Fig. S1. Cellular localization of hDlg and PSF. (A) HEK293 cells were subjected to cellular fractionation, and 40 g protein from each cell fraction immunoblotted using the antibodies indicated. (B) MEF cells were stained with anti-PSF and anti-hDlg antibody, and subjected to fluorescence microscopy. In merged images, the co-localized signal is shown in yellow.

Fig. S2. Knockdown of p38γ blocks hDlg phosphorylation after osmotic stress. HEK293 cells were transfected with empty pSuper vector (pS) or with a mixture of siRNA constructs to knock down p38γ (pS3mix). Cells were incubated for 1 hour with or without 10 M SB 203580 and then exposed for 15 minutes to 0.5 M sorbitol, endogenous hDlg was immunoprecipitated from 0.5 to 10 mg protein lysates and pellets were immunoblotted with the antibodies that recognises hDlg phosphorylated at S158 (P-hDlg^S158), T209 (P-hDlg^T209), S431 (P-hDlg^S431) or S442 (P-hDlg^S442) (residues phosphorylated by p38γ in cells) or antibody that recognises unphosphorylated and phosphorylated hDlg. To examine the activation of p38γ, this was immunoprecipitated from 2 mg cell lysates, and immunoblotted with the p38 phospho-specific or anti-p38γ antibody. Total lysates (50 g protein) were immunoblotted with the antibodies indicated in the figure. Knockdown of p38γ did not affect the expression of p38α and ERK5; the phosphorylation-activation of p38α, as one of its downstream targets, the small heatshock protein-27 (Hsp-27), is phosphorylated at Ser15 in these conditions. Hsp27 phosphorylation is blocked by incubation of cells with the p38α/β inhibitor SB203580.

Fig. S3. Cellular localization of p38γ. HeLa cells, stimulated or treated with 0.5 M sorbitol (15 minutes), were stained with anti-p38γ (red) and anti-PSF (green) antibodies and analysed by fluorescence microscopy. Nuclei are stained with DAPI. Results were similar in two independent experiment.

Fig. S4. Cellular localization of inactive p38γ. (A) HeLa cells were transfected with GFP-p38γ(WT) (Wild type) or with GFP-p38γ(KD) (inactive p38γ mutant in which D171 has been replaced by Ala). The green fluorescece of the GFP protein was analysed by fluorescence microscopy. Nuclei are stained with DAPI. (B) p38γ^171A/171A MEFs were subcellular fractionated and 30-50 g protein from cytoplasm (Cyt) and nuclear (Nuc) fractions were immunoblotted using specific antibodies for each protein indicated in the Figure.

Fig. S5. Cellular localization of hDlg domain. Different hDlg domains were expressed in HEK293 cells. Cells were stained with anti-GST, and analysed by fluorescence microscopy. Nuclei are DAPI-stained.

Fig. S6. p38γ blocks the phosphorylation of hDlg by p38δ. GST-hDlg (1 M) was incubated for 30 minutes at room temperature with of active GST-p38δ (0.2 U/ml) alone or in the presence of either inactive GST-p38γ or GST-p38γ(KD) and the reactions initiated with Mg-γ-³²PATP. GST-p38δ was activated using active MKK6. Inactive GST-p38γ was wild-type p38γ, which has not been activated with active MKK6, whereas GST-p38γ(KD) was a p38γ inactive mutant in which the residue D171 has been replaced by Ala. Substrate phosphorylation is plotted as a percentage of that measured in the absence of p38γ. Results are shown as the mean (± s.e.) for triplicate determinations from a single experiment.

Fig. S7. p38γ localization and hDlg-PSF complex association in cells stimulated with UV. (A) Hela cells, unstimulated or treated with UV radiation (200 J/m²) followed by a 30 minute incubation, were stained with anti-p38γ antibody and analysed by fluorescence microscopy. (B) Endogenous hDlg was immunoprecipitated from 0.2 mg lysates from HeLa cells, unstimulated or stimulated as in A. Pellets were immunoblotted with anti-PSF or anti-hDlg antibody.

Fig. S8. Osmotic stress does not affect ODC1 splicing in mouse embryonic fibroblasts. Cells were incubated in DMEM for 12 hours in the absence of serum before stimulation with 0.5 M sorbitol, for 60 or 120 minutes, as indicated. The RNA was isolated using spin purification method (Quiagen) and reverse transcribed (Applied biosystem). We analyzed the splice variants by RT-PCR using the following sets of primers, indicated in the figure by arrows. Set 1: Forward exon1, CGGGCCACCGTGCTGTGAG and Reverse exon4, TCCCAATGGCAGCTAGGGTGCT; Set 2: Forward exon3, AGCACATCGAGAACCATGAGCAGC and Reverse exon6, GCCCGTTCCAAGAGAAGCCTGC; Set 3: Forward exon5, CGCCAGAGCACATCCAAAGGCA and Reverse exon9, CGGGCTGCTCCTTCCACACG; Set 4: Forward exon9, TGGTGGTGGCTTTCCTGGATCTGA and Reverse exon12, TCCCGCTCTCCTGGGCACAA. Amplified RNA was resolved by electrophoresis in an agarose gel.

Table S1. Primer sequences used for real-time PCR

Table S2. ODC-1 mRNA expression in MEF unstimulated or treated with sorbitol