Female. Body length: 2.2 mm. Fore wing length: 2.2 mm. Flagellomere 2 length/width: 0.11 mm/0.06 mm. Flagellomere 14: missing. Oculo-ocellar distance: 0.15 mm. Distance between posterior ocelli: 0.08 mm. Diameter of posterior ocellus: 0.05 mm. Metafemur length/width: 0.53 mm/0.18 mm. Metatibia length: 0.66 mm. Mediotergite 1 length/maximum width/minimum width: 0.30/0.15/0.09 mm. Mediotergite 2 length/width at posterior margin: 0.12/0.10 mm. Figs 3, 4.

Male. Unknown.

The mediotergite 1 is relatively long and with a slight constriction near anterior end (Fig. 4). That character is also shared with other three species of Venanus. However, V. johnnyrosalesi can be separated from V. helavai by its much smaller size (2.2 mm vs 2.8–3.0 mm) and less sculptured propodeum, from V. yanayacuensis by its wider discal cell in fore wing (1.0 × vs 1.2 × as wide as high), metasoma color (brown vs black) and fore wing vein 2RS significanly longer than vein r (shorter than r in yanayacuensis), and from V. johnnyrosalesi by proportion of veins 2RS and r (2.0 × vs 1.4 ×), sculpture of metapleuron and mediotergite 2, and narrower mediotergite 1 (narrowest width 0.6 × width at posterior margin vs 0.8 × in johnnyrosalesi).

Venanus randallgarciai is named in honor of Sr. Randall Garcia, currently of San Jose, Costa Rica, but also the first director of ACG and the current Executive Director of the Instituto Nacional de Biodiversidad (INBio), and therefore a major facilitator of ACG biodiversity inventory.

Only known from a single locality in Area de Conservación Cordillera Volcanica Central, Alajuela, Costa Rica.

We obtained a partial sequence (164 bp) of the DNA barcoding region for the holotype (see also Suppl. material 1). It has the sequence accesion HYCNF533-11 in BOLD (www.boldsystems.org), and the nucleotide sequence is reproduced below:

TTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTGCCATTAATATTAGGGACTCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGATTACTTATTCCTTCATTAT TTATATTAATTTTAAGAAGATTCATTAATACAGGCGCAGGTACG