From the Cover: Mitochondrial DNA sequences reveal the photosynthetic relatives of Rafflesia, the world's largest flower -- Data Supplement - HTML Page - 05562SuppText.htslp -- Proceedings of the National Academy of Sciences

Supporting Text
PCR Methodology.
PCR amplification of matR was performed with the published primers matR 5' forward (GTTTTCACACCATCGACCGACATCG) and matR 3' reverse (CGCGGCACCTGTAGTAGGACAGAGGA) (1) under the following thermal cycling conditions: 94° C for 2.5 min followed by 35 cycles of 94° C for 0.5 min, 54° C for 1 min, and 72° C for 1.5 min, and then by a final extension at 72° C for 3 min. Each PCR reaction included 5 m l of 10´ Rxn buffer (Invitrogen), 2.5 mM MgCl₂, 400 m M dNTPs, 0.2 m M of each primer, 0.5 unit of Platinum TaqDNA Polymerase (Invitrogen), ≈0.5 ng of total DNA, and enough H₂O to bring the volumes up to 50 m l. DNA sequencing was performed on a Beckman Coulter CEQ2000XL following the manufacturer’s protocol. We developed the following internal primers (listed 5' to 3') for DNA sequencing: matR forward 1, AAGCCCTCGAGCCTCCTTTG; matR forward 2, GCACCGTATCCATATAACTGC; matR reverse 1, GCAGTTATATGGATACGGTGC; and matR reverse 2, AAAGAAGGCTCGAGGGCTTG. After amplification and sequencing, there were several small gaps (mostly 3, 6, or 9 bp each) introduced during sequence alignment before phylogenetic analysis. A disproportionate number of these gaps were inserted to align the gymnosperm outgroups to the ingroup taxa. The gaps added during alignment were unambiguously placed in nearly all cases.

1. Anderberg, A. A., Rydin, C. & Kallersjo, M. (2002) Am. J. Bot. 89, 677-687.