PlantaeMyrtalesMyrtaceaede LangePeter J.A revision of the New Zealand Kunzea ericoides (Myrtaceae) complexPhytoKeys2682014201440118510.3897/phytokeys.40.7973 Kunzea linearis urn:lsid:ipni.org:names:77141738-1 (Kirk) de Lange et Toelkencomb. et stat. nov.Leptospermum ericoides var. linearis Kirk in For. Fl. (1889), 125, Plate LXIX (t.69), f.2Leptospermum lineatum (Kirk) Cockayne in Rep. Dune Area N.Z., (1911), 38.Kunzea ericoides var. linearis (Kirk) W.Harris in N.Z.J.Bot. 25, (1987), 134.Holotype

(Fig. 29A). T. Kirk, The Forest Flora of New Zealand (1889), Plate LXIX (t.69), f.2.

Holotype and epitype of Leptospermum ericoides var. lineare Kirk. A Holotype of Leptospermum ericoides var. lineare Kirk, illustration t.69 (f.2) in Kirk (1889) B Epitype of Leptospermum ericoides var. lineare Kirk (WELT SP029435). Scale bar: (A) 10 mm.

Epitype

(here designated) (Fig. 29B). Ahatawapa, Waitemata T. K[irk] 953, Feb 6 1866, WELT SP29435! Labelled by Kirk as Leptospermum ericoides A. Rich. Fl. N. Z. 357 var. lineatus [sic].

Notes.

Kirk (1889; p. 125) published Leptospermum ericoides var. linearis with a brief description which is given here in full: ‘var. β, linearis. Young shoots, leaves, and calyces silky; branchlets densely crowded; leaves linear and pungent, 1/40 in. wide, margins slightly recurved; calyx with more acute teeth; petals very small, crumpled. Calyx-teeth erect in fruit. This is probably a distinct species.’ This description was accompanied by a small, somewhat stylised illustration (‘f.2’) of a fruiting sprig (Fig. 29A). No locations were given or other specimens cited. Therefore, as the sole element accompanying the protologue I regard this illustration as the holotype (see Article 9.1, Note 1, especially the statement: ‘if the author used only one element, it must be accepted as the holotype’). This is because, despite the wealth of collections in the Kirk herbarium at WELT and additional gatherings at K, all labelled in Kirk’s hand with his new name (though often spelled var. lineatus, and/or or var. lineatum (see also Kirk 1899)), Kirk (1899) did not cite any of these in his protologue, leaving the illustration, which accompanies the description and its direct citation by the naming author (e.g., ‘f.2’), as the only possible choice. However, as the holotype is stylised it is inadequate to allow a precise application of the name Leptospermum ericoides var. linearis, therefore in accordance with Article 9.8 of the International Code of Nomenclature (McNeill et al. 2012) I designate WELT SP029435 as epitype (Fig. 29B). This sheet comprises two fruiting specimens which clearly show the densely crowded branchlets, linear leaves, and fruits bearing persistent, erect calyx lobes. These are some of the distinguishing characters mentioned in Kirk’s protologue for his new variety (Kirk 1889; p. 125). Further, the specimens were clearly collected by and labelled in Kirk’s hand as ‘Leptospermum ericoides var. lineatus’.

Etymology.

The specific epithet linearis refers to the linear leaves of this species, a condition much remarked upon by Thomas Kirk on his herbarium specimens, and to a lesser extent in his descriptions (Kirk 1889, 1899).

Description

(Figs 30, 31, 32). Growth habit erect shrubs or small trees up to 12 m forming dark green to silvery-grey, erect but more or less rounded, plumose, densely branched canopies up to 2 m diam., sometimes (usually on ultramafic rocks) decumbent and/or trailing. Trunk 1(–4 or more), mostly erect but in trailing specimens distinctly serpentine, 0.10–0.46(-0.60) m d.b.h.; basal portion of trunks initially covered with rather thick, firm, stringy, brown to brownish grey coriaceous bark. Bark early bark firmly coriaceous, dark brown to brown, ± elongate, usually bearing a few transverse cracks (especially on branch flanges and decurrent leaf bases) otherwise remaining firmly attached, margins elongate sinuous, ± entire with scarcely any flaking; old bark similar though more distinctly corky-coriaceous, coarsely tessellated and remaining firmly attached, if detaching then usually doing so along transverse cracks, and peeling inwards to leave distinct layers of chartaceous, lunate, flakes that are centrally attached; flakes usually with highly irregular, frayed and shattered apices, otherwise margins ± entire; upper surface of bark flakes tessellated; upper trunk bark crumbling readily in hand, shattering if pulled hard into numerous, small, tabular flakes. Branches numerous, usually present from close to or at trunk base, but becoming progressively confined with age to the upper half of trunk; ascending to upright, very rarely spreading (usually in decumbent plants), usually distinctly plumose and often bearing old fruits; branchlets numerous, plumose, rather slender, ± quadrangular to subterete, leaves crowded along stems; branchlets sericeous, indumentum copious, hairs antrorse-appressed, weakly flexuose, up to 0.68 mm long, hyaline to translucent (appearing silvery when young, maturing silver-grey). Vegetative buds inconspicuous, usually obscured from view by surrounding leaves; at resting stage 0.2–0.8 mm diam. narrowly ovoid; scales deciduous; (0.2–)1.2 mm long, stramineous to pale brown, broadly ovate-lanceolate grading through lanceolate to narrowly lanceolate; midrib strongly keeled, prolonged to apiculate tip, often with one prominent row of 2–6 oil glands on either side of midrib; scales initially completely obscured by long silky silvery-white hairs, becoming glabrate, with hairs progressively confined to scale margins, midrib, and keel prolongation. Leaves not heterophyllous, sessile, usually hairy, very rarely glabrous, densely crowded along branchlets, particularly toward apices, initially obliquely ascending, subappressed to suberect, basally often spreading to weakly recurved in distal one-third; lamina (9.3–)12.7(–19.5) × (0.3–)0.7(–1.2) mm, initially silvery-grey (due to dense hair covering), maturing dark green to glaucous green above (as hairs are shed) with a dull not glossy surface, paler beneath; lamina linear, distal one-third sometimes weakly recurved, apex sharply acute, cuspidate, base attenuate (with adaxial surface often glabrous, abaxial densely hairy); adaxial lamina surface flat to weakly concave, glandular punctate, with oil glands evident when fresh or dry (though more conspicuous when dry), up to c.300, midrib very slightly raised near base, otherwise only evident for c. one-third of length as a conspicuous line of silvery-grey antrorse-appressed, silky hairs up to 0.8 mm long; abaxial surface flat to weakly convex, glandular punctate, oil glands up to 300; midrib raised for entire length, densely sericeous to just short of leaf apex, hairs as for adaxial midrib and lamina margins; lamina margins copiously covered in silvery-grey hairs, these forming a thick band and fusing with the abaxial midrib hairs just short of lamina apex, and along decurrent leaf bases. Perules deciduous, (0.3–)1.8(–2.3) mm long, straminaceous to pale brown, narrowly ovate, ovate-lanceolate grading through to narrowly lanceolate; midrib strongly keeled, cuspidate, with an obscure row of 2–8 oil glands on either side of midrib; lamina initially obscured by long silky silvery-white hairs, becoming glabrate, with hairs progressively confined to scale margins, midrib, and keel prolongation. Inflorescence mostly compact, spiciform (3–)8(–12)-flowered botrya 20–80 mm long; usually on brachyblasts with the terminal shoot either bearing a slightly longer (up to 180 mm) compact 6–15-flowered, spiciform botryum, or a greatly elongated, spiciform, 10–40-flowered botryum up to 180 mm long. Flowers of smaller botrya crowded, those of elongated botrya regularly spaced up to 20 mm apart; terminal portion of both short and elongated spiciform botrya inflorescence types often bearing undeveloped flowers and active vegetative growth. Inflorescence axis densely invested in antrorse-appressed, weakly flexuose, silky hairs. Pherophylls persistent, leaf-like, 1–2 per flower, closely clasping hypanthium base, usually hairy, very rarely glabrous; lamina (6.0–)9.8(–12.8) × (0.9–)1.8(–2.2) mm, dark silvery-green, silvery-grey or glaucous (depending one extent of hair covering), linear to linear-falcate; linear-falcate pherophylls with basal portion sharply bent almost at right angles to inflorescence axis, otherwise obliquely ascending to suberect, or spreading; apex acute, base attenuate; adaxial surface usually deeply concave to weakly so, glandular punctate, oil glands up to c.100 (usually fewer); midrib slightly raised near base, otherwise indistinct, bearing antrorse-appressed, silky, hairs for whole length or glabrous; abaxial surface deeply convex, glandular punctate, oil glands up to 100 (usually fewer); midrib scarcely evident especially if glabrous, otherwise mostly evident as a dense line of antrorse-appressed, silky hairs continuing to the apex, lamina margin usually densely covered by antrorse-appressed, sericeous hairs, sometimes glabrous. Pedicels sessile to subsessile, up to 1.2 mm long at anthesis, scarcely elongating after anthesis, terete, copiously invested with silky, antrorse-appressed, weakly flexuose, hairs. Flower buds ovoid, double conic to pyriform, apex sharply erect; calyx lobes pinched at apex inwards, and touching prior to bud burst. Fresh flowers when fully expanded (1.9–)3.9(–5.7) mm diam. Hypanthium (2.0–)2.8(–4.0) × (2.5–)3.4(–4.1) mm, with free portion 0.6–0.9 mm long, silvery-white to silvery-grey due to copious covering of hairs or dark red-green if glabrous; barrel-shaped, cupular or narrowly campanulate, terminating in scarcely defined chartaceous rim bearing 5 persistent sharply erect calyx lobes; hypanthium surface smooth, usually completely covered in a dense covering of long, silky, antrorse-appressed silvery hairs; ribs scarcely evident. Calyx lobes 5, erect, subcoriaceous, (1.0–)1.3(–1.6) × (0.2–)0.4(–0.6) mm, persistent, narrowly deltoid to deltoid with acute tips, red-green, weakly keeled or not, lobes densely covered in long, silky, silvery, antrorse-appressed, hairs or glabrous; margins green flushed pink or red, oil glands evident only in glabrous forms, rather inconspicuous, ± colourless. Receptacle green or pink at anthesis, usually darkening to crimson after fertilisation. Petals 5(–6), (0.9–)1.4(–2.0) × (0.7–)1.4(–1.9) mm, cream, pale pink or cream basally flushed pink, narrowly ovate to suborbicular, suberect, upper one-third sometimes weakly recurved, apex rounded, margins ± finely and irregularly crumpled, sometimes denticulate, oil glands colourless. Stamens 32–46(–60) in 1–2 weakly defined whorls, arising from receptacular rim, filaments cream. Antipetalous stamens (2–)3(–6) sometimes petaloid, antisepalous (3–)4(–7). Outermost antipetalous stamens initially erect with the upper portion often incurved, more rarely outcurved, on filaments 1.2–1.8 mm long, inner stamen if present, 0.9–1.6 mm, erect or incurved, often a further 1–3 stamens, of similar length to inner stamens may be present at the base of the outermost antipetalous pair. Antisepalous stamens shorter than outermost antipetalous stamens, 0.8–1.0 mm, erect or weakly to strongly incurved, rarely outcurved, usually in mixtures of both. Anthers dorsifixed, 0.04–0.06 × 0.02–0.04 mm, testiculate, latrorse. Pollen white (13.2–)16.2(–21.0) μm. Anther connective gland prominent, pale pink or golden-yellow when fresh, drying yellow to pale orange, spheroidal, finely to coarsely papillate. Ovary (3–)4(–5) locular, each with 18–26(–30) ovules in two rows on each placental lobe. Style 0.8–2.0 mm long at anthesis, elongating after anthesis, cream or pale pink; stigma narrowly capitate, as wide as, or slightly wider than style, ± flat, greenish-white or pink, flushing red after anthesis, surface finely granular-papillate. Fruits long persistent, (1.6–)2.3(–2.9) × (2.3–)3.0(–4.1) mm, initially silvery-white or silvery-grey due to dense hair covering, maturing grey-brown to grey-black depending on degree of hair loss, sometimes completely glabrous in which case dark brown; in all types fading with age to pale grey in exposed situations or grey-black in shade, barrel-shaped to narrowly obconic, rarely campanulate to cupular, calyx valves prominently erect, splits concealed by dried, erect, free portion of hypanthium. Seeds 0.50–1.00(–1.10) × 0.48–0.63(–0.70) mm, obovoid, oblong, oblong-ellipsoid, or cylindrical and ± curved; usually curved near apex, laterally compressed, 2–3-angled with convex to flattened faces, apex rounded to subacute; base oblique, ± flattened; testa semi-glossy, orange-brown to dark brown, surface coarsely reticulate. FL: (Jul–)Nov–Jan(–May). FT: Jun–May. Chromosome Number 2n = 22 (see de Lange and Murray 2004).

Distinguishing features of Kunzea linearis. A Flowering branchlet (ex cult. AK 287881) B Fruiting branchlet (ex cult. AK 287881) C Vegetative bud and branchlet indumentum (ex cult. AK 287881) D Adaxial leaf surface (ex cult. AK 287881) E Abaxial leaf surface (ex cult. AK 287881) F Adaxial leaf apex (ex cult. AK 287881) G Leaf margin indumentum (ex cult. AK 287881) H Leaf variation: (H1) Surville Cliffs (Glabrescent form, AK 287872), (H2) Surville Cliffs (Hairy Form) (AK 287955), (H3) North Island, Te Paki, Taumatatotara Flat (AK 287953), (H4) North Island, Houhoura Harbour, Perpendicular Point (AK 211064), (H5) North Island, Karikari Peninsula, Lake Waiporohita (AK 287886), (H6) Waipapa Stream (AK 288775), (H7) North Island, Raetea Forest (AK 206328), (H8) North Island, Waipu Cove Road (AK 287889), (H9) North Island, Northcote, Ahatawapa (AK 288766), (H10) North Island, Hauraki Plains, Waikumete Stream (AK 286054) I Flower (top view) (ex cult. AK 287881) J Flower and hypanthium (side view) (ex cult. AK 287881) K Flower cross section showing anther, style and ovules (ex cult. AK 287881) L Style and stigma (ex cult. AK 287881) M Stamens (ex cult. AK 287881) N Dehisced fruit (ex cult. AK 287881). Scale bars: (A, B, H) 10 mm; (C–F, I–N) 1 mm; (G) 0.5 mm.

Scanning Electron Micrographs of Kunzea linearis. (A–E all AK 287954) Branchlet indumentum F–H Seeds (AK 206336). Scale bars: (A, C, F) 1 mm; (B, D, E, G, H) 100 μm.

Kunzea linearis. A Kunzea linearis sprawling form developed on windswept ultramafic rocks, North Island, North Cape Scientific Reserve, Surville Cliffs, (photo: P. J. de Lange) B Coastal shrubland developed on steep turbidite cliffs, North Island, Auckland, Waitemata Harbour, Kendal’s Bay (photo: P. J. de Lange) C–D Decumbent shrub form developed on ultramafic soils North Island, North Cape Scientific Reserve, Surville Cliffs, (photo: P. J. de Lange) E Adult plant exhibiting the erect growth habit usually seen throughout range, North Island, Te Aupouri Peninsula, Te Kao, (photo: P. J. de Lange) F Adult tree showing ascending, plumose branching pattern; North Island, Auckland City, Western Springs (photo: P. J. de Lange) G–J Bark showing the characteristic tessellated pattern and lunate flakes typical of this species, North Island, Auckland, Waitemata Harbour, Kendal’s Bay (photo: P. J. de Lange) K Spiciform botrya of Kunzea linearis showing buds with the distinctive erect calyx lobes, North Island, Karikari Peninsula, Lake Ohia (photo: J. E. Braggins) L Flowering spiciform botrya of Kunzea linearis, note position of petals and presence of active vegetative growth at inflorescence apex, North Island, Karikari Peninsula, Lake Ohia (photo: J. E. Braggins).

Representative specimens

(148 sheets seen): New Zealand (North Island). Te Paki, North Cape Scientific Reserve, Surville Cliffs, P. J. de Lange 1250 & G. M. Crowcroft, 30 Jan 1992, (AK 207192, Duplicates: AD, CHR); Te Paki, Tom Bowlings Bay, H. Carse s.n., Dec 1926, (CHR 296369); Te Paki, Spirits Bay/Kerr Point Road junction, R. Cooper s.n., 30 Oct 1969, (AK 121371, Duplicate: CHR); Te Aupouri, Te Kao (near school/Te Ahu road junction), P. J. de Lange 4164, 18 Jan 2000, (AK 287887; Duplicate: AD, NSW); Te Aupouri, Mt Camel, near Perpendicular Point, P. J. de Lange 1865, 15 Nov 1992, (AK 211064, Duplicates: AD, CHR); Rangaunu Harbour, Kaimaumau, R. Cooper s.n., 7 Nov 1966, (AK 117773); Waipapakauri, H. Carse s.n., 7 Jan 1902, (WELT SP077488); Kaitaia, H. B. Matthews s.n. & H. Carse, Dec 1918, (CHR 296350); Ahipara Gumfields, Waitaha Stream, P. J. de Lange 4146, 17 Jan 2000, (AK 287957); Mangonui, Rangiawhia School, R. Cooper s.n., 25 Aug 1965, (AK 123157); Mangamuka, Raetea Forest, L. J. Forester s.n., 5 Mar 1992, AK 206336; Whangaroa Harbour, Wainui Road, Waitapu Bay, P. J. de Lange 5987 & P. B. Heenan, 1 Apr 2004, (AK 286197, Duplicate: AD); Russell, Bay of Islands, D. Petrie s.n., May 1897, (WELT SP029463); Between Waimate and the Bay of Islands, W. Colenso 182, 30 Jul 1844, (WELT SP022866, Duplicate: K); Kai Iwi Lake, R. Cooper s.n., 13 Nov 1968, (AK 120232); Whangarei, near Marsden Point, R. O. Gardner 10178, 24 May 2000, (AK 251630); Pouto Peninsula, Sail Point, above Clarkes Bay, P. J. de Lange 6288 & R. O. Gardner, 10 Aug 1995, (AK 288776); Mangawhai, Molesworth Drive, P. J. de Lange 5537 & G. M. Crowcroft, 4 Oct 2002, (AK 283238); Te Arai Point Road, Te Arai, P. J. de Lange 5534 & G. M. Crowcroft, 3 Oct 2002, (AK 283237, Duplicate: CHR); Takatu Peninsula, Million Bay, Campbells Beach, P. J. de Lange 6330, 12 Jan 2005, (AK 289208); Northcote, Waitemata Harbour, North Block, ‘Aha Tawa Pa’ (Tennyson Road), P. J. de Lange 6284, 15 Nov 2004, (AK 288766, Duplicates: AD, CHR, K, MEL, NSW, NZFRI, WAIK, WELT); Birkdale, H. B. Matthews s.n., 1919, (AK 102429); Auckland, near Cox’s Creek, T. Kirk s.n., n.d., (K); Maramarua – Matamata Road (State Highway 27), 800 m north of Waikumete Stream, P. J. de Lange 4625, 7 Nov 2000, (AK 286054, Duplicates: AD, CHR, WAIK); Hapuakohe Range, Wai Iti Road, above Ohinekaua Stream, P. J. de Lange 4707, 16 Nov 2000, (AK 288490, Duplicates: AD, CHR); North Wairarapa, 1 mile west of Kupukore, A. P. Druce s.n., May 1965, (CHR 132842). Poor Knights Islands: Aorangi, western ridge of Tatua Peak, P. J. de Lange 6875, 14 Jan 2007, (AK 298368, Duplicate: CHR).

Distribution

(Fig. 33). Endemic. New Zealand, North Island (sea level – 310 m a.s.l.). Recorded from Te Paki south to the Ahipara Gumlands and the Karikari Peninsula. South of there it is sporadic and mainly coastal to the Waitemata Harbour. Also present on the western side of Aotea (Great Barrier Island), the eastern side of the Coromandel Peninsula (near Tairua), on the western margin of the Hauraki Plains just north of Kaihere, and within the foothills of the Hapuakohe Range. South of there Kunzea linearis is known only from a single, highly disjunct collection made by A. P. Druce (CHR 132842) from near Mt Kupukore, in the northern Wairarapa. Although I have seen no other specimens from the southern half of the North Island, I accept this record, because the collector A.P. [Tony] Druce, was a well known, cautious botanical explorer not prone to making labelling errors, and with a critical eye for the unusual (Atkinson 1999). Also, at the time of that specimen’s collection in May 1965, Druce was unfamiliar with Kunzea linearis (he had labelled his specimen ‘Leptospermum ericoides’). In fact it was not until May 1987, 22 years later that he made his next herbarium collection of Kunzea linearis from Ahipara (CHR 469707), and that gathering Druce labelled as an ‘unnamed’ species (Kunzea “Ahipara” (Druce 1993)), apparently not realising that it already had a formal name within the genus. Although subsequent searches of Mt Kupukore made at my request in 2007 by Mr Pat Enright (in litt.) failed to find Kunzea linearis there, hybrids between it and Kunzea robusta were present, suggesting its past, or continuing presence in the area.

Distribution of Kunzea linearis.

Recognition.

Kunzea linearis is the most distinctive of the New Zealand Kunzea species (see Table 1). Its discovery by Thomas Kirk at Ahatawapa and Cox’s Creek, Auckland was remarked upon by Hooker (1867; p. 728) who noted it’s distinctiveness in his treatment of Leptospermum ericoides but elected not to name it because ‘the species of this genus are, however, so variable that I do not venture to make a new one of this’. Perhaps swayed by Hooker’s views, Kirk (1899) did not name it at species rank. Nevertheless in his protologue he remarked (p. 125) that ‘this is probably a distinct species’. No other species has the same combination of densely crowded erect, plumose, dark green to silvery grey branches and branchlets (Fig. 32F), covered in masses of hairy linear leaves, sessile to subsessile small flowers with suberect, crumpled petals that are borne on mainly spiciform, condensed botrya, with long linear to linear-falcate pherophylls (Figs 30A–B, 32K–L). Herbarium specimens of Kunzea linearis are particularly distinctive because they usually turn silvery-grey on drying, a colour caused by the abundance of light-reflecting silky hairs on the branchlets and leaves. In addition to these differences, Kunzea linearis is further distinguished by its unique chromosome complement comprising eight ‘large’ (1.2–1.5 μm), and three small (0.8–0.9 μm) chromosome pairs. Of the sequence regions investigated (see de Lange 2007; de Lange et al. 2010), ETS was the only site showing variation (Table 2), with Kunzea linearis differing from all other Kunzea Subgen. Niviferae at alignment positions 41 and 259 where a unique guanine nucleotide and guanine/adenine mix are present (de Lange 2007). Otherwise, Kunzea linearis shares with Kunzea ericoides a cytosine nucleotide at alignment position 269 (Table 2), and with Mt Egmont samples of Kunzea robusta, and multiple samples of Kunzea ericoides, Kunzea salterae, Kunzea serotina and Kunzea toelkenii a guanine/cytosine mix at position 232 (Table 2).

Kunzea linearis is frequently sympatric with Kunzea amathicola and Kunzea robusta, and less commonly with Kunzea sinclairii on Aotea (Great Barrier Island). It is easily distinguished from all three species in the field and the herbarium by the linear leaves, inflorescence type, pherophylls and floral features (Figs 30A–B, 32K–L; Table 1). Kunzea linearis has a superficial resemblance to Kunzea ericoides, because both species have somewhat similar long narrow leaves, such that they have been confused in past literature e.g., de Lange et al. (1997). Kunzea linearis differs from the allopatric South Island endemic Kunzea ericoides by its long, silky, antrorse-appressed, weakly flexuose branchlet hairs (Figs 30C, 31A–E), consistently dark green to almost glaucous linear leaves densely crowded toward the branchlet apices, usually condensed spiciform botrya (Figs 30A–B, 32K–L), sessile to subsessile flowers with the calyx lobes of the mature bud erect, apically pinched inwards and touching just prior to bud burst (Figs 30A, I–K, 32K–L), suberect petals, and by the usually hairy hypanthia and fruits (Fig. 30J, N).

Kunzea linearis has some similarity to the allopatric Three Kings Island group endemic Kunzea triregensis, especially as the latter sometimes has flower buds with suberect touching calyx lobes. Although the two species never meet in the wild, they have been confused in herbaria. Differences between both species are discussed in more detail under Kunzea triregensis.

Ecology.

Kunzea linearis is primarily a species of coastal to lowland shrubland habitats overlying impoverished soils (Fig. 32B) and peat bogs. It is only very rarely found at any distance inland. The sole exception appears to be Te Paki where it is virtually the only Kunzea species present and so seems to occupy a much greater range of habitats than it would usually (e.g., Fig. 32A). Elsewhere within its range, even in apparently suitable inland gumland scrub habitats overlying leached soils, and on the clay podzols of the Northland Peninsula, it is usually replaced by Kunzea robusta. Kunzea linearis seems to reach its greatest abundance on sand podzols overlying older usually Pleistocene-aged sand dunes, especially in places where these grade into peat. Because it is tolerant of seasonal flooding, waterlogged soils and extreme drought Kunzea linearis is usually the dominant species on the sand country of the Te Aupouri Peninsula, as well as the acidic leached clays and older sand soils of Te Paki. It is also the dominant woody shrub on the margins of the oligotrophic peat bogs and lakes of the Taumatatotara Flats (Te Paki), the Motutangi-Kaimaumau Peat Bog, Lake Ohia, Karikari Peninsula lakes and in parts of the Ahipara Gumlands. Outside these habitats Kunzea linearis has been found growing within shell banks and low-lying clay banks subject to saline inundation within the mangrove (Avicennia marina subsp. australasica (Walp.) J.Everett) swamps of the upper Whangaroa Harbour. In western Northland it may occasionally colonise mobile sand where it is then usually sympatric with and often out-competed by Kunzea amathicola. In parts of Te Paki and also on the Poor Knights Islands, Kunzea linearis can sometimes be found in abundance within mixed indigenous forests, though mostly then on skeletal soils developed on outcrops of hard volcanic rock or on deeply leached clay podzols (usually in association with kauri (Agathis australis (D.Don) Lindl.)). These situations are exceptional and, as a rule, Kunzea linearis is not found in mature forests. South of the Pouto Peninsula and Te Arai, Kunzea linearis has a very patchy. In these areas it is usually found on cliff faces growing amongst pohutukawa (Metrosideros excelsa Sol. ex Gaertn.). In places where the cliffs abut land that has been frequently fired, Kunzea linearis may be a local component of the fire-induced gumland vegetation. The peculiar disjunct distribution of Kunzea linearis south of its main Northland occurrences, and in particular the close association of the Waitemata Harbour populations with sites of former Maori habitation and fortifications, e.g., Ahatawapa and Kendal’s Bay (Fig. 32B), and some of the original sites of European settlement e.g., Devonport, Cox’s Creek, led de Lange (2006) to suggest that these Kunzea linearis populations were not natural and may have resulted from the accidental spread of seed from firewood bought by Maori to the Waitemata Harbour from the eastern part of coastal Northland during the musket wars that raged between 1810 and the close of the 1830s. While this requires further study, the majority of these southerly occurrences are in habitats not usually occupied by the species in the main part of its range, and that also invariably occur on or close to cultural sites. Alternatively it could be natural to these areas, and may have temporarily expanded its range during the initial settlement phase of Auckland to occupy freshly cleared land. However, this explanation does not address the peculiar patchy distribution of the species on Aotea (Great Barrier Island), the Coromandel Peninsula, western Hauraki Plains and the foothills of the Hapuakohe Range, where successional habitats are still common, nor its peculiar disjunction to Mt Kupukore in the eastern Wairarapa (see Fig. 33).

Kunzea linearis is sometimes heavily parasitised by the hemiparasitic dwarf mistletoe Korthalsella salicornioides. In the northern part of its range it is often festooned in dense tangles of the lauraceous hemiparasitic taihoa (Cassytha paniculata R.Br. and Cassytha pubescens R.Br.). Around Te Paki Kunzea linearis provides an important habitat for an unnamed green gecko (Naultinus “Te Paki”), and elsewhere in Te Aupouri the Northland green gecko (Naultinus grayi Bell, 1843) (R. Hitchmough pers. comm.) whilst around Auckland it is a favoured habitat for another gecko, Naultinus elegans (Gray, 1842). Two geckos of the genus Dactylocnemis Fitzinger, 1861 (Dactylocnemis pacificus (Gray, 1842) and Dactylocnemis “North Cape”) and one of Mokopirirakau (Mokopirirakau granulatus (Gray, 1845)) are also commonly found sheltering under the bark of this species (R. Hitchmough pers. comm.).

Hybridism.

Kunzea linearis is a widespread species of northern New Zealand, and it is frequently sympatric with Kunzea amathicola in the western part of its range and with Kunzea robusta in the east. Throughout this range, but especially in places of prolonged human disturbance, the putative hybrids Kunzea amathicola × Kunzea linearis and Kunzea linearis × Kunzea robusta can be abundant. This observation is borne out by artificial hybridisation which showed that, whether used as a staminate or pistillate parent, Kunzea linearis readily formed hybrids with five of the seven other New Zealand Kunzea used in that study (de Lange et al. 2005).

Because Kunzea linearis hybrids are fully fertile there is a tendency for introgressed populations to develop, especially where local habitat conditions are prone to regular disturbance. Thus, complex introgressive hybrid swarms may occur in places that are frequently burned, subject to plantation forestry, coastal subdivision or urban development. Where conditions are extreme, such as the heavily developed northern shores of the Waitemata Harbour, Auckland, it is now difficult to find ‘pure’ examples of Kunzea linearis, as introgressed hybrid plants are dominant over much of that area.

The most commonly encountered hybrid is Kunzea linearis × Kunzea robusta. This is recognised by its foliage, which tends to be ascending rather than spreading, dark green, linear-oblanceolate rather than linear, and which has obtuse rather than acute apices. Foliar hair distribution is also markedly more variable on hybrid specimens, ranging from glabrate to distinctly sericeous hairy but with the hairs generally more restricted to the leaf margins and abaxial midribs. All putative hybrids, when fresh, have glossy leaves rather than the more usual dull dark green to silvery-grey leaf surfaces typical of Kunzea linearis. Flowering material is especially diagnostic, with the inflorescences on single individuals varying from elongate spiciform to compact corymbiform. The flowers tend to be shortly pedicellate, never sessile to subsessile, and the hypanthia broadly obconic to broadly barrel-shaped rather than barrel-shaped to sharply obconic. The hypanthia and fruit surfaces usually show a mixture of the short, antrorse-appressed hairs typical of Kunzea robusta and the long, sericeous, weakly flexuose, antrorse-appressed hairs of Kunzea linearis. In some examples the hypanthium surface may even be glabrate. An important distinction is the shape of the calyx lobes in mature buds. In Kunzea linearis these are consistently narrowly deltoid with distinctly acute apices, and in Kunzea robusta, broadly obtuse to rounded. In the hybrid they tend to be broadly deltoid with subacute to rounded apices. As with Kunzea robusta, the calyx lobes of the mature flower buds in hybrids tend to lie flat, though a few may be suberect, and, unlike Kunzea linearis, the lobes are rarely touching at bud burst. The petals of the hybrids tend to be larger than the range seen in Kunzea linearis and spreading rather than suberect, but, as with Kunzea linearis, they are often flushed pink or off-white with the margins finely crumpled. Depending on the degree of introgression, most hybrids can be readily identified by these characters.

The hybrid Kunzea amathicola × Kunzea linearis is common only in a small area between Waipapakauri, Ahipara and the adjacent, heavily modified Ahipara Plateau. Although this hybrid is fully described under Kunzea amathicola, some of the key diagnostic features are noted here to assist with distinguishing it from Kunzea linearis. Kunzea amathicola × Kunzea linearis is best recognised vegetatively by its leaves which are narrow to broadly lanceolate rather than linear to oblong, oblong-obovate to elliptic. Also they tend to be less evenly spaced than is usual for Kunzea amathicola, and, as in Kunzea linearis, are more crowded toward the branchlet apices. The shape of the pherophylls is diagnostic. Unlike Kunzea linearis which has linear to linear-falcate, ascending to spreading pherophylls, or Kunzea amathicola which has oblong, oblong-obovate, to elliptic, recurved ones, those of the hybrid are linear-oblong and spreading to weakly falcate. The flowers of Kunzea linearis are sessile to subsessile, and those of Kunzea amathicola are distinctly long pedicellate; hybrid flowers show a gradation from subsessile to shortly pedicellate (often on the same plant), and the hypanthium, calyx lobes and petals are also intermediate (see under Kunzea amathicola). The most critical difference is the shape and position of the calyx lobes, which are narrowly deltoid and erect in Kunzea linearis, broadly obtuse to rounded and suberect or spreading in Kunzea amathicola, and narrowly obtuse and suberect to erect in the hybrid. Further, as with Kunzea amathicola, the calyx lobes of fruiting hybrids are incurved from the base.

The hybrid Kunzea linearis × Kunzea sinclairii is very uncommon. Four specimens have been found on the western side of Aotea (Great Barrier Island), two flowering examples collected at “Fitzroy” (W. R. B. Oliver s.n. (WELT SP029478), W. R. B. Oliver s.n. (WELT SP029494)), and two sterile gatherings, one each from near Mt Young and Maungapiko. Oliver’s gatherings are the only wild flowering specimens of this hybrid known. The other examples are sterile but their hybrid status is evident by their distinctive foliage, and, in the one wild example I found, weakly erect, spreading, small tree habit. The foliage of all four specimens is distinctly narrow-lanceolate to almost linear, reddish silvery-grey, and copiously covered in long silky hairs. The leaf apices are sharply acute, and the margins have distinctly longer hairs than the rest of the lamina. Artificially raised hybrids of this combination were fully fertile (e.g., P. J. de Lange 5776 (AK 284581)), and produced shortly pedicellate flowers on somewhat spiciform inflorescences. The pherophylls ranged from broadly elliptic to lanceolate, and, as in Kunzea sinclairii, they are quickly shed, being present only in the early stages of floral bud development. The flowers of wild and experimental Kunzea linearis × Kunzea sinclairii hybrids are smaller than is usual in Kunzea sinclairii with hypanthia that are more narrowly obconic to campanulate, red-pigmented and copiously covered in long, antrorse-appressed hairs. The calyx lobes are suberect to erect, broadly deltoid with acute apices and very hairy margins. The lobes are very hairy along the centre, either side of which is a glabrous pale pink band. Often there is a small, deciduous apiculus.

Vernacular names.

Until recently northern Maori (specifically Te Rarawa of Te Aupouri and Ngati Kuri of Te Paki), did not recognise the name ‘kanuka’ for any species of Kunzea. All species of Kunzea from that region were universally known there as ‘manuka’, while Leptospermum scoparium (usually known outside this area now as ‘manuka’) is known there as ‘kahikatoa’ (G. Neho pers. comm.). While Ngati Kuri usually refer to Kunzea linearis as ‘manuka’ it is also known there by the name ‘rawiri’ (W. Murray pers. comm.). Rawiri was also a Nga Puhi name recorded on specimens of this species collected by the Cunningham’s from either the Bay of Islands or the Hokianga (Cunningham 1839; p. 111).

Conservation status.

Kunzea linearis is appropriately listed as ‘At Risk/Declining’ by de Lange et al. (2013b).

Distinguishing features of New Zealand Kunzea.

Kunzea amathicolaKunzea ericoidesKunzea linearisKunzea triregensis
HabitatCoastal to lowland (sea level – 320 m a.s.l.). Primarily a species of mobile or stabilised sand country and associated coastal headlands. Also found around estuaries and extending up river valleys. Occasionally on offshore islands (Hauraki Gulf)Coastal to low alpine (sea level – 1600 m a.s.l.). A primary coloniser of formerly forested habitats on a range of substrates including sand, clay, loams, alluvium, sedimentary, igneous, plutonic and ultramafic rockCoastal to lowland (sea level – 310 m a.s.l.). Favouring stable sand, sand and clay podzols and the margins of peat bogs. Rarely extending into tall forest. Occasionally found in hill country as a component of successional vegetation. Also on offshore islandsCoastal (sea level – 296 m a.s.l.). In open ground, shrublands and as the dominant of tall forest
Growth formHeterophyllous. Either rounded shrubs (up to 2 × 3 m) or erect to spreading trees (up to 18 × 8 m)Homophyllous. Erect to pendulous trees up to 18 × 6 mHomophyllous. Erect small trees up to 12 × 3 mHomophyllous. Erect tall trees up to 18 × 3 m
Trunk1(–2) usually branching from or near to base. Up to 0.85 m d.b.h. Erect, soon arching outwards. Juveniles much branched from base. Adults usually devoid of branches in lower half of trunk1(–4). Usually devoid of branches in lower half of trunk. Up to 0.85 m d.b.h. Erect1(–4 or more). Usually devoid of branches in lower half of trunk. Up to 0.85 m d.b.h. Mostly erect1(–6). Devoid of branches in lower half of trunk. Up to 0.85 m d.b.h. Mostly erect
Old barkCorky-coriaceous, tessellated, peeling upwards along trunk as broad, tabular strips with ± entire margins or weakly irregular. Secondary peeling not evident. Bark sparsely vegetated by liverwort and lichen growthCorky-coriaceous, coarsely tessellated or broken in long elongate sections, peeling inwards along transverse and longitudinal cracks, remaining centrally attached. Flakes mostly tabular, peeling in chartaceous layers, with ± entire to sinuous margins. Secondary peeling common. Bark often bare but may be densely covered by moss, liverwort and lichen growthCorky-coriaceous, coarsely tessellated, peeling inwards along transverse and longitudinal cracks, remaining centrally attached. Flakes mostly detaching in layers as chartaceous, lunate (in profile) flakes, margins often irregular with frayed apices. Secondary peeling not evident. Bark sparingly vegetated by liverwort and lichen growthCorky-coriaceous, ± tessellated, peeling upwards along trunk as broad tabular strips, margins ± entire, surface often deeply corrugated and cracked. Secondary peeling not evident. Bark usually sparingly vegetated by moss, liverwort and lichen growth
Epicormic growthOccasionalNot presentNot presentNot present
Reversion shootsCommon on damaged trunk and branch basesNot presentNot presentNot present
SuckersAbsentAbsentAbsentAbsent
BranchesJuvenile branches erect to suberect not spreading. Adult branches initially suberect, soon arching and spreading, weakly flexuose. Reversion shoots commonSlender, initially ascending, soon spreading, apices usually pendulous. Reversion shoots absentAscending to upright, very rarely spreading, distinctly plumose. Reversion shoots absentUpright to ± spreading. Reversion shoots absent
Branchlet hairsCopious, persistent, antrorse-appressed, 225–500 μm longInitially copious, soon glabrescent, divergent, 20–50 μm longUsually copious (rarely glabrous), persistent, antrorse-appressed, 400–700 μm longCopious, persistent, antrorse-appressed, 220–520 μm long
LeavesAdult and juvenile leaves adaxially dark glossy green, abaxially paler. Juvenile leaves (2.4–)3.4(–5.3) × (1.2–)1.9(–2.3) mm, ovate, broadly ovate, rhomboid to obovate. Adult leaves (6.0–)8.2(–12.5) × (1.8–)2.6(–3.8) mm, oblong, oblong-obovate, broadly oblanceolate to broadly lanceolateBright green, yellow green, rarely dark green, (4.0–)13.5(–25.0) × (0.5–)1.1(–1.8) mm, linear, linear-lanceolate to narrowly lanceolateInitially silvery-grey, maturing dark green to glaucous green, (9.3–)12.7(–19.5) × (0.3–)0.7(–1.2) mm, linearAdaxially dark glossy green, abaxially paler, (6.0–)10.0(–13.5) × (1.1–)1.8(–2.3) mm, lanceolate to narrowly lanceolate
Leaf margins and midribLeaf margins and abaxial midrib densely covered in a thick (up to 0.6 mm wide), plumose band of white sericeous, antrorse-appressed hairs, converging at leaf apex in a distinct tuft of hairs. Surfaces glabrous to sparsely hairyLeaf margins sparsely covered with antrorse-appressed hairs, tending to glabrate; abaxial midrib glabrate to glabrous. Hairs failing, short of leaf apex. Surfaces glabrousLeaf margins and abaxial midrib densely covered in a thick (up to 0.4 mm wide), plumose band of antrorse-appressed hairs, usually converging just short of leaf apex. Surfaces sparsely hairy to glabrate, rarely glabrousLeaf margins and abaxial midrib densely covered in a thick (up to 0.6 mm wide), plumose band of white sericeous, antrorse-appressed hairs, converging at leaf apex in a distinct tuft of hairs. Surfaces glabrous to sparsely hairy
Flowering(Jul–)Nov–Jan(–Jun)(Nov–)Dec–Jan(–Mar)(Jul–)Nov–Jan(–May)(Oct–)Dec(–May)
InflorescenceElongate, (5–)12(–20)-flowered botryum up to 200 mm long. Male flowers absentMostly a compact, corymbiform to shortly elongate, (3–)8(–15)-flowered botryum up to 60 mm long. Male flowers absentMostly a compact, spiciform (3–)8(–12)-flowered botryum up to 80 mm long. Male flowers absentElongate, (3–)10(–2)-flowered botryum up to 200 mm long, often interrupted by lengths of vegetative growth, sometimes bearing additional lateral elongate botrya. Male flowers absent
PherophyllsPersistent, foliose, spreading, strongly recurved; pherophylls of juvenile plants (2.0–)3.4(–5.3) × (1.2–)1.9(–2.3) mm; adult pherophylls (4.1–)5.4(–6.0) × (1.6–)2.3(–3.1) mm, oblong, oblong-obovate, broadly obovate to elliptic± Persistent, foliose, spreading, (3.0–)6.7(–7.8) × (0.9–)1.1(–1.4) mm, narrowly elliptic, lanceolate to narrowly lanceolatePersistent, foliose, ascending to suberect, rarely spreading, (6.0–)9.8(–12.8) × (0.9–)1.8(–2.2) mm, linear to linear-falcatePersistent, foliose, spreading, strongly recurved, (6.0–)9.8(–12.8) × (0.9–)1.8(–2.2) mm, broadly lanceolate to lanceolate
HypanthiumBroadly obconic, turbinate to hemispherical, (1.9–)2.8(–4.0) × (3.0–)4.0(–5.6) mm. Free portion 0.7–1.3 mm longSharply obconic, (1.4–)2.1(–3.2) × (1.9–)2.9(–4.1) mm. Free portion 0.4–1.0 mm longBarrel-shaped, cupular or narrowly campanulate, (2.0–)2.8(–4.0) × (2.5–)3.4(–4.1) mm. Free portion 0.6–0.9 mm longHemispherical to broadly obconic, sometimes campanulate or cupular. Free portion 0.6–0.8 mm long
Flower diameter(6.8–)11.6(–12.5) mm(4.1–)6.3(–8.3) mm(1.9–)3.9(5.7) mm(6.3–)10.2(–12.3) mm
Petals5(–8). White (often drying yellow). Orbicular to broadly ovate, spreading, (1.8–)2.6(3.7) × (0.6–)1.0(–1.8) mm. Oil glands colourless5. White (often drying yellow). Orbicular, suborbicular to narrowly ovate, spreading, (1.4–)2.2(–2.6) × (1.5–)2.2(–2.9) mm. Oil glands ± colourless5(–6). Cream, pale pink or cream basally flushed pink (drying white). Narrowly ovate to suborbicular, suberect, distal 30% often weakly recurved, (0.9–)1.4(–2.0) × (0.7–)1.4(–1.9) mm. Oil glands colourless5(–6). White (drying white). Orbicular to broadly ovate, spreading, (1.3–)2.8(–4.3) × (1.9–)2.8(–4.8) mm. Oil glands colourless
AnthersEllipsoid, ovoid-ellipsoid to ovoid-scutiform, 0.40–0.60 × 0.20–0.35 mm. Anther connective gland present or absent. Deep golden-yellow to orange when fresh, drying orange to pinkBroadly ellipsoid, 0.35–0.48 × 0.16–0.24 mm. Anther connective gland prominent, pink or pinkish-orange when fresh, drying red-orangeTesticulate, 0.04–0.06 × 0.02–0.04 mm. Anther connective gland prominent, pale pink or golden yellow when fresh, drying yellow to pale orangeTesticular-ellipsoid, 0.05–0.10 × 0.06–0.08 mm. Anther connective gland pink or golden yellow when fresh, drying yellow to pale orange
Pollen(9.9–)14.8(–18.9) μm(14.1–)14.6(–17.3) μm(13.2–)16.2(–21.0) μm(12.0–)13.8(–16.0) μm
Ovary5(–6) locular(4–)5 locular(3–)4(–5) locular4(–5) locular
Style and stigmaStyle 2.0–3.2 mm long at anthesis, white or pinkish-white. Stigma broadly capitate at least 50% wider than style or even wider, surface flatStyle 1.5–2.2 mm long at anthesis, white, flushing pink at anthesis. Stigma capitate, c.25% wider than style, surface flatStyle 0.8–2.0 mm long at anthesis, cream or pale pink. Stigma narrowly capitate as wide as or slightly wider than style, surface ± flatStyle 1.9–3.1 mm long at anthesis, white or pinkish white. Stigma broadly capitate much wider than style, surface ± flat
FruitBroadly obconic, turbinate to hemispherical, (2.4–)3.9(–4.8) × (3.6–)4.8(–6.0) mm. Long persistentCupular, barrel-shaped, shortly cylindrical to hemispherical, (1.9–)2.7(–3.4) × (1.8–)2.8(–3.9) mm. Rarely persistentBarrel-shaped to narrowly obconic, (1.6–)2.3(–2.9) × (2.3–)3.0(–4.1) mm. Long persistentHemispherical, broadly obconic, campanulate to cupular, (1.9–)3.2(–5.2) × (2.0–)3.1(–4.9) mm. Long persistent
SeedOrange-brown to dark brown, oblong, oblong-obovate, narrowly ellipsoid to cylindrical, 1.2–1.5(1.7) × 0.3–0.4(–0.6) mm. Surface coarsely reticulateOrange-brown to dark brown, obovoid, oblong, oblong-ellipsoid, or cylindrical and ± curved, 0.8(-1.0) × 0.32(–0.50) mm. Surface coarsely reticulateOrange-brown to dark brown, obovoid, oblong, oblong-ellipsoid, or cylindrical and ± curved, 0.5–1.0(–1.1) × 0.48–0.63(–0.70) mm. Surface coarsely reticulateOrange-brown to dark brown, oblong, oblong-obovate, 0.50–1.00(–1.10) × 0.50–0.60(–0.80) mm. Surface coarsely reticulate
Chromosome karyotype10 chromosomes pairs, 2–2.5 μm long, one pair 1.5 μm long10 chromosome pairs, 1.8–2 μm long, one pair 0.6 μm longEight chromosome pairs 1.2–1.5 μm long, three pairs 0.8–0.9 μm long10 chromosomes pairs, 2–2.5 μm long, one pair 1.5 μm long
Kunzea robustaKunzea salteraeKunzea serotinaKunzea sinclairii
HabitatCoastal to montane (rarely subalpine) (sea level – 1000 m a.s.l.). An important component of successional shrubland and forest. Also found in mature forest on slip scars, around tree falls and rarely as a canopy constituent. Colonising a wide variety of substrates but preferring well drained clays, loams and alluvium or hard rock. Usually avoiding mobile sand systemsCoastal (sea level – 220 m a.s.l.). On mobile sand dunes, active and quiescent geothermal fields, associated clay, and hard rock as well as stable sand soils. Dominant on sand dunes and dominant to co-dominant of successional forestInland in low-lying areas to alpine situations (30 – 2000 m a.s.l.). In lowland areas favouring seasonally frost-prone situations. Inland locally common in intermontane basins, on steep mountain slopes, in frost-flats, tussock grasslands and in subalpine shrublands. Common on a range of skeletal soils, in flood prone soils, on fresh alluvium, and hard rockLowland to montane (20 – 510 m a.s.l.). Mostly confined to sparsely vegetated rhyolite rock tors and associated talus. Extending down stream and river gorges on rhyolite, and into open ground and scrub. Sometimes along roadsides in tall forest
Growth HabitHeterophyllous. Erect, spreading trees up to 30 × 8 mHomophyllous. Shrubs (0.1 × 2 m) or small trees (up to 10 × 6 m)Heterophyllous. Shrubs (up to 2 × 2 m) or trees (up to 20 × 4 m)Heterophyllous. Shrubs (up to 3 × 1 m). Rarely small trees (up to 6 × 4 m)
Trunk1(–6). Mostly solitary. Up to 1 m d.b.h. Erect. Adults usually devoid of branches for at least the lower 1–3 mUsually multi-trunked from base. In exposed conditions branched from base, otherwise mostly devoid of branches in lower half. Up to 0.3 m d.b.h. Widely spreading to suberect, flexuose1(–3) arising from ground, basally buttressed. Except in tall shrublands branched from base. Up to 0.86 m a.b.h. Erect1(–4) or more. Shortly erect, mostly branching at 0.2–1 m from base, sometimes indistinguishable due to branches arising from ground level
BarkCorky-coriaceous, stringy to coarsely tessellated, peeling upwards in broad, tabular strips, margins ± entire to weakly irregular. Secondary peeling uncommon. Bark mostly bare, sometimes supporting sparse moss, liverwort and lichen growthCorky-chartaceous, coarsely tessellated, peeling inwards along transverse and longitudinal cracks, remaining centrally attached. Flakes mostly narrowly and shortly tabular, often lunate (in profile). Secondary peeling uncommon. Bark devoid of moss, liverwort and lichen growthChartaceous to corky-chartaceous, somewhat stringy, readily peeling inwards along transverse and longitudinal creaks, often inrolled. Flakes hanging in loose inrolled masses, ± tabular, with deeply sinuous, to highly irregular margins, often deeply cracked, frayed, and crumpled. Secondary peeling common. Bark usually supporting dense moss, liverwort and lichen growthCorky-coriaceous to somewhat chartaceous, coarsely stringy to tessellated, firmly attached, peeling inwards along transverse and longitudinal cracks, remaining centrally attached. Flakes ± tabular with entire margins and coarsely frayed apices. Secondary peeling common. Bark mostly bare, sometimes supporting sparse moss, liverwort and lichen growth
Epicormic growthNot presentNot presentOccasionalNot present
Reversion shootsNot presentNot presentOccasionalNot present
SuckersAbsentAbsentAbsentAbsent
BranchesInitially erect, soon arching outwards and spreading, distal ends mostly erect, rarely pendulousSuberect to widely spreading, rarely ascending, mostly pendulousObliquely ascending, fastigiateProstrate and widely spreading, new growth subscandent
Branchlet hairsCopious, persistent, mostly long (150–380 μm) to short (50–150 μm) antrorse-appressed; from East Cape to near Mahia Peninsula in mixtures of sparse long (100–200 μm), antrorse-appressed and abundant short (25–80 μm), divergent hairsInitially copious, rarely glabrate to glabrous; hairs initially mixed, at first dominated by long (up to 550 μm) antrorse-appressed hairs, these deciduous, leaving behind persistent, mostly divergent, short (40–100 μm) hairs with ± curled apicesCopious, persistent, divergent, 50–80 μm long, apices weakly curledCopious, persistent, antrorse-appressed, 280–600 μm long
LeavesAdaxially light to dark green, abaxially paler. Juvenile leaves of mainly northern New Zealand and coastal locations, (14.6–)19.0(–28.4) × (1.6–)2.2(–2.5) mm; from the Rangitikei, central and northern Wairarapa and Mt Egmont, (3.2–)4.6(–6.3) × (0.7–)1.2(–1.5) mm. Adult leaves of northern New Zealand and coastal locations, (4.9–)14.2(–20.1) × (0.9–)1.7(–3.0) mm; from inland areas especially the Rangitikei, Wairarapa and Central Otago, (5.8–)9.3(–12.3) × (1.2–)1.8(–2.2) mm. Adult leaves oblanceolate, broadly oblanceolate, lanceolate to linear-lanceolate, rarely elliptic to obovate. Surfaces glabrousBright glossy green, yellow-green, bronze-green to dark green, (4–)10(–18) × (0.6–)1.2(–2.0) mm, linear-lanceolate to narrowly oblanceolate. Surfaces glabrousJuvenile, sub-adult and reversion shoot leaves red-green, pale green suffused with red, or bright green, (0.8–)5.2(–7.8) × (0.6–)0.8(–1.2) mm, linear-lanceolate to lanceolate. Surfaces glabrous. Adult leaves dark glossy green or bronze-green, margins and base often flushed red, (2.0–)3.7(–6.3) × (0.8–)1.1(1.8) mm, linear-oblanceolate, oblanceolate to obovate. Surfaces glabrousJuvenile leaves dark green or glaucous, up to 25.0 × 3.5 mm, oblanceolate to lanceolate, glabrous. Adult leaves silvery-white, silvery-grey to reddish-grey, (5.6–)14.5(–20.6) × (2.0–)3.2(–4.5) mm, broadly lanceolate, elliptic, obovate to oblong-obovate. Surfaces densely hairy
Leaf margins and midribLeaf margins initially finely covered with a thin often interrupted band of flexuose, spreading to antrorse-appressed hairs not or rarely meeting at apex, glabrescent; adaxial and abaxial midribs glabrate, basally clad with, deciduous, fine, antrorse-appressed hairsLeaf margins sparsely to densely covered with antrorse-appressed hairs; abaxial midrib usually glabrous, sometimes with a dense weft of antrorse-appressed hairs near base. Hairs failing short of leaf apexLeaf margins sparsely hairy, hairs antrorse to subantrorse, aligned in 1 or 2 often interrupted rows failing well short of leaf apex. Adaxial and abaxial midribs glabrescent, sometimes hairy near basesLeaf margins and midribs of adult leaves distinctly hairy (though much less so than rest of lamina), hairs converging at leaf apex
Flowering(Aug–)Nov–Jan–Feb(–Jun)Aug–Apr(Nov–)Jan–Feb(–May)(Sep–)Nov–Jan(–Mar)
InflorescenceInitially corymbiform often becoming shortly elongate, (1–)12(–30)-flowered, up to 60 mm long, sometimes with late season elongate botrya up to 80 mm long. Male flowers absentCorymbiform, (2–)4(–8)-flowered, up to 45 mm long. Male flowers absentCompact, corymbiform, (1–3–)8(–12)-flowered up to 25 mm long. Inflorescences on ultimate branchlet terminus often elongate with active, terminal vegetative growth. Male flowers absentMostly compact, corymbiform (4–)9(–20)-flowered, up to 20 mm long, usually terminated by active vegetative growth; sometimes extending as late season elongate botrya. Male flowers absent
PherophyllsDeciduous or persistent, squamiform or foliose; squamiform clasping pedicels, foliose spreading. Squamiform pherophylls 0.4–1.2 × 0.3–0.6 mm, broadly to narrowly deltoid or lanceolate; foliose 6.0–)9.0(–17.9) × (1.1–)1.2(–1.8) mm, elliptic, oblanceolate, broadly lanceolate to lanceolate, flat or weakly recurvedDeciduous, mostly squamiform (rarely foliose), spreading, 0.6–1.8 mm long, broadly to narrowly linear lanceolateDeciduous, mostly foliose (rarely squamiform), clasping pedicels, 0.9–2.5 mm long, spathulate, spathulate-orbicular, rarely pandurate or lanceolateDeciduous, foliose or squamiform; foliose tightly clasping pedicel, (1.0–)1.2 × (0.2–)0.4 mm, oblong to oblong-lanceolate, very rarely broadly spathulate. Squamiform pherophylls tightly clasping pedicels, 0.3–1.0 × 0.4–0.8 mm, broadly to narrowly ovate or lanceolate
HypanthiumBroadly obconic to turbinate, rarely cupular, (2.1–)3.1(–4.1) × (3.0–)3.9(–5.2) mm. Free portion 0.4–0.9 mm longNarrowly obconic to funnelform, (2.1–)2.2(–3.8) × (1.8–)2.2(–3.2) mm. Free portion 1.0–1.6 mm longUrceolate to campanulate, (1.6–)2.0(–3.4) × (1.5–)1.9(–3.8) mm. Free portion 0.4–0.8 mm longNarrowly obconic to obconic or cupular, (1.9–)2.6(–3.6) × (2.1–)3.1(–4.2) mm. Free portion 0.4–0.7 mm long
Flower diameter(4.3–)7.7(–12.0) mm(9–)10(–12) mm(2.8–)5.2(8.8) mm(5.7–)8.1(–10.2) mm
Petals5(–6). White, rarely pink (sometimes drying yellow or cream), orbicular, suborbicular to ovate, spreading, (1.5–)2.6(–3.8) × (1.3–)2.6(–3.6) mm. Oil glands colourless, drying opaque or grey5. White, rarely basally flushed pink, orbicular to suborbicular, spreading, 1.4–1.6 × 1.4–1.6 mm. Oil glands not evident when fresh, drying colourless or rose-pink5(–6). White, sometimes basally flushed pink, narrowly orbicular to broadly ovate or cuneate, 1.4–1.6(–2.0) × 1.2–1.6(–2.0). Oil glands yellow, drying pale yellow to ± colourless5(–6). White, rarely basally flushed pink, broadly ovate, suborbicular to orbicular, rarely ± cuneate-truncate, spreading upper 30% ften weakly recurved, (2.0–)2.9(–3.6) × (2.1–)2.7(–3.3) mm. Oil glands not evident in fresh or dried material
AnthersEllipsoid to ovoid-ellipsoid or deltoid, 0.38–0.63 mm. Anther connective gland prominent, light pink, salmon pink, yellow to orange when fresh, drying dark orange, orange-brown or dark brownScutiform to ovoid, 0.11–0.16 × 0.10–0.14 mm, each anther deeply and longitudinally furrowed, with one anther lobe in each pair fused at right angles along inner margin with adjoining anther lobe to form a prominent “pinched” longitudinal ridge. Anther connective gland, pale orange to pink when fresh, drying orange-brownTesticulate to ellipsoid, 0.04–0.06 × 0.02–0.04 mm. Anther connective gland, orange flushed with rose when fresh, drying dark orange-brown or purpleBroadly ellipsoid to scutiform, 0.06–0.1 × 0.06–0.09 mm. Anther connective gland, pale pink when fresh, drying pale orange
Pollen(9.1–)14.7(–15.1) μm(10.2–)14.7(–16.6) μm(11.1–)12.4(–13.7) μm(11.9–)15.4(–19.9) μm
Ovary5(–6) locular(3–)4 locular3–4(–5) locular(3–)4(–5) locular
Style and stigmaStyle 2.0–3.5 mm long at anthesis, white or pinkish white; stigma broadly capitate, at least 1.5× style diameter of even wider, flatStyle 2.1–3.2 mm long at anthesis, white basally flushed with pink; stigma capitate, at least 1× style diameter, flat, abruptly broadenedStyle 0.6–1.2 mm long at anthesis, white; stigma capitate, scarcely wider than style, usually flat or weakly domed along margins and centrally depressedStyle 1.8–3.0 mm long at anthesis, white basally flushed pink or pale pink; stigma narrowly capitate, as wide or scarcely wider than style, ± flat
FruitObconic, broadly obconic to ± turbinate, rarely cupular, (2.2–)3.8(–4.6) × (3.2–)4.0(–5.3) mm. Rarely persistentCupular to suburceolate (2.0–)2.2(–2.7) × (2.0–)2.9(–4.0) mm. Rarely persistentUrceolate to shortly campanulate, rarely cupular, (1.2–)2.1(–3.0) × (1.2–)2.1(–3.4) mm. Rarely persistentNarrowly obconic to obconic, rarely cupular, (2.2–)3.0(–3.6) × (2.7–)3.2(–3.9) mm. Long persistent
SeedOrange-brown to dark brown, oblong, oblong-obovate, oblong-elliptic, 0.9–1.0(–1.1) × 0.35–0.40(–0.48) mm. Surface coarsely reticulateOrange-brown, narrowly oblong, oblong, oblong-obovate to falcate-oblong or elliptic, 0.80–1.00 × 0.45–0.48 mm. Surface coarsely reticulate, ridges prominent, central portion of each cell bearing a short, deciduous, tubular-spiny, protuberanceOrange-brown to dark brown, narrowly oblong, oblong, oblong-obovate, 0.60–0.90(–1.00) × 0.48–0.50(–0.60) mm. Surface coarsely reticulateOrange-brown to dark brown, obovoid, oblong, or oblong-ellipsoid, 0.52–1.04(–1.09) × 0.38–0.58(–0.72) mm. Surface coarsely reticulate
Chromosome karyotypeFour chromosome pairs 2–2.5 μm long, six intermediate pairs 1.5–1.8 μm long, and one small pair 0.6 μm long11 chromosome pairs, 0.9–1 μm long11 chromosome pairs, 0.9–1 μm long11 chromosome pairs, 0.9–1 μm long
Kunzea tenuicaulisKunzea toelkenii
HabitatLowland to montane (40 – 580 m a.s.l.). Confined to sites of geothermal activity where it is often the dominant woody speciesCoastal (< 20 m a.s.l.). Confined to mobile and semi-stable sand dunes
Growth HabitHeterophyllous. Shrubs (up to 3 × 1 m) or small trees (up to 6 × 4 m)Homophyllous. Shrubs (up to 4 × 6 m)
Trunk(1–)4–6, in arborescent forms multi-trunked from base. Up to 0.6 m d.b.h. At first erect, soon widely spreading and curving to somewhat sinuous invariably soon branched; in decumbent plants trunk virtually indistinguishable, 0.01–0.10 m d.b.h., trailing to semi-erect, curved and somewhat sinuous, obscured by numerous branches(1–)6(–10), up to 0.4 m d.b.h. Mostly arising from the top of a broad, serpentine rootstock, also appearing from exposed sections of root flange. Ascending to suberect, serpentine, highly contorted, twisted, bent, and spiralled. Lower half of trunk usually devoid of branches
BarkChartaceous to ± corky, tessellated, peeling upwards in small, thin, narrow mostly elongated flakes, these easily detached, margins mostly tabular to slightly sinuous or irregular. Secondary peeling not evident. Bark mostly bare. Rarely supporting sparse moss, liverwort and lichen growthCorky-coriaceous, stringy, deeply furrowed, initially peeling inwards along transverse and longitudinal cracks and then upwards in long, thick, highly irregular, deeply sinuate, cracked and frayed flakes, often remaining central attached, and then lunate in profile. Flakes easily detached. Secondary peeling common peels lunate in profile. Bark usually supporting dense lichen growth
Epicormic growthOccasional. Arising from basal portion of trunk only when damagedCommon. Arising from basal portion of damaged or undamaged trunk
SuckersAbsentCommonly present
Reversion shootsOccasionalNot present
BranchesSlender, often weakly flexuose; in prostrate plants trailing, otherwise initially ascending, soon suberect to widely spreading, arching, often pendulousWidely spreading, ± serpentine, flexuose, often pendulous, usually interwoven with adjoining branches
Branchlet hairsCopious, persistent, divergent, weakly flexuose, 25–78 μm long, apices ± straightCopious, persistent, of two types; antrorse-appressed, up to 260 μm long, weakly flexuose, and divergent, 40–180 μm long, with apices twisted or spiralled
LeavesMostly dark glossy green, red-green to bronze-green, sometimes bright green, spreading to recurved. Juvenile leaves 0.9–3.0(–4.5) × 0.2–0.4(–0.6) mm, linear-lanceolate, persistent in stressed habitats, or as reversion shoots. Adult leaves (1.1–)4.0(–10.0) × (0.8–)1.3(–2.8) mm, narrowly oblanceolate, oblanceolate, obovate to obovate-rostrate. Surfaces glabrous, rarely abaxial surface with fine hair covering toward leaf baseDark glossy green or bright-green, spreading to weakly to strongly recurved, (2.6–)5.7(–8.5) × (0.6–)1.6(–2.5) mm, obovate, clavate, to broadly oblanceolate. Surfaces glabrous
Leaf margins and midribMargins sparsely to densely covered with deciduous, antrorse-appressed to subantrorse, weakly spreading hairs failing just short of cuspidate leaf apex. Adaxial and abaxial midribs sparsely covered in deciduous, antrorse-appressed hairs, these increasing in density toward base, not reaching to leaf apexMargins sparse to densely covered with ± persistent, antrorse, subantrorse to spreading hairs meeting just short of leaf apex. Lower half of adaxial midrib finely covered in deciduous, antrorse-appressed hairs, abaxial glabrous
Flowering(Aug)Sep–Oct(–Mar)(Sep–)Oct–Nov
InflorescenceMostly compact, corymbiform (1–)6(–10)-flowered botrya up to 25 mm long, rarely with inflorescence at the ultimate branchlet tips elongated; these elongate botrya always surmounted by active terminal vegetative growth. Male flowers not seenMostly compact, corymbiform (1–3–)7(–10)-flowered botrya, up to 40 mm long. Inflorescences at the ultimate branchlet terminus uncommon (except in trailing epicormic growth), if present then up to 80 mm long, bearing active terminal growth. Flowers of late season elongate botrya often functionally male
PherophyllsDeciduous, initial few foliose rest squamiform, tightly clasping pedicels to ± spreading, 0.5–1 mm long, foliose pherophylls pale green, oblong, oblong-obovate to oblanceolate; squamiform pherophylls brown or pink, deltoid to oblong-ovateDeciduous, initial few foliose rest squamiform, tightly clasping pedicel or spreading, 0.4–1.6 mm long; foliose pherophylls green to bronze-green, shortly lanceolate to obovate; squamiform pherophylls amber-brown to brown, deltoid to ovate
HypanthiumNarrowly cupular to campanulate, (1.8–)2.5(–3.3) × (1.7–)2.4(–3.1) mm. Free portion 0.3–1.0 mm longObconic to funnelform, (1.7–)2.4(–3.2) × (2.8–)3.6(–4.3) mm, with free portion 0.6–0.9 mm long
Flower diameter(3.3–)5.5(–9.0) mm(3.6–)6.8(–9.0) mm
Petals5(–6). White, pinkish white, usually basally flushed pink, sometimes completely pink, orbicular, sometimes cuneate, 1.4–1.6(–2.0) × 1.4–1.6(–2.0) mm. Oil glands not evident when fresh, drying colourless5(–6). White, orbicular to very broadly ovate, 1.5–1.9(–2.8) × 1.5–1.9(–2.6) mm. Oil glands colourless in fresh and dried material
AnthersTesticulate, 0.04–0.08 × 0.02–0.04 mm. Anther connective gland orange when fresh, drying pale brownTesticular-oval to testicular-ellipsoid, 0.06–0.09 × 0.05–0.08 mm. Anther connective gland pale lemon to pink when fresh, drying yellow to pale orange
Pollen(12.8–)14.7(–16.6) μm(12.2–)13.6(–17.8) μm
Ovary(3–)4(–5) locular3–4(–5) locular
Style and stigmaStyle 2.0–3.6 mm long at anthesis, white basally flushed with pink; stigma capitate, scarcely wider than style. Domed along margins with a basal central depressionStyle 1.0–1.8 mm long at anthesis, white; stigma capitate, scarcely wider than style, flat
FruitUsually barrel-shaped, rarely cupular, (1.0–)2.3(–3.3) × (1.6–)2.2(–3.2) mm. ± PersistentBroadly obconic to cupular, (2.1–)2.6(–3.0) × (2.5–)3.0(–3.7) mm. Rarely persistent
SeedOrange-brown to dark brown, narrowly oblong, oblong, oblong-obovate to falcate-oblong, 0.80–1.00 × 0.45–0.50 mm. Surface coarsely reticulateAmber, orange-brown to brown, oblong, oblong-obovate 0.50–1.02 × 0.52–0.68 mm. Surface coarsely reticulate
Chromosome karyotype11 chromosome pairs, 0.9–1 μm long11 chromosome pairs, 0.9–1 μm long

Sites of character variability within Australian and New Zealand taxa and informal entities of the Kunzea ericoides complex (from de Lange 2007).

Taxon/Informal EntityITS-1ITS-2ETS
Alignment Position5425485535815946396466717247427569941020102810771841626875123153201202210213221232252259269274275276286404
Australian Kunzea ericoides complex
Kunzea leptospermoides F.Muell ex Miq.a*caagccgttgc*gcaagcacgaacccc/ag*aat*c/t
Kunzea peduncularis F.Muell.a*c**gccgttgccgcaagcacgaaccccg*aat*c
Kunzea phylicioides (A.Cunn. ex Schauer) Drucea/tac**gccgttgc*gcaagcacg/aaaccccg*aat*c
Kunzea aff. peduncularistac/t**gc/tcgttgc*gcaagcacgaac/tcccg*aat*c
Kunzea aff. ericoides (g)a*c**gccgttgc*gcaagtacg/aaaccccg*aat*c
Kunzea aff. ericoides (h)a*c**gccgttgccgcaagcacgaaccccg*aat*c
Kunzea aff. ericoides (i)aac**gcccttgc*acaagcgcaaactccg*aat*c
New Zealand Kunzea ericoides complex
Kunzea amathicolaacc**gctgg/tcgc*gcaagcgcgagccccgg****c
Kunzea ericoidesacc**gccgtcgc*gcaaacgc/tgagccg/ccgc****c
Kunzea linearisacc**gccgtcgc*gcgaacgcgagccg/ccg/ac****c
Kunzea robustaacc**gccgtcgc*gcaaacgcgagccccgg****c
Kunzea robusta (Mt Egmont only)acc**gccgtcgc*gcaaacgcgagccg/ccgg****c
Kunzea tenuicaulisacc**accgg/tcac*gtaaacgcgcgccccga****c
Kunzea toelkeniiacc**gccgtcgc*gcaaacgcgagccg/ccga****c
Kunzea triregensisacc**gccgtcgc*gcaaacgcgagccccg*****c
Kunzea salteraeacc**gccgg/tcgc/t*gcaaacgcgagccg/ccga****c
Kunzea serotinaacc**gccgtcgc*gcaaacgcgagccg/ccga****c
Kunzea sinclairiiacc**gccgtcgc*gcaaacgcgagccccgg****c
Kunzea aff. ericoides " Lottin Point"acc**gccgtcgc*gcatgcgcgagccccg****gc
Key:- unique character- shared character- shared Australian character
- shared character- shared character
KirkT (1889) The Forest Flora of New Zealand. Government Printer, Wellington.KirkT (1899) The students’ flora of New Zealand and the outlying islands. Government Printer, Wellington.McNeillJBarrieFFBuckWRDemoulinVGreuterWHawksworthDLHerendeenPSKnappSMarholdJPradoJWFPrud’Homme van ReineWFSmithGFWiersemaJTurlandNJ (2012) International Code of Nomenclature for algae, fungi and plants (Melbourne Code).Regnum Vegetabile154. http://www.iapt-taxon.org/nomen/main.phpde LangePJMurrayBG (2004) Chromosome numbers in Kunzea (Myrtaceae).Australian Journal of Botany52: 609617. doi: 10.1071/BT04060AtkinsonIAE (1999) Obituary: Anthony Peter Druce, BE (Civil), 1920–1999.New Zealand Journal of Botany37: 573577. doi: 10.1080/0028825X.1999.9512654DruceAP (1993) Indigenous vascular plants of New Zealand (9th rev.). Unpublished Checklist held at Landcare Research, Lincoln, New Zealand.HookerJD (1867) Handbook of the New Zealand Flora. Part I. Reeve and Co, London.de LangePJ (2007) Biosystematics of the New Zealand Kunzea ericoides (A.Rich.) Joy Thomps. complex. PhD Thesis, University of Auckland, New Zealand.de LangePJSmissenRDWagstaffSJKeelingDJMurrayBGToelkenHR (2010) A molecular phylogeny and infrageneric classification of Kunzea (Myrtaceae) inferred from rDNA ITS and ETS sequences.Australian Systematic Botany23: 309319. doi: 10.1071/SB10019de LangePJNortonDAMolloyBPJ (1997) An annotated checklist of New Zealand mistletoe (Loranthaceae) hosts. In: de LangePJNortonDA (Eds) New Zealand's loranthaceous mistletoes.Conference proceedings. Department of Conservation, Wellington, 83104.de LangePJ (2006) Kunzea. In: EagleAL. Eagle’s Complete Trees and Shrubs of New Zealand, Vol. 1. Te Papa Press, Wellington, 234239.de LangePJDatsonPMMurrayBGToelkenHR (2005) Hybridism in the Kunzea ericoides complex (Myrtaceae): an analysis of artificial crosses.Australian Systematic Botany18: 117131. doi: 10.1071/SB04043CunninghamA (1839) Flora insularum Novae Zelandiae Precursor.Annals of Natural History3: 111. doi: 10.1080/03745483909443207de LangePJRolfeJRChampionPDCourtneySPHeenanPBBarklaJWCameronEKNortonDAHitchmoughDA (2013b) Conservation status of New Zealand indigenous vascular, 2012. Department of Conservation, Wellington. www.doc.govt.nz/publications/conservation/nz-threat-classification-system/nz-threat-classfication-system-lists-2012-14/