mRNA structure in the control (lane 1) and morphants (lanes 2 and 3) using 0169 and 0170. In the MO1 morphants, we can observe the apparition of a 360 bp band corresponding to a transcript containing intron1. In the MO2 morphants, the amplicon is reduced in size (120 bp), indicating a deletion of exon2. The identity of the amplicons has been confirmed by sequencing.
Fig. S6. Acetylated-tubulin labelling reveals ciliated cells within the developing pancreas of wild-type and morphant zebrafish. Experiments to visualize primary cilia were performed on transgenic zebrafish embryos tg(pax6:GFP) where pancreatic endocrine cells can be detected by GFP expression (Delporte et al., 2008). (A,B) Pancreatic cell labelling using the tg(pax6:GFP) transgenic line underlines the developing pancreas in control (A) and rfx6 Mo2 morphants (B). (C,D) Magnifications of the area in white boxes in A and B with the acetylated-tubulin-labelled cilia in red and pax6:GFP in green. Arrows in C and D point to cilia. The same cilia are marked with a grey dot visible in Movies 1 and 2. Scale bars: 10 mm in A,B; 2 mm in C,D.
Delporte, F. M., Pasque, V., Devos, N., Manifroid, I., Voz, M. L., Motte, P., Biemar, F., Martial, J. A. and Peers, B. (2008). Expression of zebrafish pax6b in pancreas is regulated by two enhancers containing highly conserved cis-elements bound by PDX1, PBX and PREP factors. BMC Dev. Biol.8, 1-19.
Movie 1. 3D visualization of cilia at the pancreatic cell surface in control embryos at 24 hpf. Acetylated-tubulin-labelled cilia are in red and the pancreatic cell using pax6:GFP-labelling is in green. Cilia are marked with a grey dot. Scale box: 2 µm.
Movie 2. 3D visualization of cilia at the pancreatic cell surface in rfx6 MO2 morphants at 24 hpf. Acetylated-tubulin-labelled cilia are in red and the pancreatic cell using pax6:GFP-labelling is in green. Cilia are marked with a grey dot. Scale box: 2 µm.