Institution: NIH Library

Current Issue
Archive
News & Multimedia
For Authors
About PNAS

Collected Articles
- Colloquium Papers
- Commentaries
- Core Concepts
- Cozzarelli Prize
- Editorials
- Feature Articles
- From the Academy
- Frontiers of Science
- Inaugural Articles
- In This Issue
- Inner Workings
- Introductions
- Letters and Replies
- News Features
- Nobel Lectures
- Opinions
- Perspectives
- PNAS Classics
- PNAS Plus
- Profiles
- QnAs
- Retrospectives
- Reviews
- Science and Culture
- Significance Statements
- Special Features
- Sustainability Science
Browse by topic
- Anthropology
- Applied Biological Sciences
- Applied Mathematics
- Applied Physical Sciences
- Astronomy
- Biochemistry
- Biophysics and Computational Biology
- Cell Biology
- Chemistry
- Computer Sciences
- Developmental Biology
- Earth, Atmospheric, and Planetary Sciences
- Ecology
- Economic Sciences
- Engineering
- Environmental Sciences
- Evolution
- Genetics
- Geology
- Geophysics
- Immunology
- Mathematics
- Medical Sciences
- Microbiology
- Molecular Biology
- Neuroscience
- Pharmacology
- Physics
- Physiology
- Plant Biology
- Political Sciences
- Population Biology
- Psychological and Cognitive Sciences
- Social Sciences
- Statistics
- Sustainability Science
- Systems Biology
Early Edition
- All Early Edition
- Highlights from Early Edition

Detection of ultra-rare mutations by next-generation sequencing

Supporting Information

Correction to the Supporting Information (SI)

The authors note that on page 1, left column, first full paragraph, lines 3–5 “AATGATACGGCGACCACCGAATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT” should instead appear as “AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT”. In addition, the authors note that on page 1, left column, fifth full paragraph, lines 2–3 “0.1 M EDTA” should instead appear as “0.1 mM EDTA”.

Below is a link to the corrected SI.

Files in this Data Supplement:

Download Supporting Information (PDF)

Current Issue
E-mail Alerts
Subscribe
RSS

Published online before print August 1, 2012, doi: 10.1073/pnas.1208715109 PNAS September 4, 2012 vol. 109 no. 36 14508-14513

Access

OA Abstract
OA Full Text (HTML)
Full Text (PDF)
Full Text + SI (Combined PDF)
Figures Only
» Corrected Supporting Information

most read
most cited

DNA sequencing with chain-terminating inhibitors
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Cluster analysis and display of genome-wide expression patterns
One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products
Significance analysis of microarrays applied to the ionizing radiation response

50 Most-Cited Articles »