Female (NMNH).COSTA RICA: Alajuela Province, Sector Rincon Rain Forest of ACG, Caribe, Rio Francia, 400 m, latitude 10.90093, longitude -85.28915; 11–17.vii.2007, Malaise Trap. Voucher code: DHJPAR0025453.

Male (NMNH).Same data as for holotype, except for collecting date: 22-28.viii.2007. Voucher code: DHJPAR0025443.

Female. Antenna about the same length as body; body length 2.6 mm; forewing 2.9 mm. Head: face with shallow and sparse punctures and sparse, uniformly distributed setae; face width at antennal base/face width at clypeus edge: 1.1×; intertentorial pit distance/face width at clypeus edge: 0.5×; compound eye height/head height: 0.8×; head height/width: 0.8×; face width at antennal base/head maximum width: 0.6×; malar space/basal width of mandible 1.3×; clypeus width/height: 3.1×. Length/width of flagellomeres: 2nd (2.3×), 8th (2.5×), 14th (1.3×). Length of flagellomere 2^nd/length of flagellomere 14^th: 2.2×. Ocello-ocular distance/posterior ocelli diameter: 2.3×; distance between posterior ocelli/ocelli diameter: 1.4×.

Mesosoma. Pronotum with two lateral grooves, the lower one excavated. Mesoscutum more or less uniformly sculptured by impressed punctures (distance between punctures about the same as their diameter). Mesoscutum 1.4× wider than long. Mesoscutum and scutellum uniformly covered by dense, pale-coloured pilosity. Scutellum similarly sculptured to mesoscutum. Scutellum length/width at base 1.0×. Scutellar suture broad, with 6-8 costulae. Posterior band of scutellum polished. Scutellar lateral face with polished area less than 30% the face height and about half the face width. Mesopleuron mostly smooth and glabrous, except for punctures on the anterior margin and setae on the all margins; separated from metapleuron by a crenulated sulcus. Metapleuron mostly smooth, with some punctures and setae in the apical half; metapleuron with a crenulate, longitudinal sulcus running from lower margin near metacoxa through spiracle. Metapleural carina raised with a short lamella. Propodeum mostly smooth, with a median carina well defined and raised its entire length; and with a clearly complete transverse carina that reaches the spiracles and forks around them (also with additional, shorter transverse carinae, some of them radiating from the median carina but not reaching the spiracles). Transverse carina on propodeum delimiting two areas, the anterior, basal one being more or less horizontal, while the posterior, apical one is declivous.

Metasoma. Mediotergite 1 mostly smooth and with a deep medial groove over its basal half; slightly widening for the first quarter of its length, then narrowing towards apex; basal width/apical width 2.1×; length/apical width 4.8×. Mediotergite 2 mostly smooth, transverse, subtriangular to trapezoidal in shape; basal width/apical width 0.4×; length/apical width 0.4×. Mediotergite 3 1.5× the length of mediotergite 2. Mediotergite 3 and following unsculptured, polished and with sparse setae. Hypopygium mostly inflexible but with a median, translucid fold ventrally where no pleats are distinguishable. Ovipositor sheaths fully setose, 0.7× as long as metatibia length.

Legs. Metacoxa long, surpassing the length of the third metasomal tergum. Metatibial inner spur 1.6× the length of outer spur, and 0.6× the length of metatarsomere 1. Metafemur 3.2× as long as wide.

Wings. Vein R1a 1.3× as long as stigma length. Stigma 3.1× as long as wide. Length of R1a about 12× as long as the distance between its end and the end of 3RSb. Vein r and 2RS evenly curved to very slightly arched, with no clear limits between the two veins. Vein 2M about the same length of vein (RS+M)b. Edge of vannal lobe of hind wing medially straight to slightly concave and with uniformly distribute setae which are shorter than those at base and apex of the lobe.

Colour: Mostly an orange-yellowish species. Antennal flagellomere and dorsal part of scape brown. Apical edge of scutellum, metascutellum and some carina on propodeum, reddish-brown. Central area on mediotergites 3 and following dark brown. Forewing stigma and most of the wing veins dark brown.

Male. Like the female except for darker coloration as follows: interocellar area, propodeum, metascutellum, apical edge of scutellum, most of the lateral face of scutellum, and most of mediotergites 2+, dark brown to black.

The known specimens were captured in July-August 2007 (full rainy season) by the same Malaise trap placed in old growth rain forest understory on the banks of Rio Francia, where it crosses the access road through Sector Rincon Rain Forest of ACG, at 400 m.

The two known specimens bear the same DNA barcode. The nucleotide sequence in fasta format is:

>Mariapanteles felipei

ATTTTATATTTTTTATTTGGAATATGATCTGGAATATTAGGATTTTCATTAAGAATAATTATCCGATTAGAGTTAGGCACACCAGGAAGATTAATTAGAAATGATCAAATCTATAATAGAATTGTTACATCACATGCTTTTATCATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTATTTAATTCCATTAATATTAGCAACTCCTGATATATCATTCCCACGAATAAATAATATGAGATTTTGATTACTAATTCCTTCATTATTTTTATTAATTTTTAGAAGATTTATTAATACAGGAGTAGGTACAGGTTGAACAGTTTATCCACCTTTATCATCAAATTTAGGACATAGAGGTATATCAGTTGATTTAGGAATCTTTTCTCTACATTTAGCAGGAGCCTCATCAATTATAGGAGCAATTAATTTTATTACAACAATTAAAAATATACGAGTTAAATTATTAAAAATAGATAAAATTTCTTTATTTACTTGATCAGTTTTAATTACAGCAATTTTATTATTATTATCTTTACCAGTTTTAGCAGGAGCAATTACTATACTTTTAACAGACCGAAATTTAAATACATCATTTTTTGATCCTTCAGGAGGTGGGGATCCAATTTTATACCAACATTTATTT

Mariapanteles felipei is dedicated toLuis Felipe Chavarría Díaz of ACG and San Jose, Costa Rica, in recognition of his 30+ years of dedication to Costa Rican conservation, biodiversity systematics, and biodiversity development throughout Costa Rica, and very specifically within Area de Conservación de Guanacaste.

The biology of this species, collected with Malaise traps, is unknown. Since its inception in 1978, the ACG caterpillar and parasitoid inventory (Janzen et al. 2009) has achieved Microgastrinae rearings from 9,000+ wild-caught caterpillars and has Malaise-trapped 5,000+ individual Microgastrinae in dry forest, cloud forest and rain forest (Janzen and Hallwachs 2012, Smith et al. 2008); this intense effort has yielded only two conspecific individuals of Mariapanteles, both from the same Malaise trap a few weeks apart. While this may suggest that the species is “rare”, it has been the experience of the ACG inventory that when the wasp is finally reared and therefore its host caterpillar known, or the Malaise trap is placed in the “right” place, it may well be found to be common.