RT-PCR. mRNA was isolated by using the Fast Track mRNA isolation kit (Invitrogen). Genomic DNA was removed from the samples with the DNA-free kit (Ambion, Austin, TX). For RT-PCR, mRNA was reverse transcribed with random hexamer primers and amplified by using the RNA PCR Gold Core kit (Perkin–Elmer). For PCR amplification of both mouse and human ephrin-B2, the forward primer TAAAGACCAAGCAGACAGATGCAC and the reverse primer GTGATGATGATGACGATGAAGATG were used. The PCR products were digested with AvaII (mouse-specific) or EcoRV (human-specific).

Immunoprecipitations, Fc Pull-Down Assays, and Immunoblotting. EphB4 immunoprecipitations were performed as described (1). The rabbit anti-EphB4 polyclonal Ab used for immunoprecipitations were prepared by using a GST fusion protein of human EphB4 as the antigen (amino acids 2,644–2,964), affinity-purified by using a GST-EphB4 column, and absorbed on a GST-EphB2 column. For ephrin-B2 Fc pull-down assays, 293 HEK cells transiently transfected with EphB4D C-EGFP or EGFP-F were solubilized in a buffer containing 1% Triton X-100 detergent. Cell lysates were incubated with 10 m g of ephrin-B2 Fc (R & D Systems) immobilized on protein-G beads. Samples from immunoprecipitations, pull-down assays, and cell lysates were immunoblotted with Abs against phosphotyrosine (PY20; BD Biosciences), EGFP (Chemicon), and EphB4. In addition to the EphB4 Abs described above, two Abs to the ectodomain of EphB4 (R & D Systems, Santa Cruz Biotechnology) were also used.

Quantitation of Tumor Blood Vessels by Image Analysis. To quantitate tumor blood vessels, photomicrographs of peroxidase CD-31-stained frozen sections were taken by using a ×10 objective (see Fig. 11) and analyzed with imagepro software (Media Cybernetics, Silver Spring, MD). Stained structures with a closed perimeter were considered to be blood vessels, and their mean diameters and enclosed areas were measured. We counted a total of ≈2,400 blood vessels in 24 sections from six EphB4D C-EGFP tumors and ≈3,000 blood vessels in 23 sections from six EGFP-F tumors.

1. Noren, N. K., Liu, B. P., Burridge, K. & Kreft, B. (2000) J. Cell Biol. 150, 567–580.