ID,RANK,RAW SCORE,P VALUE,Q VALUE,TEST,SEQUENCE,ACCESSION#,DESCRIPTION,ASSOCIATED.WITH,ORGANISM,REFERENCE
LEGUMINBOXLEGA5,1,134.7439679,1.65E-261,8.01E-259,cis.trt,TCCATAGCCATGCAWRCTGMAGAATGTC,S000060,"""legumin box"" in legA 5' legumin gene promoter in legumin;",legumin; pea; tobacco; promoter; seed;,pea (Pisum sativum); tobacco (Nicotiana tabacum); Vicia faba;,"Baumlein H, Wobus U, Pustell J, Kafatos FC The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element. Nucleic Acids Res 14:2707-2720 (1986) PubMed: 3960730; GenBank: X03677; Shirsat A, Wilford N, Croy R, Boulter D Sequences responsible for the tissue specific promoter activity of a pea legumin gene in tobacco. Mol Gen Genet 215:326-331 (1989) PubMed: 2710102;"
ABADESI2,2,4.923278878,3.88E-23,9.40E-21,cis.trt,GGACGCGTGGC,S000008,"Synthetic element (hex-3) related to response to ABA and to desiccation; seed expression; Gene: synthetic; hex-3, mutant of hex-1 sequence from wheat histone H3 promoter; transacting factor: bZIP ?;",ABA; SEED; bZIP; hex-1; hex-3; histone;,rice (Oryza sativa); wheat (Triticum aestivum),"Lam E, Chua N-H Tetramer of a 21-base pair synthetic element confers seed expression and  transcriptional enhancement in response to water stress and abscisic acid. J Biol Chem 266:17131-17135 (1991) PubMed: 1832669; Thomas TL Gene expression during plant embryogenesis and germination: An overview. Plant Cell 5:1401-1410 (1993) PubMed: 8281041; Busk PK, Pages M Regulation of abscisic acid-induced transcription Plant Mol Biol 37:425-435 (1998) PubMed: 9617810"
GLUTEBOX1OSGT3,3,0.328339456,6.59E-15,1.07E-12,cis.trt,TATCTAGTGAGTCACTTCA,S000128,"""Box 1"" of rice (O.s.) glutelin Gt3 gene family promoter region; See S000128 GLUTEBOX2A;",Box 1; glutelin; Gt3; seed; endosperm;,rice (Oryza sativa);,"Croissant-Sych Y, Okita TW Identification of positive and negative regulatory cis-elements of the rice glutelin Gt3 promoter. Plant Science 116:27-35 (1996)"
RSEPVGRP18,4,1.410460427,2.76E-14,3.35E-12,cis.trt,CATCCAACTTTCATATCCATGTGCTT,S000289,"""RSE (root-specific element)"" found in bean (P.V.) grp1.8 gene promoter; Located at -98 to -73; Required also for vascular-specific expression in stem; See S000288, S000099;",RSE; grp1.8; vascular; root; stem; shoot;,bean (Phaseolus vulgaris),"Keller B, Heierli D Vascular expression of the grp1.8 promoter is controlled by three specific regulatory elements and one unspecific activating sequence Plant Mol Biol 26: 747-756 (1994) PubMed: 7948928"
TDBA12NTCHN50,5,4.252321361,4.69E-13,4.55E-11,cis.trt,TGACTTTCTGAC,S000266,TDBA12 binding site found in tobacco (N.t.) basic class I chitinase gene (CHN50); Elicitor response element; TDBA12 belongs to WRKY proteins that appear to be unique to plants; TDBA12 is activated by TMV infection in resistant tobacco plant and by plant defense signal molecule SA;,TDBA12; chitinase; CHN50;  WRKY; HR; TMV; SAR; elicitor;,tobacco (Nicotiana tabacum),"Yang P, Chen C, Wang Z, Fan B, Chen Z A pathogen- and salicylic acid-induced WRKY DNA-binding activity recognizes the elicitor response element of the tobacco class I chitinase gene promoter Plant J 18:141-149 (1999) Eulgem T, Rushton PJ, Robatzek S, Somssich IE The WRKY superfamily of plant transcription factors Trends Plant Sci 5: 199-206 (2000) PubMed: 10785665;"
CONSERVED11NTZMATP1,6,1.241416134,1.84E-12,1.49E-10,cis.trt,ACGTATTAAAA,S000301,Conserved 11 nt sequence found in the maize (Z.m.) mitochondrial atp1 promoter; Located between -5 and +6; Essential for the expression;,mitochondria; atp1;,maize (Zea mays),"Rapp WD, Stern DB A conserved 11 nucleotide sequence contains an essential promoter element of the maize mitochondrial atp1 gene EMBO J 11: 1065-1073 (1992) PubMed: 1372246"
SE2PVGRP1,7,3.780991057,3.83E-09,2.66E-07,cis.trt,TTNNNGTAGCTAGTGTATTTGTAT,S000101,"""SE2 (stem element 2)"" of bean (P.v.) GRP1.8 gene; part of SE2 element;",stem; SE2; GRP; GRP1;,bean (Phaseolus vulgaris),"Elmayan T, Tepfer M. Evaluation in tobacco of the organ specificity and strength of the rolD promoter, domain A of the 35S promoter and the 35S2 promoter. Transgenic Res 4:388-396 (1995) PubMed: 7581519;"
AGTACSAO,8,563.074074,9.55E-08,5.79E-06,cis.trt,AAAAAGTAAAAAGTAAAAAAGTAAAAAG,S000258,"""AGTA repeat"" in pumpkin (C.s.) ascorbate oxidase gene (AO) promoter; Found in silencer region; AOBP (AGTA repeat binding protein) binding site; AOBP protein has DOF domain; Required for repression of expression of AO gene;",AGTA repeat; DOF; AOBP; ascorbate oxidase; silencer region;,pumpkin (Cucurbita sp.),"Kisu Y, Ono T, Shimofurutani N, Suzuki M, Esaka M Characterization and expression of a new class of zinc finger protein that binds to silencer region of ascorbate oxidase gene Plant Cell Physiol 39:1054-1064 (1998) PubMed: 9871365;  GenBank: D45066;"
GLUTAACAOS,1,5.871459469,1.10E-12,5.34E-10,compensatory,AACAAACTCTAT,S000045,"""glutelin common motif""; ""AACA motif""; Conserved in all member of rice (0.s.) glutelin; -74 to -64;",AACA; glutelin; seed; endosperm;,rice (Oryza sativa),"Takaiwa F, Oono K Interaction of an immature seed-specific trans-acting factor with the 5' upstream region of a rice glutelin gene. Mol Gen Genet 224:289-293 (1990) PubMed: 2277646;"
ABRE3OSRAB16,2,3.304480198,3.37E-12,8.18E-10,compensatory,GTACGTGGCGC,S000120,ABA-responsive element of rice (O.s.) rab16 and alpha-amylase genes;,ABA; rab16; alpha-amylase; ABRE; seed;,rice (Oryza sativa);,"Skriver K, Olsen FL, Rogers JC, Mundy J Cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. Proc Natl Acad Sci USA 88:7266-7270 (1991) PubMed: 1831269; Busk PK, Pages M Regulation of abscisic acid-induced transcription Plant Mol Biol 37:425-435 (1998) PubMed: 9617810;"
ABADESI2,3,3.933085216,1.89E-11,3.05E-09,compensatory,GGACGCGTGGC,S000008,"Synthetic element (hex-3) related to response to ABA and to desiccation; seed expression; Gene: synthetic; hex-3, mutant of hex-1 sequence from wheat histone H3 promoter; transacting factor: bZIP ?;",ABA; SEED; bZIP; hex-1; hex-3; histone;,rice (Oryza sativa); wheat (Triticum aestivum),"Lam E, Chua N-H Tetramer of a 21-base pair synthetic element confers seed expression and  transcriptional enhancement in response to water stress and abscisic acid. J Biol Chem 266:17131-17135 (1991) PubMed: 1832669; Thomas TL Gene expression during plant embryogenesis and germination: An overview. Plant Cell 5:1401-1410 (1993) PubMed: 8281041; Busk PK, Pages M Regulation of abscisic acid-induced transcription Plant Mol Biol 37:425-435 (1998) PubMed: 9617810"
ABRECE3HVA1,4,9.332930526,5.24E-11,5.56E-09,compensatory,ACGCGTGTCCTC,S000141,CE3 (coupling element 3) of ABRC3 in barley HVA1 gene; ABRC3 (ABA response complex 3) of HVA1 consists of CE3 and A2; ABA responsive element; stress response; Found in barley HVA1 gene encoding a class 3 late embryogenesis-abundant (Lea) protein; ABRC1 OF HVA22 consists of CE1 and A3; CE1=S000014; A3=ABRE3=S000118; See S000118;,CE3; coupling element; ABRC3; ABRE; ABA; HVA1; Lea; seed;,barley (Hordeum vulgare);,"Shen Q, Zhang P, Ho THD Modular nature of abscisic acid (ABA) response complexes: composite promoter units that are necessary and sufficient for ABA induction of gene expression in barley. Plant Cell 8:1107-1119 (1996) PubMed: 8768371; Bray EA Plant responses to water deficit Trends in Plant Science 2:48-54 (1997) Busk PK, Pages M Regulation of abscisic acid-induced transcription Plant Mol Biol 37:425-435 (1998) PubMed: 9617810; Casaretto J, Ho TH. The transcription factors HvABI5 and HvVP1 are required for the abscisic acid induction of gene expression in barley aleurone cells. Plant Cell 15: 271-284 (2003) PubMed: 12509536;"
OCETYPEIIINTHISTONE,5,51.8522074,5.74E-11,5.56E-09,compensatory,GATCCGCGNNNNNNNNNNNNNNACCAATCS,S000269,"""Type III element""; Oct-containing composite element Type III found in tobacco (N.t.) histone gene promoter; Oct (octomer) motif is paired with CCAAT-box to form Type III element; Required for S-phase specific and meristematic tissue-specific expression;",histone; Oct; OCE; CCAAT-box; Type III; S-phase; meristem;,tobacco (Nicotiana tabacum),"Taoka K, Kaya H, Nakayama T, Araki T, Meshi T, Iwabuchi M Identification of three Kinds of mutually related composite elements conferring S phase-specific transcriptional activation Plant J 18:611-623 (1999) PubMed: 10417712;"
-141NTG13,6,6.489848211,9.59E-09,7.75E-07,compensatory,GCTTTTGATGACTTCAAACAC,S000335,"""-141 sequence""; Binding site of tobacco (N.t.) TGA1a-related protein,PG13, found in the G13 gene promoter; PG13 (Protein encoded by G13) shows high homology to TGA1a; ASF-1, PG13, and TGA1a bind to the same target sequence in the 5' upstream region of G13 suggesting that autoregulation of transcription may involved in the control of G13 expression; TGA1a is preferentially expressed in root tip meristems; TGA1a may contribute to the expression of GST isoenzymes, especially in root tip meristems;",TGA1a; G13; ASF1; ASF-1; bZip; xenobiotic stress; root; meristem;,tobacco (Nicotiana tabacum),"Fromm H, Katagiri F, Chua NH The tobacco transcription activator TGA1a binds to a sequence in the 5' upstream region of a gene encoding a TGA1a-related protein Mol Gen Genet 229: 181-188 (1991) PubMed: 1921969; GenBank: M62855; Klinedinst S, Pascuzzi P, Redman J, Desai M, Arias J A xenobiotic-stress-activated transcription factor and its cognate target genes are preferentially expressed in root tip meristems Plant Mol Biol 42: 679-688 (2000) PubMed: 10809441;"
SE2PVGRP1,7,6.145085566,2.29E-08,1.59E-06,compensatory,TTNNNGTAGCTAGTGTATTTGTAT,S000101,"""SE2 (stem element 2)"" of bean (P.v.) GRP1.8 gene; part of SE2 element;",stem; SE2; GRP; GRP1;,bean (Phaseolus vulgaris),"Elmayan T, Tepfer M. Evaluation in tobacco of the organ specificity and strength of the rolD promoter, domain A of the 35S promoter and the 35S2 promoter. Transgenic Res 4:388-396 (1995) PubMed: 7581519;"
YAB1,8,2.110132233,7.63E-05,0.004624093,compensatory,NA,NA,NA,NA,NA,NA
GT1CONSENSUS,9,1.417727973,9.23E-05,0.004972039,compensatory,GRWAAW,S000198,"Consensus GT-1 binding site in many light-regulated genes, e.g., RBCS from many species, PHYA from oat and rice, spinach RCA and PETA, and bean CHS15; R=A/G; W=A/T; For a compilation of related GT elements and factors, see Villain et al. (1996); GT-1 can stabilize the TFIIA-TBP-DNA (TATA box) complex; The activation mechanism of GT-1 may be achieved through direct interaction between TFIIA and GT-1; Binding of GT-1-like factors to the PR-1a promoter influences the level of SA-inducible gene expression;",GT-1; light; TATA; TFIIA; TBP; HR; SAR; TMV; leaf; shoot;,pea (Pisum sativum); oat (Avena sativa); rice (Oryza sativa); tobacco (Nicotiana tabacum); Arabidopsis thaliana; spinach (Spinacia oleracea); bean;,"Terzaghi WB, Cashmore AR Light-regulated transcription Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) Villain P, Mache R, Zhou DX The mechanism of GT element-mediated cell type-specific transcriptional control J Biol Chem 271:32593-32598 (1996) PubMed: 8955086; Le Gourrierec J, Li YF, Zhou DX Transcriptional activation by Arabidopsis GT-1 may be through interaction with TFIIA-TBP-TATA complex Plant J 18:663-668 (1999) PubMed: 10417717 Buchel AS, Brederode FT, Bol JF, Linthorst HJM Mutation of GT-1 binding sites in the Pr-1A promoter influences the level of inducible gene expression in vivo Plant Mol Biol 40:387-396 (1999) PubMed: 10437823; Zhou DX Regulatory mechanism of plant gene transcription by GT-elements and GT-factors Trends in Plant Science  4:210-214 (1999) PubMed: 10366876"
POLASIG3,10,1.681214554,0.000215337,0.010443832,compensatory,AATAAT,S000088,"""Plant polyA signal""; Consensus sequence for plant polyadenylation signal;",poly A; polyadenylation;,maize (Zea mays),"Heidecker G, Messing J Structural analysis of plant genes. Ann Rev Plant Physiol 37:439-466 (1986) Joshi CP Putative polyadenylation signals in nuclear genes of higher plants: a compilation and analysis. Nucleic Acids Res 15:9627-9640 (1987) PubMed: 3697078;"
CPBCSPOR,11,0.955287994,0.000244522,0.010781201,compensatory,TATTAG,S000491,"The sequence critical for Cytokinin-enhanced Protein Binding in vitro, found in -490 to -340 of the promoter of the cucumber (CS) POR (NADPH-protochlorophyllide reductase) gene;",cytokinin; chlorophyll; chloroplast;,Cucumis sativus L. (cucumber),"Fusada N, Masuda T, Kuroda H, Shimada H, Ohta H, Takamiya K. Identification of a Novel Cis-Element Exhibiting Cytokinin-Dependent Protein Binding in Vitro in the 5'-region of NADPH-Protochlorophyllide Oxidoreductase Gene in Cucumber. Plant Mol Biol. 59: 631-645 (2005). PubMed: 16244912"
GT1GMSCAM4,12,2.720471728,0.000453952,0.018347222,compensatory,GAAAAA,S000453,"""GT-1 motif"" found in the promoter of soybean (Glycine max) CaM isoform, SCaM-4; Plays a role in pathogen- and salt-induced SCaM-4 gene expression; See also S000198 (GT-1 consensus);",GT-1 box;,Glycine max (soybean),"Park HC, Kim ML, Kang YH, Jeon JM, Yoo JH, Kim MC, Park CY, Jeong JC, Moon BC, Lee JH, Yoon HW, Lee SH, Chung WS, Lim CO, Lee SY, Hong JC, Cho MJ. Pathogen- and NaCl-induced expression of the SCaM-4 promoter is mediated in part by a GT-1 box that interacts with a GT-1-like transcription factor. Plant Physiol. 135: 2150-2161 (2004). PubMed: 15310827"
SE1PVGRP18,1,0.248644858,7.69E-18,3.73E-15,all.trans q<0.01,ATAATGGGCCACACTGTGGGGCAT,S000288,"""SE1 (Stem element 1)"" found in the bean (P.v.) grp1.8 gene promoter; Located between -121 and -94; Enhances the expression strongly but unspecifically; See S000289, S000101 (SE2);",SE1; grp1.8; vascular; stem; shoot;,bean (Phaseolus vulgaris),"Keller B, Heierli D Vascular expression of the grp1.8 promoter is controlled by three specific regulatory elements and one unspecific activating sequence Plant Mol Biol 26: 747-756 (1994) PubMed: 7948928"
EREGCC,2,2.370671806,1.50E-13,3.64E-11,all.trans q<0.02,TAAGAGCCGCC,S000036,"""GCC box"" in ""ERE (ethylene responsive element)""; Ethylene-responsive  region of tobacco (N.t.) chitinase gene contains two copies of the GCC-box; ERF2 and ERF4 enhanced the GCC box-mediated transcription; ERF3 reduced the transcription of the reporter gene in tobacco protoplasts; Binding site of AtEBP; Pti4/5/6 proteins from tomato which belong to the ERF family activate the expression of ""GCC box""-containing PR genes; ERF3 was found to interact with NtUBC2, a ubiquitin-conjugating enzyme;",Ethylene; EREBP; GCC box; G-box; CHN; ERE; ERF; xylanase; TvX; OBF; bZIP; EBP; pathogen; ocs; leaf; shoot; Pti4/5/6; ubiquitin; UBC2;,tobacco (Nicotiana tabacum); Arabidopsis thaliana;,"Koyama T, Okada T, Kitajima S, Ohme-Takagi M, Shinshi H, Sato F. Isolation of tobacco ubiquitin-conjugating enzyme cDNA in a yeast two-hybrid system with tobacco ERF3 as bait and its characterization of specific interaction. J Exp Bot. 54: 1175-1181 (2003) PubMed: 12654868; Gu YQ, Wildermuth MC, Chakravarthy S, Loh YT, Yang C, He X, Han Y, Martin GB Tomato transcription factors pti4, pti5, and pti6 activate defense responses when expressed in Arabidopsis Plant Cell 14: 817-831 (2002) PubMed: 11971137; Yamamoto S, Suzuki K, Shinshi H Elicitor-responsive, ethylene-independent activation of GCC box-mediated transcription that is regulated by both protein phosphorylation and dephosphorylaton in cultured tobacco cells Plant J 20: 571-579 (1999) PubMed: 10652129; Ohta M, Ohme-Takagi M, Shinshi H Three ethylene-responsive transcription factors in tobacco with distinct transactivation functions Plant J 22:29-38 (2000) PubMed: 10792818; Ohme-Takagi M, Shinshi H Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element Plant Cell 7: 173-182 (1995) PubMed: 7756828; Buttner M, Singh KB Arabidopsis thaliana ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an ocs element binding protein Proc Natl Acad Sci USA 94: 5961-5966 (1997) PubMed: 9159183; GenBank: Y09942; Ohme-Takagi M, Suzuki K, Shinshi H Regulation of Ethylene-Induced Transcription of Defense Genes Plant Cell Physiol 41: 1187-1192 (2000) PubMed: 11092902;"
GLUTEBOX1OSGT3,3,0.424159007,1.64E-12,2.65E-10,all.trans q<0.03,TATCTAGTGAGTCACTTCA,S000128,"""Box 1"" of rice (O.s.) glutelin Gt3 gene family promoter region; See S000128 GLUTEBOX2A;",Box 1; glutelin; Gt3; seed; endosperm;,rice (Oryza sativa);,"Croissant-Sych Y, Okita TW Identification of positive and negative regulatory cis-elements of the rice glutelin Gt3 promoter. Plant Science 116:27-35 (1996)"
ABADESI2,4,3.733626235,1.95E-11,1.94E-09,all.trans q<0.04,GGACGCGTGGC,S000008,"Synthetic element (hex-3) related to response to ABA and to desiccation; seed expression; Gene: synthetic; hex-3, mutant of hex-1 sequence from wheat histone H3 promoter; transacting factor: bZIP ?;",ABA; SEED; bZIP; hex-1; hex-3; histone;,rice (Oryza sativa); wheat (Triticum aestivum),"Lam E, Chua N-H Tetramer of a 21-base pair synthetic element confers seed expression and  transcriptional enhancement in response to water stress and abscisic acid. J Biol Chem 266:17131-17135 (1991) PubMed: 1832669; Thomas TL Gene expression during plant embryogenesis and germination: An overview. Plant Cell 5:1401-1410 (1993) PubMed: 8281041; Busk PK, Pages M Regulation of abscisic acid-induced transcription Plant Mol Biol 37:425-435 (1998) PubMed: 9617810"
ABRE3OSRAB16,5,2.932258338,2.00E-11,1.94E-09,all.trans q<0.05,GTACGTGGCGC,S000120,ABA-responsive element of rice (O.s.) rab16 and alpha-amylase genes;,ABA; rab16; alpha-amylase; ABRE; seed;,rice (Oryza sativa);,"Skriver K, Olsen FL, Rogers JC, Mundy J Cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. Proc Natl Acad Sci USA 88:7266-7270 (1991) PubMed: 1831269; Busk PK, Pages M Regulation of abscisic acid-induced transcription Plant Mol Biol 37:425-435 (1998) PubMed: 9617810;"
SE2PVGRP1,6,5.573117645,2.12E-08,1.71E-06,all.trans q<0.06,TTNNNGTAGCTAGTGTATTTGTAT,S000101,"""SE2 (stem element 2)"" of bean (P.v.) GRP1.8 gene; part of SE2 element;",stem; SE2; GRP; GRP1;,bean (Phaseolus vulgaris),"Elmayan T, Tepfer M. Evaluation in tobacco of the organ specificity and strength of the rolD promoter, domain A of the 35S promoter and the 35S2 promoter. Transgenic Res 4:388-396 (1995) PubMed: 7581519;"
PALBOXPPC,7,5.922814484,0.000186202,0.01290113,all.trans q<0.07,YTYYMMCMAMCMMC,S000136,"Box P; Consensus; One of three putative cis-acting elements (boxes P, A, and L) of phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) genes in parsley (P.c.); ""None of these elements (boxes P, A, and L) alone, or the promoter region containing all of them together, conferred elicitor or light responsiveness. These elements appear to be necessary but not sufficient for elicitor- or light-mediated PAL gene activation."" (Logemann et al., 1995); See also S000137 (Box A), S000138 (Box L);",Box P; PAL;,parsley (Petroselinum crispum),"Logemann E, Parniske M, Hahlbrock K Modes of expression and common structural features of the complete phenylalanine ammonia-lyase gene family in parsley. Proc Natl Acad Sci USA 92:5905-5909 (1995) PubMed: 7597051; GenBank: L37355, L37356, L37357;"
ABREMOTIFAOSOSEM,8,0.900906532,0.000469365,0.028455245,all.trans q<0.08,TACGTGTC,S000299,"""motif A"" ABRE-like sequence found in rice (O.s.) Osem gene promoter; Essential for activation by VP1; Important for regulation by ABA; See S000102, S000300; TRAB1, bZIP transcription factor, interacts with VP1 and mediates abscisic acid-induced transcritption;",ABRE; Em; Osem; ABA; VP1; seed;,rice (Oryza sativa),"Hattori T, Terada t, Hamasuna S Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1 Plant J 7: 913-925 (1995) PubMed: 7599651; GenBank: U22102 Hobo T, Kowyama Y, Hattori T A bZIP factor, TRAB1, interacts with VP1 and mediates abscisic acid-induced transcription Proc Natl Acad Sci USA 96: 15348-15353 (1999) PubMed: 10611387;"
RNFG2OS,1,13.22075797,1.14E-12,5.51E-10,<lp heterosis,CCAGTGTGCCCCTGG,S000189,"RNFG2 binding site; Box II; RNFG2 is one of two Rice Nuclear Factors required for phloem-specific gene expression of Rice Tungro Bacilliform Virus (RTBV); Box II is found at -53 to -39 of RTBV promoter; See also RNFG1OS (S000188); ""Box II"" is the binding site of bZIP protein RF2a and RF2b; RF2a and RF2b are predominantly expressed in vascular tissue (Dai et al.);",RNFG1; phloem; RTBV; Box II; stem; phloem; RF2a; RF2b; bZIP; vascular;,rice (Oryza sativa);,"Yin Y, Beachy RN The regulatory regions of the rice tungro bacilliform virus promoter and interacting nuclear factors in rice (Oryza sativa L.) Plant J 7:969-980 (1995) PubMed: 7599653; Yin Y, Chen L, Beachy R Promoter elements required for phloem-specific gene expression from the RTBV promoter in rice Plant J 12:1179-1188 (1997) PubMed: 9418055; Dai S, Zhang Z, Chen S, Beachy RN. RF2b, a rice bZIP transcription activator, interacts with RF2a and is involved in symptom development of rice tungro disease. Proc Natl Acad Sci U S A. 101:687-92.(2004) PubMed: 14704272;"
L1DCPAL1,2,8.101800007,1.06E-10,2.58E-08,<lp heterosis,ATTCACCTACCC,S000504,"""L1"" element, found in PAL1 promoter in carrot (Daucus carota), is a protoplastization (dilution) responsive element; L1 contains Box L-like sequence (ACCTACCC); see also S000492 (BOXL CORE of DC PAL1);",L1,Daucus carota (carrot),"Takeda J, Ito Y, Maeda K, Ozeki Y. Assignment of UVB-responsive cis-element and protoplastization-(dilution-) and elicitor-responsive ones in the promoter region of a carrot phenylalanine ammonia-lyase gene (gDcPAL1). Photochem Photobiol. 76:232-238 (2002). PubMed: 12194222"
PREMOTIFNPCABE,3,10.56424387,3.03E-10,4.89E-08,<lp heterosis,ACCGGCCCACTT,S000230,"Motif sequence repeated many times in two positive regulatory elements, PRE1 (-1554 to -1182) and PRE2 (-747 to -516) found far upstream in the tobacco (N.p.) CAB gene (cab-E) promoter; Confer maximum levels of photoregulated expression;",PRE; cab; CAB; photoregulated genes; light-regulated genes; light; leaf; shoot;,tobacco (Nicotiana plumbaginifolia),"Castresana C, Garcia-Luque I, Alonso E, Malik VS, Cashmore AR Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia. EMBO J 7:1929-1936 (1988) PubMed: 2901343; GenBank: X12512; Terzaghi WB, Cashmore AR Light-regulated transcription Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995)"
MYC2-5,5,1.553712278,1.14E-06,0.000110696,<lp heterosis,NA,NA,NA,NA,NA,NA
SORLIP2AT,4,1.55951797,9.94E-07,0.000110696,<lp heterosis,GGGCC,S000483,"one of ""Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);",phyA; phytochrome; light;,Arabidopsis thaliana,"Hudson ME, Quail PH. Identification of promoter motifs involved in the network of phytochrome A-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiol. 133: 1605-1616 (2003) PubMed: 14681527"
CGCGBOXAT,6,1.931996382,4.37E-06,0.000353089,<lp heterosis,VCGCGB,S000501,"""CGCG box"" recognized by AtSR1-6 (Arabidopsis thaliana signal-responsive genes); Multiple CGCG elements are found in promoters of many genes; Ca++/calmodulin binds to all AtSRs; V=A/C/G; B=G/T/C;",calmodulin,Arabidopsis thaliana,"Yang T, Poovaiah BW. A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants. J Biol Chem. 277:45049-45058. (2002) PubMed: 12218065"
ABRERATCAL,7,1.085135147,3.57E-05,0.002472755,<lp heterosis,MACGYGB,S000507,"""ABRE-related sequence"" or ""Repeated sequence motifs"" identified in the upstream regions of 162 Ca(2+)-responsive upregulated genes; see also ABRE; M=C/A; Y=T/C; B=T/C/G;",ABRE; calcium;,Arabidopsis thaliana,"Kaplan B, Davydov O, Knight H, Galon Y, Knight MR, Fluhr R, Fromm H. Rapid Transcriptome Changes Induced by Cytosolic Ca2+ Transients Reveal ABRE-Related Sequences as Ca2+-Responsive cis Elements in Arabidopsis. Plant Cell. 18:2733-2748 (2006) PubMed: 16980540"
PALBOXAPC,8,1.551841486,0.000132341,0.008023161,<lp heterosis,CCGTCC,S000137,"Box A; Consensus; One of three putative cis-acting elements (boxes P, A, and L) of phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) genes in parsley (P.c.); ""None of these elements (boxes P, A, and L) alone, or the promoter region containing all of them together, conferred elicitor or light responsiveness. These elements appear to be necessary but not sufficient for elicitor- or light-mediated PAL gene activation."" (Logemann et al., 1995); See also S000136 (Box P), S000138 (Box L);",Box A; PAL;,parsley (Petroselinum crispum),"Logemann E, Parniske M, Hahlbrock K Modes of expression and common structural features of the complete phenylalanine ammonia-lyase gene family in parsley. Proc Natl Acad Sci USA 92:5905-5909 (1995) PubMed: 7597051; GenBank: L37355, L37356, L37357;"
RHERPATEXPA7,9,0.919647209,0.000178763,0.009633366,<lp heterosis,KCACGW,S000512,"""Right part of RHEs (Root Hair-specific cis-Elements)"" conserved among the Arabidopsis thaliana A7 (AtEXPA7) orthologous (and paralogous) genes from diverse angiosperm species with different hair distribution patterns; K=G/T; W=T/A;",root; hair;,Arabidopsis thaliana,"Kim DW, Lee SH, Choi SB, Won SK, Heo YK, Cho M, Park YI, Cho HT. Functional Conservation of a Root Hair Cell-Specific cis-Element in Angiosperms with Different Root Hair Distribution Patterns. Plant Cell. 18:2958-2970 (2006) PubMed: 17098810"
UPRMOTIFIIAT,10,2.586607542,0.000315386,0.015296217,<lp heterosis,CCNNNNNNNNNNNNCCACG,S000426,"""Motif II"" in the conserved UPR (unfolded protein response) cis-acting element in Arabidopsis genes coding for SAR1B, HSP-90, SBR-like, Ca-ATPase 4, CNX1, PDI, etc.; See S000425, S000428, S000429;",UPR; unfolded protein response;,Arabidopsis thaliana,"Martinez IM, Chrispeels MJ. Genomic analysis of the unfolded protein response in Arabidopsis shows its connection to important cellular processes. Plant Cell. 15:561-576 (2003) PubMed: 12566592; Oh DH, Kwon CS, Sano H, Chung WI, Koizumi N. Conservation between animals and plants of the cis-acting element involved in the unfolded protein response. Biochem Biophys Res Commun. 301:225-230 (2003) PubMed: 12535667;"
MYC2-4,11,1.223257831,0.000363238,0.01601548,<lp heterosis,NA,NA,NA,NA,NA,NA
RAP2.6-5,12,3.772785081,0.000656593,0.026537316,<lp heterosis,NA,NA,NA,NA,NA,NA
VOZATVPP,13,1.920111561,0.000934425,0.034861229,<lp heterosis,GCGTNNNNNNNACGC,S000456,"""VOZ-binding sequence"" found in the promoter of A. thaliana V-PPase (vacuolar H+-pyrophosphatase) gene; Involved in its expression during pollen development; one-zinc finger;(Mitsuda et al., 2004);",VOZ; V-PPase; pollen;,Arabidopsis thaliana,"Mitsuda N, Hisabori T, Takeyasu K, Sato MH. VOZ; isolation and characterization of novel vascular plant transcription factors with a one-zinc finger from Arabidopsis thaliana. Plant Cell Physiol. 45: 845-854 (2004). PubMed: 15295067"
ABADESI2,2,9.368519159,3.19E-11,7.74E-09,>hp heterosis,GGACGCGTGGC,S000008,"Synthetic element (hex-3) related to response to ABA and to desiccation; seed expression; Gene: synthetic; hex-3, mutant of hex-1 sequence from wheat histone H3 promoter; transacting factor: bZIP ?;",ABA; SEED; bZIP; hex-1; hex-3; histone;,rice (Oryza sativa); wheat (Triticum aestivum),"Lam E, Chua N-H Tetramer of a 21-base pair synthetic element confers seed expression and  transcriptional enhancement in response to water stress and abscisic acid. J Biol Chem 266:17131-17135 (1991) PubMed: 1832669; Thomas TL Gene expression during plant embryogenesis and germination: An overview. Plant Cell 5:1401-1410 (1993) PubMed: 8281041; Busk PK, Pages M Regulation of abscisic acid-induced transcription Plant Mol Biol 37:425-435 (1998) PubMed: 9617810"
EREGCC,1,6.859107215,2.93E-11,7.74E-09,>hp heterosis,TAAGAGCCGCC,S000036,"""GCC box"" in ""ERE (ethylene responsive element)""; Ethylene-responsive  region of tobacco (N.t.) chitinase gene contains two copies of the GCC-box; ERF2 and ERF4 enhanced the GCC box-mediated transcription; ERF3 reduced the transcription of the reporter gene in tobacco protoplasts; Binding site of AtEBP; Pti4/5/6 proteins from tomato which belong to the ERF family activate the expression of ""GCC box""-containing PR genes; ERF3 was found to interact with NtUBC2, a ubiquitin-conjugating enzyme;",Ethylene; EREBP; GCC box; G-box; CHN; ERE; ERF; xylanase; TvX; OBF; bZIP; EBP; pathogen; ocs; leaf; shoot; Pti4/5/6; ubiquitin; UBC2;,tobacco (Nicotiana tabacum); Arabidopsis thaliana;,"Koyama T, Okada T, Kitajima S, Ohme-Takagi M, Shinshi H, Sato F. Isolation of tobacco ubiquitin-conjugating enzyme cDNA in a yeast two-hybrid system with tobacco ERF3 as bait and its characterization of specific interaction. J Exp Bot. 54: 1175-1181 (2003) PubMed: 12654868; Gu YQ, Wildermuth MC, Chakravarthy S, Loh YT, Yang C, He X, Han Y, Martin GB Tomato transcription factors pti4, pti5, and pti6 activate defense responses when expressed in Arabidopsis Plant Cell 14: 817-831 (2002) PubMed: 11971137; Yamamoto S, Suzuki K, Shinshi H Elicitor-responsive, ethylene-independent activation of GCC box-mediated transcription that is regulated by both protein phosphorylation and dephosphorylaton in cultured tobacco cells Plant J 20: 571-579 (1999) PubMed: 10652129; Ohta M, Ohme-Takagi M, Shinshi H Three ethylene-responsive transcription factors in tobacco with distinct transactivation functions Plant J 22:29-38 (2000) PubMed: 10792818; Ohme-Takagi M, Shinshi H Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element Plant Cell 7: 173-182 (1995) PubMed: 7756828; Buttner M, Singh KB Arabidopsis thaliana ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an ocs element binding protein Proc Natl Acad Sci USA 94: 5961-5966 (1997) PubMed: 9159183; GenBank: Y09942; Ohme-Takagi M, Suzuki K, Shinshi H Regulation of Ethylene-Induced Transcription of Defense Genes Plant Cell Physiol 41: 1187-1192 (2000) PubMed: 11092902;"
ABADESI2,1,5.50792543,2.04E-22,9.87E-20,gxe.halup.fildown,GGACGCGTGGC,S000008,"Synthetic element (hex-3) related to response to ABA and to desiccation; seed expression; Gene: synthetic; hex-3, mutant of hex-1 sequence from wheat histone H3 promoter; transacting factor: bZIP ?;",ABA; SEED; bZIP; hex-1; hex-3; histone;,rice (Oryza sativa); wheat (Triticum aestivum),"Lam E, Chua N-H Tetramer of a 21-base pair synthetic element confers seed expression and  transcriptional enhancement in response to water stress and abscisic acid. J Biol Chem 266:17131-17135 (1991) PubMed: 1832669; Thomas TL Gene expression during plant embryogenesis and germination: An overview. Plant Cell 5:1401-1410 (1993) PubMed: 8281041; Busk PK, Pages M Regulation of abscisic acid-induced transcription Plant Mol Biol 37:425-435 (1998) PubMed: 9617810"
SE1PVGRP18,2,0.186595265,1.98E-18,4.81E-16,gxe.halup.fildown,ATAATGGGCCACACTGTGGGGCAT,S000288,"""SE1 (Stem element 1)"" found in the bean (P.v.) grp1.8 gene promoter; Located between -121 and -94; Enhances the expression strongly but unspecifically; See S000289, S000101 (SE2);",SE1; grp1.8; vascular; stem; shoot;,bean (Phaseolus vulgaris),"Keller B, Heierli D Vascular expression of the grp1.8 promoter is controlled by three specific regulatory elements and one unspecific activating sequence Plant Mol Biol 26: 747-756 (1994) PubMed: 7948928"
OCSGMGH24,3,0.121923394,6.51E-15,1.05E-12,gxe.halup.fildown,CGGTTTACGTAATCTCTTACATCA,S000346,"""OCS element"" found in the soybean (G.m) GH2/4 gene promoter; Required for auxin and salycylic acid responsiveness; Activated by both active and inactive auxin and salicylic acid analogues; See S000074, S000130, S000158, S000304; Tandem OCSTF binding-sites are essential for the activity of the Ocs-element; The Ocs-element occurs rarely in plant gene promoters; See S000357;",OCS; auxin; salicylic acid; GH2/4;,Soybean (Glycine max),"Ulmasov T, Hagen G, Guilfoyle T The ocs element in the soybean GH2/4 promoter is activated by both active and inactive auxin and salicylic acid analogues Plant Mol Biol 26: 1055-1064 (1994) PubMed: 7811965; Ellis JG, Tokuhisa JG, Llewellyn DJ, Bouchez D, Singh K, Dennis ES, Peacock WJ Does the ocs-element occur as a functional component of the promoters of plant genes? Plant J (1993) 4: 433-443 PubMed: 8220489;"
ATRICHPSPETE,4,0.192992923,5.94E-14,7.20E-12,gxe.halup.fildown,AATATACTAGTATTATTTACTAAAAAAAATC,S000248,A/T-rich sequences found in pea (P.s.) plastocyanin gene (petE) promoter; Act as quantitative enhancer; Found at -289 to -255 of pea PetE gene;,A/T-rich; AT-rich; AT rich; enhancer;,pea (Pisum sativum),"Sandhu JS, Webster CI, Gray JC A/T-rich sequences act as quantitative enhancers of gene expression in transgenic tobacco and potato plants Plant Mol Biol  37:885-896 (1998) PubMed: 9678583;"
EREGCC,5,1.843389554,1.68E-13,1.63E-11,gxe.halup.fildown,TAAGAGCCGCC,S000036,"""GCC box"" in ""ERE (ethylene responsive element)""; Ethylene-responsive  region of tobacco (N.t.) chitinase gene contains two copies of the GCC-box; ERF2 and ERF4 enhanced the GCC box-mediated transcription; ERF3 reduced the transcription of the reporter gene in tobacco protoplasts; Binding site of AtEBP; Pti4/5/6 proteins from tomato which belong to the ERF family activate the expression of ""GCC box""-containing PR genes; ERF3 was found to interact with NtUBC2, a ubiquitin-conjugating enzyme;",Ethylene; EREBP; GCC box; G-box; CHN; ERE; ERF; xylanase; TvX; OBF; bZIP; EBP; pathogen; ocs; leaf; shoot; Pti4/5/6; ubiquitin; UBC2;,tobacco (Nicotiana tabacum); Arabidopsis thaliana;,"Koyama T, Okada T, Kitajima S, Ohme-Takagi M, Shinshi H, Sato F. Isolation of tobacco ubiquitin-conjugating enzyme cDNA in a yeast two-hybrid system with tobacco ERF3 as bait and its characterization of specific interaction. J Exp Bot. 54: 1175-1181 (2003) PubMed: 12654868; Gu YQ, Wildermuth MC, Chakravarthy S, Loh YT, Yang C, He X, Han Y, Martin GB Tomato transcription factors pti4, pti5, and pti6 activate defense responses when expressed in Arabidopsis Plant Cell 14: 817-831 (2002) PubMed: 11971137; Yamamoto S, Suzuki K, Shinshi H Elicitor-responsive, ethylene-independent activation of GCC box-mediated transcription that is regulated by both protein phosphorylation and dephosphorylaton in cultured tobacco cells Plant J 20: 571-579 (1999) PubMed: 10652129; Ohta M, Ohme-Takagi M, Shinshi H Three ethylene-responsive transcription factors in tobacco with distinct transactivation functions Plant J 22:29-38 (2000) PubMed: 10792818; Ohme-Takagi M, Shinshi H Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element Plant Cell 7: 173-182 (1995) PubMed: 7756828; Buttner M, Singh KB Arabidopsis thaliana ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an ocs element binding protein Proc Natl Acad Sci USA 94: 5961-5966 (1997) PubMed: 9159183; GenBank: Y09942; Ohme-Takagi M, Suzuki K, Shinshi H Regulation of Ethylene-Induced Transcription of Defense Genes Plant Cell Physiol 41: 1187-1192 (2000) PubMed: 11092902;"
CONSERVED11NTZMATP1,7,1.311186171,1.13E-11,7.84E-10,gxe.halup.fildown,ACGTATTAAAA,S000301,Conserved 11 nt sequence found in the maize (Z.m.) mitochondrial atp1 promoter; Located between -5 and +6; Essential for the expression;,mitochondria; atp1;,maize (Zea mays),"Rapp WD, Stern DB A conserved 11 nucleotide sequence contains an essential promoter element of the maize mitochondrial atp1 gene EMBO J 11: 1065-1073 (1992) PubMed: 1372246"
HDZIPIIIAT,6,1.456694318,1.13E-11,7.84E-10,gxe.halup.fildown,GTAATSATTAC,S000475,"Ath b-9 HD-Zip (HD-Zip-9), a member of a small family of HD-Zip proteins (HD-ZIP III), in Arabidopsis recognize this sequence; See also S000371; S=G/C;",Homeobox; HD-ZIP;,Arabidopsis thaliana,"Sessa G, Steindler C, Morelli G, Ruberti I. The Arabidopsis Athb-8, -9 and -14 genes are members of a small gene family coding for highly related HD-ZIP proteins. Plant Mol Biol. 38: 609-622.(1998) PubMed: 9747806 Ohashi-Ito K, Kubo M, Demura T, Fukuda H. Class III Homeodomain Leucine-Zipper Proteins Regulate Xylem Cell Differentiation. Plant Cell Physiol. 46: 1646-1656 (2005) PubMed: 16081527"
SE2PVGRP1,8,4.386463995,8.43E-09,5.11E-07,gxe.halup.fildown,TTNNNGTAGCTAGTGTATTTGTAT,S000101,"""SE2 (stem element 2)"" of bean (P.v.) GRP1.8 gene; part of SE2 element;",stem; SE2; GRP; GRP1;,bean (Phaseolus vulgaris),"Elmayan T, Tepfer M. Evaluation in tobacco of the organ specificity and strength of the rolD promoter, domain A of the 35S promoter and the 35S2 promoter. Transgenic Res 4:388-396 (1995) PubMed: 7581519;"
TATABOX5,9,2.268307246,2.24E-07,1.20E-05,gxe.halup.fildown,TTATTT,S000203,"""TATA box""; TATA box found in the 5'upstream region of pea (Pisum sativum) glutamine synthetase gene; a functional TATA element by in vivo analysis;",TATA; glutamine; synthetase;,pea (Pisum sativum);,"Tjaden G, Edwards JW, Coruzzi GM cis elements and trans-acting factors affecting regulation of a nonphotosynthetic light-regulated gene for chloroplast glutamine synthetase Plant Physiol 108:1109-1117 (1995) PubMed: 7630938; GenBank: U22971;"
POLASIG1,10,2.273239915,2.57E-07,1.25E-05,gxe.halup.fildown,AATAAA,S000080,"""PolyA signal""; poly A signal found in legA gene of pea, rice alpha-amylase; -10 to -30 in the case of animal genes. Near upstream elements (NUE) in Arabidopsis (Loke et al. 2005);",poly A signal; NUE; FUE;,pea (Pisum sativum); rice (Oryza sativa); Arabidopsis thaliana;,"Heidecker G, Messing J Structural analysis of plant genes. Ann Rev Plant Physiol 37:439-466 (1986) Joshi CP Putative polyadenylation signals in nuclear genes of higher plants: a compilation and analysis. Nucleic Acids Res 15:9627-9640 (1987) PubMed: 3697078; O'Neill SD, Kumagai MH, Majumdar A, Huang N, Sutliff TD, Rodriguez RL The alpha-amylase genes in Oryza sativa: Characterization of cDNA clones and mRNA expression during seed germination. Mol Gen Genet 221:235-244 (1990) PubMed: 2370848; GenBank: M24286, M24287; Loke JC, Stahlberg EA, Strenski DG, Haas BJ, Wood PC, Li QQ. Compilation of mRNA polyadenylation signals in Arabidopsis revealed a new signal element and potential secondary structures. Plant Physiol. 138: 1457-1468. (2005) PubMed: 15965016"
GT1CONSENSUS,11,1.422114257,1.98E-06,8.74E-05,gxe.halup.fildown,GRWAAW,S000198,"Consensus GT-1 binding site in many light-regulated genes, e.g., RBCS from many species, PHYA from oat and rice, spinach RCA and PETA, and bean CHS15; R=A/G; W=A/T; For a compilation of related GT elements and factors, see Villain et al. (1996); GT-1 can stabilize the TFIIA-TBP-DNA (TATA box) complex; The activation mechanism of GT-1 may be achieved through direct interaction between TFIIA and GT-1; Binding of GT-1-like factors to the PR-1a promoter influences the level of SA-inducible gene expression;",GT-1; light; TATA; TFIIA; TBP; HR; SAR; TMV; leaf; shoot;,pea (Pisum sativum); oat (Avena sativa); rice (Oryza sativa); tobacco (Nicotiana tabacum); Arabidopsis thaliana; spinach (Spinacia oleracea); bean;,"Terzaghi WB, Cashmore AR Light-regulated transcription Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) Villain P, Mache R, Zhou DX The mechanism of GT element-mediated cell type-specific transcriptional control J Biol Chem 271:32593-32598 (1996) PubMed: 8955086; Le Gourrierec J, Li YF, Zhou DX Transcriptional activation by Arabidopsis GT-1 may be through interaction with TFIIA-TBP-TATA complex Plant J 18:663-668 (1999) PubMed: 10417717 Buchel AS, Brederode FT, Bol JF, Linthorst HJM Mutation of GT-1 binding sites in the Pr-1A promoter influences the level of inducible gene expression in vivo Plant Mol Biol 40:387-396 (1999) PubMed: 10437823; Zhou DX Regulatory mechanism of plant gene transcription by GT-elements and GT-factors Trends in Plant Science  4:210-214 (1999) PubMed: 10366876"
GT1GMSCAM4,12,2.765060981,2.78E-06,0.000112436,gxe.halup.fildown,GAAAAA,S000453,"""GT-1 motif"" found in the promoter of soybean (Glycine max) CaM isoform, SCaM-4; Plays a role in pathogen- and salt-induced SCaM-4 gene expression; See also S000198 (GT-1 consensus);",GT-1 box;,Glycine max (soybean),"Park HC, Kim ML, Kang YH, Jeon JM, Yoo JH, Kim MC, Park CY, Jeong JC, Moon BC, Lee JH, Yoon HW, Lee SH, Chung WS, Lim CO, Lee SY, Hong JC, Cho MJ. Pathogen- and NaCl-induced expression of the SCaM-4 promoter is mediated in part by a GT-1 box that interacts with a GT-1-like transcription factor. Plant Physiol. 135: 2150-2161 (2004). PubMed: 15310827"
LECPLEACS2,13,3.627698535,9.72E-06,0.000362622,gxe.halup.fildown,TAAAATAT,S000465,Core element in LeCp (tomato Cys protease) binding cis-element (from -715 to -675) in LeAcs2 gene;,cysteine protease; ethylene; xylanase; ACS;,Lycopersicon esculentum (tomato),"Matarasso N, Schuster S, Avni A. A novel plant cysteine protease has a dual function as a regulator of 1-aminocyclopropane-1-carboxylic Acid synthase gene expression. Plant Cell. 17: 1205-1216. (2005) PubMed: 15749766"
MARTBOX,14,12.92119289,2.54E-05,0.000879522,gxe.halup.fildown,TTWTWTTWTT,S000067,"""T-Box""; Motif found in SAR (scaffold attachment region; or matrix attachment region, MAR);",MAR; SAR; T-box; scaffold; matrix;,Drosophila; fly;,"Gasser SM, Amati BB, Cardenas ME, Hofmann JFX Studies on scaffold attachment sites and their relation to genome function. Intnatl Rev Cyto 119:57-96 (1989) PubMed: 2695485;"
SREATMSD,15,0.88990384,3.05E-05,0.000987249,gxe.halup.fildown,TTATCC,S000470,"""sugar-repressive element (SRE)"" found in 272 of the 1592 down-regulated genes after main stem decapitation in Arabidopsis; See also S000471, S000472;",Axillary bud outgrowth;,Arabidopsis thaliana,"Tatematsu K, Ward S, Leyser O, Kamiya Y, Nambara E. Identification of cis-elements that regulate gene expression during initiation of axillary bud outgrowth in Arabidopsis. Plant Physiology 138: 757-766 (2005) PubMed: 15908603"
TATCCAYMOTIFOSRAMY3D,16,1.040487645,4.04E-05,0.001225535,gxe.halup.fildown,TATCCAY,S000256,"""TATCCAY motif"" found in rice (O.s.) RAmy3D alpha-amylase gene promoter; Y=T/C; a GATA motif as its antisense sequence; TATCCAY motif and G motif (see S000130) are responsible for sugar repression (Toyofuku et al. 1998);",GATA; amylase; sugar; repression;,rice (Oryza sativa),"Toyofuku K, Umemura T, Yamaguchi J Promoter elements required for sugar-repression of the RAmy3D gene for alpha-amylase in rice FEBS Lett  428:275-280 (1998) PubMed: 9654148; Rubio-Somoza I, Martinez M, Abraham Z, Diaz I, Carbonero P. Ternary complex formation between HvMYBS3 and other factors involved in transcriptional control in barley seeds. Plant J. 47: 269-281 (2006) PubMed: 16762033"
YAB1,17,2.02340921,0.000110011,0.003138555,gxe.halup.fildown,NA,NA,NA,NA,NA,NA
DOFCOREZM,18,1.275830395,0.000147181,0.003965699,gxe.halup.fildown,AAAG,S000265,"Core site required for binding of Dof proteins in maize (Z.m.); Dof proteins are DNA binding proteins, with presumably only one zinc finger, and are unique to plants; Four cDNAs encoding Dof proteins, Dof1, Dof2, Dof3 and PBF, have been isolated from maize; PBF is an endosperm specific Dof protein that binds to prolamin box; Maize Dof1 enhances transcription from the promoters of both cytosolic orthophosphate kinase (CyPPDK) and a non-photosynthetic PEPC gene; Maize Dof2 supressed the C4PEPC promoter;",Dof; C4PEPC; CyPPDK; PEPC; C4; leaf; shoot;,maize (Zea mays),"Yanagisawa S, Schmidt RJ Diversity and similarity among recognition sequences of Dof transcription factors Plant J  17:209-214 (1999) PubMed: 10074718; Yanagisawa S Dof1 and Dof2 transcription factors are associated with expression of multiple genes involved in carbon metabolism in maize Plant J 21:281-288 (2000) PubMed: 10758479;"
POLASIG3,19,1.646809388,0.000173921,0.004439554,gxe.halup.fildown,AATAAT,S000088,"""Plant polyA signal""; Consensus sequence for plant polyadenylation signal;",poly A; polyadenylation;,maize (Zea mays),"Heidecker G, Messing J Structural analysis of plant genes. Ann Rev Plant Physiol 37:439-466 (1986) Joshi CP Putative polyadenylation signals in nuclear genes of higher plants: a compilation and analysis. Nucleic Acids Res 15:9627-9640 (1987) PubMed: 3697078;"
CARGCW8GAT,20,1.621232453,0.000211337,0.005124914,gxe.halup.fildown,CWWWWWWWWG,S000431,"A variant of CArG motif (see S000404), with a longer A/T-rich core; Binding site for AGL15 (AGAMOUS-like 15); W=A/T;",CArG; AGL15; AGAMOUS; MADS;,Arabidopsis thaliana,"Tang W, Perry SE. Binding site selection for the plant MADS domain protein AGL15: an in vitro and in vivo study. J Biol Chem.278:28154-28159 (2003) PubMed: 12743119; Folter S, Angenent GC. trans meets cis in MADS science. Trends Plant Sci. 11:224-231 (2006) PubMed: 16616581"
TATABOXOSPAL,21,1.681854566,0.000463317,0.010700414,gxe.halup.fildown,TATTTAA,S000400,"Binding site for OsTBP2, found in the promoter of rice pal gene encoding phenylalanine ammonia-lyase; OsTFIIB stimulated the DNA binding and bending activities of OsTBP2 and synergistically enhanced OsTBP2-mediated transcription from the pal promoter;",TBP; TFIIB; pal; DNA binding and bending;,Oryza sativa (rice),"Zhu Q, Ordiz MI, Dabi T, Beachy RN, Lamb C Rice TATA binding protein interacts functionally with transcription factor IIB and the RF2a bZIP transcriptional activator in an enhanced plant in vitro transcription system Plant Cell 14: 795-803 (2002) PubMed: 11971135;"
TGTCACACMCUCUMISIN,22,1.101879502,0.000554583,0.012226038,gxe.halup.fildown,TGTCACA,S000422,"""TGTCACA motif"" found in the region (from -254 to -215) of cucumisin (a subtilisin-like serine protease) in the fruit of melon (Cucumis melo L.); A novel enhancer element necessary for fruit-specific expression of the cucumisin gene;",cucumisin; fruit;,Cucumis melo L. (melon),"Yamagata H, Yonesu K, Hirata A, Aizono Y. TGTCACA motif is a novel cis-regulatory enhancer element involved in fruit-specific expression of the cucumisin gene. J Biol Chem. 277:11582-11590 (2002) PubMed: 11782472;"
ROOTMOTIFTAPOX1,23,1.411227023,0.00093753,0.019769653,gxe.halup.fildown,ATATT,S000098,Motif found both in promoters of rolD;,root; rolD;,Agrobacterium rhizogenes;,"Elmayan T, Tepfer M Evaluation in tobacco of the organ specificity and strength of the rol D promoter, domain A of the 35S promoter and the 35S^2 promoter Transgenic Res 4:388-396 (1995) PubMed: 7581519;"
TATABOX2,24,1.992351603,0.000992676,0.020060331,gxe.halup.fildown,TATAAAT,S000109,"""TATA box""; TATA box found in the 5'upstream region of pea legA gene; sporamin A of sweet potato; TATA box found in beta-phaseolin promoter (Grace et al.); sequence and spacing of TATA box elements are critical for accurate initiation (Grace et al.);",TATA; legA; phaseolin;,pea (Pisum sativum); tobacco (Nicotiana tabacum); bean (Phaseolus vulgaris);,"Shirsat A, Wilford N, Croy R, Boulter D Sequences responsible for the tissue specific promoter activity of a pea legumin gene in tobacco. Mol Gen Genet 215:326-331 (1989) PubMed: 2710102; Grace ML, Chandrasekharan MB, Hall TC, Crowe AJ. Sequence and spacing of TATA box elements are critical for accurate initiation from the beta-phaseolin promoter. J Biol Chem. 279:8102-8110 (2004). PubMed: 14660650"
CPBCSPOR,25,0.913650308,0.001186122,0.023010774,gxe.halup.fildown,TATTAG,S000491,"The sequence critical for Cytokinin-enhanced Protein Binding in vitro, found in -490 to -340 of the promoter of the cucumber (CS) POR (NADPH-protochlorophyllide reductase) gene;",cytokinin; chlorophyll; chloroplast;,Cucumis sativus L. (cucumber),"Fusada N, Masuda T, Kuroda H, Shimada H, Ohta H, Takamiya K. Identification of a Novel Cis-Element Exhibiting Cytokinin-Dependent Protein Binding in Vitro in the 5'-region of NADPH-Protochlorophyllide Oxidoreductase Gene in Cucumber. Plant Mol Biol. 59: 631-645 (2005). PubMed: 16244912"
AMYBOX2,26,1.252422416,0.00134598,0.02510771,gxe.halup.fildown,TATCCAT,S000021,"""amylase box""; ""amylase element""; Conserved sequence found in 5'upstream region of alpha-amylase gene of rice, wheat, barley; ""amylase box"" (Huang et al. 1990); ""amylase element"" (Hwang et al., 1998);",amylase; seed;,barley (Hordeum vulgare); rice (Oryza sativa); wheat (Triticum aestivum),"Huang N, Sutliff TD, Litts JC, Rodriguez RL Classification and characterization of the rice alpha-amylase multigene family. Plant Mol Biol 14:655-668 (1990) PubMed: 2102847; GenBank: X16509; Hwang YS, Karrer EE, Thomas BR, Chen L, Rodriguez RL Three cis-elements required for rice alpha-amylase Amy3D expression during sugar starvation Plant Mol Biol 36:331-341 (1998) PubMed: 9484474;"
NTBBF1ARROLB,27,0.909819527,0.001758324,0.0315847,gxe.halup.fildown,ACTTTA,S000273,NtBBF1(Dof protein from tobacco) binding site in Agrobacterium rhizogenes (A.r.) rolB gene; Found in regulatory domain B (-341 to -306); Required for tissue-specific expression and auxin induction;,rolB; Dof; auxin; domain B; root; shoot; meristem; vascular;,Agrobacterium rhizogenes,"Baumann K, De Paolis A, Costantino P, Gualberti G The DNA binding site of the Dof protein NtBBF1 is essential for tissue-specific and auxin-regulated expression of the rolB oncogene in plants Plant Cell 11:323-333 (1999) PubMed: 10072394;  GenBank: AJ009594;"
IBOXCORE,28,0.923460543,0.001879336,0.032552778,gxe.halup.fildown,GATAA,S000199,"""I box""; ""I-box""; Conserved sequence upstream of light-regulated genes; Conserved sequence upstream of light-regulated genes of both monocots and dicots; See IBOX (S000124);",I box; I-box; rbcS; light regulation; light; leaf; shoot;,,"Terzaghi WB, Cashmore AR Light-regulated transcription Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995)"
RVE1-2,29,1.844874329,0.002233591,0.037354888,gxe.halup.fildown,NA,NA,NA,NA,NA,NA
POLASIG2,30,2.149827303,0.002562968,0.041434643,gxe.halup.fildown,AATTAAA,S000081,"""PolyA signal""; poly A signal found in rice alpha-amylase; -10 to -30 in the case of animal genes. AATAAA; AATAAT; AATTAAA; AATAAG;",poly A signal;,rice (Oryza sativa); animal;,"O'Neill SD, Kumagai MH, Majumdar A, Huand N, Sutliff TD, Rodriguez RL The alpha-amylase genes in Oryza sativa: Characterization of cDNA clones and mRNA expression during seed germination. Mol Gen Genet 221:235-244 (1990) PubMed: 2370848; GenBank: M24286, M24287;"
SEF1MOTIF,31,3.521332391,0.002663141,0.041665278,gxe.halup.fildown,ATATTTAWW,S000006,"""SEF1 (soybean embryo factor 1)"" binding motif; sequence found in 5'-upstream region (-640; -765) of soybean beta-conglicinin (7S globulin) gene; W=A/T;",SOYBEAN; STORAGE PROTEIN; 7S; GLOBULIN; BETA-CONGLICININ; seed;,soybean (Glycine max),"Allen RD, Bernier F, Lessard PA, Beachy RN Nuclear factors interact with a soybean beta-conglycinin enhancer. Plant Cell 1:623-631 (1989) PubMed: 2535514; Lessard PA, Allen RD, Bernier F, Crispino JD, Fujiwara T, Beachy RN Multiple nuclear factors interact with upstream sequences of differentially regulated beta-conglycinin genes. Plant Mol Biol 16:397-413 (1991) PubMed: 1893110;"
MARARS,32,6.829411227,0.002861969,0.042007007,gxe.halup.fildown,WTTTATRTTTW,S000064,"""ARS element""; Motif found in SAR (MAR);",MAR; SAR; ARS;,yeast,"Gasser SM, Amati BB, Cardenas ME, Hofmann JFX Studies on scaffold attachment sites and their relation to genome function. Intnatl Rev Cyto  119:57-96 (1989) PubMed: 2695485;"
SEF4MOTIFGM7S,33,1.860170025,0.002925067,0.042007007,gxe.halup.fildown,RTTTTTR,S000103,"""SEF4 binding site""; Soybean (G.m.) consensus sequence found in 5'upstream region (-199) of beta-conglycinin (7S globulin) gene (Gmg17.1); ""Binding with SEF4 (soybean embryo factor 4)""; R=A/G;",soybean; seed; storage protein; 7S; globulin; beta-conglycinin; SEF;,soybean (Glycine max);,"Allen RD, Bernier F, Lessard PA, Beachy RN Nuclear factors interact with a soybean beta-conglycinin enhancer. Plant Cell 1:623-631 (1989) PubMed: 2535514; Lessard PA, Allen RD, Bernier F, Crispino JD, Fujiwara T, Beachy RN Multiple nuclear factors interact with upstream sequences of differentially regulated beta-conglycinin genes. Plant Mol Biol 16:397-413 (1991) PubMed: 1893110;"
TATCCACHVAL21,34,0.828552873,0.002944821,0.042007007,gxe.halup.fildown,TATCCAC,S000416,"""TATCCAC box"" is a part of the conserved cis-acting response complex (GARC) that most often contain three sequence motifs, the TAACAAA box (see S000181), or GA-responsive element (GARE); the pyrimidine box, CCTTTT (see S000259); and the TATCCAC box, which are necessary for a full GA response;",gibberellin; GA; GARC;,barley (Hordeum vulgare),"Isabel-LaMoneda I, Diaz I, Martinez M, Mena M, Carbonero P. SAD: a new DOF protein from barley that activates transcription of a cathepsin B-like thiol protease gene in the aleurone of germinating seeds. Plant J. 33: 329-340 (2003) PubMed: 12535346; Martinez M, Rubio-Somoza I, Fuentes R, Lara P, Carbonero P, Diaz I. The barley cystatin gene (Icy) is regulated by DOF transcription factors in aleurone cells upon germination. J Exp Bot. 56: 547-556 (2005) PubMed: 15611149"
ATHB6COREAT,35,1.808635425,0.003347381,0.046385141,gxe.halup.fildown,CAATTATTA,S000399,"Consensus binding sequence for Arabidopsis (A.T.) homeodomain-leucine zipper protein, ATHB6; ATHB6 is a target of the protein phosphatase ABI1 and regulates hormone responses; See S000371;",ATHB6; ABA; ABI1; homeodomain-leucine zipper;,Arabidopsis thaliana,"Himmelbach A, Hoffmann T, Leube M, Hohener B, Grill E Homeodomain protein ATHB6 is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis EMBO J. 21:3029-3038 (2002) PubMed: 12065416;"
BIHD1OS,36,0.97333787,0.003501629,0.047174719,gxe.halup.fildown,TGTCA,S000498,"Binding site of OsBIHD1, a rice BELL homeodomain transcription factor;",HD; homeodomain;,Oryza sativa (rice),"Luo H, Song F, Goodman RM, Zheng Z. Up-regulation of OsBIHD1, a rice gene encoding BELL homeodomain transcriptional factor, in disease resistance responses. Plant Biol (Stuttg). 7: 459-468 (2005). PubMed: 16163610"
MYBST1,37,0.816074612,0.003629473,0.047575521,gxe.halup.fildown,GGATA,S000180,Core motif of MybSt1 (a potato MYB homolog) binding site; MybSt1 cDNA clone was isolated by using CaMV 35S promoter domain A as a probe (Baranowskij et al. 1994); The Myb motif of the MybSt1 protein is distinct from the plant Myb DNA binding domain described so far;,MYB; myb; Myb;,potato (Solanum tuberosum);,"Baranowskij N, Frohberg C, Prat S, Willmitzer L A novel DNA binding protein with homology to Myb oncoproteins containing only one repeat can function as a transcriptional activator EMBO J 13:5383-5392 (1994) PubMed: 7957104;"
GARE4HVEPB1,38,0.638074381,0.003795016,0.048436393,gxe.halup.fildown,GTAACAGAATGCTGG,S000297,"""GARE-4"" found in the barley (H.v.) EPB-1 (cysteine proteinase) gene promoter; Located between -142 to -156; Required for GA induction; Putative binding site of transcription factor, GAMyB; See S000298;",EPB; cysteine proteinase; GA; ABA; GARE; pyrimidine box; seed; aleurone;,barley (Hordeum vulgare),"Cercos M, Gomez-Cadenas A, Ho THD Hormonal regulation of a cysteine proteinase gene, EPB-1, in barley aleurone layers: cis- and trans-acting elements involved in the co-ordinated gene expression regulated by gibberellins and abscisic acid Plant J 19: 107-118  (1999) PubMed: 10476058"
ANAEROBICCISZMGAPC4,1,126.3086456,5.95E-30,2.89E-27,gxe.haldown.filup,CGAAACCAGCAACGGTCCAG,S000350,20 bp anaerobic cis-regulatory sequence found in the maize (Z.m.) GapC4 (Glyceraldehyde-3-phosphate dehydrogenase 4) gene promoter; Located between -286 and -266; Required for anaerobic gene expression in transgenic tobacco; See S000351;,anaerobic; GapC4; Glyceraldehyde-3-phosphate dehydrogenase;,maize (Zea mays),"Geffers R, Cerff R, Hehl R Anaerobiosis-specific interaction of tobacco nuclear factors with cis-regulatory sequences in the maize GapC4 promoter Plant Mol Biol 43: 11-21 (2000) PubMed: 10949370;"
RSEPVGRP1,2,8.353748576,1.03E-18,2.49E-16,gxe.haldown.filup,CAACTTTCATAT,S000099,"""RSE (root-specific element)"" of bean (P.v.) GRP1.8 gene; consensus sequence;See also S000288 and S000289;",root; GRP1.8;,bean (Phaseolus vulgaris),"Elmayan T, Tepfer M Evaluation in tobacco of the organ specificity and strength of the rol D promoter, domain A of the 35S promoter and the 35S^2 promoter. Transgenic Res 4:388-396 (1995) PubMed: 7581519;"
GLUTEBOX2OSGT2,3,1.911909432,1.97E-13,3.18E-11,gxe.haldown.filup,TCCGTGTACCA,S000047,"""Box II"" of rice (O.s.) glutelin Gt2 gene family; nuclear factor binding site;",glutelin; Box II; Gt2; seed; endosperm;,rice (Oryza sativa),"Kim SY, Wu R Multiple protein factors bind to a rice glutelin promoter region. Nucleic Acids Res 18:6845-6852 (1990) PubMed: 2263449; GenBank: X52153;"
GLUTAACAOS,4,4.550065826,3.31E-12,4.02E-10,gxe.haldown.filup,AACAAACTCTAT,S000045,"""glutelin common motif""; ""AACA motif""; Conserved in all member of rice (0.s.) glutelin; -74 to -64;",AACA; glutelin; seed; endosperm;,rice (Oryza sativa),"Takaiwa F, Oono K Interaction of an immature seed-specific trans-acting factor with the 5' upstream region of a rice glutelin gene. Mol Gen Genet 224:289-293 (1990) PubMed: 2277646;"
CONSERVED11NTZMATP1,5,1.437862687,4.87E-12,4.73E-10,gxe.haldown.filup,ACGTATTAAAA,S000301,Conserved 11 nt sequence found in the maize (Z.m.) mitochondrial atp1 promoter; Located between -5 and +6; Essential for the expression;,mitochondria; atp1;,maize (Zea mays),"Rapp WD, Stern DB A conserved 11 nucleotide sequence contains an essential promoter element of the maize mitochondrial atp1 gene EMBO J 11: 1065-1073 (1992) PubMed: 1372246"
ABADESI2,6,3.330740037,4.54E-11,3.67E-09,gxe.haldown.filup,GGACGCGTGGC,S000008,"Synthetic element (hex-3) related to response to ABA and to desiccation; seed expression; Gene: synthetic; hex-3, mutant of hex-1 sequence from wheat histone H3 promoter; transacting factor: bZIP ?;",ABA; SEED; bZIP; hex-1; hex-3; histone;,rice (Oryza sativa); wheat (Triticum aestivum),"Lam E, Chua N-H Tetramer of a 21-base pair synthetic element confers seed expression and  transcriptional enhancement in response to water stress and abscisic acid. J Biol Chem 266:17131-17135 (1991) PubMed: 1832669; Thomas TL Gene expression during plant embryogenesis and germination: An overview. Plant Cell 5:1401-1410 (1993) PubMed: 8281041; Busk PK, Pages M Regulation of abscisic acid-induced transcription Plant Mol Biol 37:425-435 (1998) PubMed: 9617810"
OCETYPEIIINTHISTONE,7,32.10144151,1.17E-10,8.10E-09,gxe.haldown.filup,GATCCGCGNNNNNNNNNNNNNNACCAATCS,S000269,"""Type III element""; Oct-containing composite element Type III found in tobacco (N.t.) histone gene promoter; Oct (octomer) motif is paired with CCAAT-box to form Type III element; Required for S-phase specific and meristematic tissue-specific expression;",histone; Oct; OCE; CCAAT-box; Type III; S-phase; meristem;,tobacco (Nicotiana tabacum),"Taoka K, Kaya H, Nakayama T, Araki T, Meshi T, Iwabuchi M Identification of three Kinds of mutually related composite elements conferring S phase-specific transcriptional activation Plant J 18:611-623 (1999) PubMed: 10417712;"
LREBOX3PSRBCS3,8,4.067373194,4.59E-10,2.78E-08,gxe.haldown.filup,ACTATTTTCACTATC,S000062,"""LRE (light-responsive element) Box III"" of pea (P.s.) rbcS-3A gene; GT-1 binding;  For a compilation of related GT elements and factors, see Villain et al. (1996);",light; rbcS; GT-1; leaf; shoot;,pea (Pisum sativum),"Green PJ, Kay SA, Chua N-H Sequence-specific interactions of a pea nuclear factor with light-responsive elements upstream of the rbcS-3A gene. EMBO J 6:2543-2549 (1987) PubMed: 3678200; Villain P, Mache R, Zhou DX The mechanism of GT element-mediated cell type-specific transcriptional control J Biol Chem 271:32593-32598 (1996) PubMed: 8955086;"
HDZIPIIIAT,9,1.360271762,6.89E-10,3.71E-08,gxe.haldown.filup,GTAATSATTAC,S000475,"Ath b-9 HD-Zip (HD-Zip-9), a member of a small family of HD-Zip proteins (HD-ZIP III), in Arabidopsis recognize this sequence; See also S000371; S=G/C;",Homeobox; HD-ZIP;,Arabidopsis thaliana,"Sessa G, Steindler C, Morelli G, Ruberti I. The Arabidopsis Athb-8, -9 and -14 genes are members of a small gene family coding for highly related HD-ZIP proteins. Plant Mol Biol. 38: 609-622.(1998) PubMed: 9747806 Ohashi-Ito K, Kubo M, Demura T, Fukuda H. Class III Homeodomain Leucine-Zipper Proteins Regulate Xylem Cell Differentiation. Plant Cell Physiol. 46: 1646-1656 (2005) PubMed: 16081527"
PROLAMINBOX,10,5.196297305,1.37E-09,6.64E-08,gxe.haldown.filup,CACATGTGTAAAGGT,S000091,"""Prolamin Box""; -330 consensus sequence found in all zein genes; prolamin type consensus sequence found in the 5'upstream regions of seed storage proteins of maize (22 kDa zein); similar sequence found in 19 kDa zein, B-hordein (barley), gamma-gliadin (wheat), high M.W. glutenin (wheat); ESBF-1 enhanced transcriptional activation mediated by SPA (the endosperm-specific wheat bZIP factor);",prolamin-box; zein; hordein; gliadin; glutenin; SPA; bZIP; EB; ESBF-1; endosperm; WPBF; DOF; seed;,rice (Oryza sativa); maize (Zea mays); barley (Hordeum vulgare); wheat (Triticum aestivum);,"Brown JWS, Wandelt C, Feix G The upstream regions of zein genes: sequence analysis and expression in the unicellular green alga Acetabularia. Eur J Cell Biol 42:161-170 (1986) Maier U-G, Brown JWS, Toloczyki C, Feix G Binding of a nuclear factor to a consensus sequence in the 5' flanking region of zein genes from maize. EMBO J 6:17-22 (1987) Schmidt RJ, Ketudat M, Aukerman MJ, Hoschek G Opaque-2 is a transcriptional activator that recognizes a specific target site in 22-kD zein genes. Plant Cell 4:689-700 (1992) PubMed: 1392590; GenBank: M86591; Conlan RS, Hammond-Kosack M, Bevan M Transcription activation mediated by the bZIP factor SPA on the endosperm box is modulated by ESBF-1 in vitro Plant J 19:173-181 (1999) PubMed: 10476064;"
PE1ASPHYA3,11,14.36127627,3.06E-08,1.35E-06,gxe.haldown.filup,GAAATAGCAAATGTTAAAAATA,S000196,"PE1; Positively acting element found at -381 to -348 of oat (A.s.) phyA3 promoter; A general positive element (Terzaghi & Cashmore, 1995);",phytochrome; phy; phyA; phyA3; leaf; shoot;,oat (Avena sativa);,"Bruce WB, Quail PH cis-Acting elements involved in photoregulation of an oat phytochrome promoter in rice Plant Cell 2:1081-1089 (1990) PubMed: 2152109; Bruce WB, Deng X-W, Quial PH A negatively acting DNA sequence element mediates phytochrome-directed repression of phyA gene transcription. EMBO J 10:3015-3024 (1991) PubMed: 1915276; Terzaghi WB, Cashmore AR Light-regulated transcription Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995)"
ACGTABREMOTIFA2OSEM,12,1.223677727,2.87E-06,0.000115931,gxe.haldown.filup,ACGTGKC,S000394,"Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis;  K=G/T;",ABA; ABRE; motif A; DRE;,rice (Oryza sativa); Arabidopsis thaliana;,"Hattori T, Totsuka M, Hobo T, Kagaya Y, Yamamoto-Toyoda A Experimentally Determined Sequence Requirement of ACGT-Containing Abscisic Acid Response Element Plant Cell Physiol 43: 136-140 (2002) PubMed: 11828032; Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, Narusaka M, Shinozaki K, Yamaguchi-Shinozaki K. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590;"
MYC2-4,13,1.237630095,6.25E-06,0.00023335,gxe.haldown.filup,NA,NA,NA,NA,NA,NA
ABRELATERD1,14,0.909845831,1.32E-05,0.000455819,gxe.haldown.filup,ACGTG,S000414,ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;,ABRE; etiolation; erd;,Arabidopsis thaliana,"Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K. Two different novel cis-acting elements of erd1, a clpA homologous Arabidopsis gene function in induction by dehydration stress and dark-induced senescence. Plant J. 33: 259-270 (2003) PubMed: 12535340; Nakashima K, Fujita Y, Katsura K, Maruyama K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K. Transcriptional regulation of ABI3- and ABA-responsive genes including RD29B and RD29A in seeds, germinating embryos, and seedlings of Arabidopsis. Plant Mol Biol. 60:51-68 (2006). PubMed: 16463099"
SITEIIATCYTC,15,1.607051759,1.53E-05,0.000495077,gxe.haldown.filup,TGGGCY,S000474,"""Site II element"" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);)",cytochrome; TCP-domain; meristem; oxidative phosphorylation;,Arabidopsis thaliana; Oryza sativa (rice);,"Welchen E, Gonzalez DH. Differential expression of the Arabidopsis cytochrome c genes Cytc-1 and Cytc-2. Evidence for the involvement of TCP-domain protein-binding elements in anther- and meristem-specific expression of the Cytc-1 gene. Plant Physiol.139: 88-100 (2005) PubMed: 16113211 Welchen E, Gonzalez DH. Overrepresentation of Elements Recognized by TCP-Domain Transcription Factors in the Upstream Regions of Nuclear Genes Encoding Components of the Mitochondrial Oxidative Phosphorylation Machinery. Plant Physiol. 141:540-545 (2006) PubMed: 16760496"
RHERPATEXPA7,16,0.912293823,2.69E-05,0.000814474,gxe.haldown.filup,KCACGW,S000512,"""Right part of RHEs (Root Hair-specific cis-Elements)"" conserved among the Arabidopsis thaliana A7 (AtEXPA7) orthologous (and paralogous) genes from diverse angiosperm species with different hair distribution patterns; K=G/T; W=T/A;",root; hair;,Arabidopsis thaliana,"Kim DW, Lee SH, Choi SB, Won SK, Heo YK, Cho M, Park YI, Cho HT. Functional Conservation of a Root Hair Cell-Specific cis-Element in Angiosperms with Different Root Hair Distribution Patterns. Plant Cell. 18:2958-2970 (2006) PubMed: 17098810"
ACGTATERD1,17,0.668701974,3.43E-05,0.000979228,gxe.haldown.filup,ACGT,S000415,ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;,ACGT; etiolation; erd;,Arabidopsis thaliana,"Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K. Two different novel cis-acting elements of erd1, a clpA homologous Arabidopsis gene function in induction by dehydration stress and dark-induced senescence. Plant J. 33: 259-270 (2003) PubMed: 12535340;"
ABRERATCAL,18,1.04585418,7.01E-05,0.001888809,gxe.haldown.filup,MACGYGB,S000507,"""ABRE-related sequence"" or ""Repeated sequence motifs"" identified in the upstream regions of 162 Ca(2+)-responsive upregulated genes; see also ABRE; M=C/A; Y=T/C; B=T/C/G;",ABRE; calcium;,Arabidopsis thaliana,"Kaplan B, Davydov O, Knight H, Galon Y, Knight MR, Fluhr R, Fromm H. Rapid Transcriptome Changes Induced by Cytosolic Ca2+ Transients Reveal ABRE-Related Sequences as Ca2+-Responsive cis Elements in Arabidopsis. Plant Cell. 18:2733-2748 (2006) PubMed: 16980540"
SORLIP2AT,19,1.451006015,9.20E-05,0.002347845,gxe.haldown.filup,GGGCC,S000483,"one of ""Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);",phyA; phytochrome; light;,Arabidopsis thaliana,"Hudson ME, Quail PH. Identification of promoter motifs involved in the network of phytochrome A-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiol. 133: 1605-1616 (2003) PubMed: 14681527"
GADOWNAT,20,0.937131509,0.000105907,0.002568243,gxe.haldown.filup,ACGTGTC,S000438,Sequence present in 24 genes in the GA-down regulated d1 cluster (106 genes) found in Arabidopsis seed germination; This motif is similar to ABRE (Busk and Pages 1998);,Ga; seed; germaination;,Arabidopsis thaliana;,"Ogawa M, Hanada A, Yamauchi Y, Kuwahara A, Kamiya Y, Yamaguchi S. Gibberellin biosynthesis and response during Arabidopsis seed germination. Plant Cell 15: 1591-1604 (2003) PubMed: 12837949; Nakashima K, Fujita Y, Katsura K, Maruyama K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K. Transcriptional regulation of ABI3- and ABA-responsive genes including RD29B and RD29A in seeds, germinating embryos, and seedlings of Arabidopsis. Plant Mol Biol. 60: 51-68 (2006). PubMed: 16463099"
CGACGOSAMY3,21,1.339468954,0.000164091,0.00378973,gxe.haldown.filup,CGACG,S000205,"""CGACG element"" found in the GC-rich regions of the rice (O.s.) Amy3D and Amy3E amylase genes, but not in Amy3E gene; May function as a coupling element for the G box element;",amylase;,rice (Oryza sativa);,"Hwang YS, Karrer EE, Thomas BR, Chen L, Rodriguez RL Three cis-elements required for rice alpha-amylase Amy3D expression during sugar starvation Plant Mol Biol 36:331-341 (1998) PubMed: 9484474;"
ABREOSRAB21,22,1.38912285,0.000308818,0.006808029,gxe.haldown.filup,ACGTSSSC,S000012,"""ABA responsive element (ABRE)"" of wheat Em and rice (O.s.) rab21 genes; Proposed consensus sequence for the repeated motif (Em1a and Em1b) of wheat Em gene; S=C/G;",ABA; ABRE; Em; rab; Em1a; Em1b; seed;,rice (Oryza sativa); wheat (Triticum aestivum),"Marcotte WR Jr, Russell SH, Quatrano RS Abscisic acid-responsive sequences from the Em gene of wheat. Plant Cell 1:969-976 (1989) PubMed: 2562556; Busk PK, Pages M Regulation of abscisic acid-induced transcription Plant Mol Biol 37:425-435 (1998) PubMed: 9617810; Skriver K, Mundy J Gene expression in response to abscisic acid and osmotic stress Plant Cell 2: 503-512 (1990) PubMed: 2152172"
BOXIIPCCHS,23,1.510223946,0.000347195,0.007321293,gxe.haldown.filup,ACGTGGC,S000229,"Core of ""Box II/G box"" found in the parsley (P.c.) chs genes; Essential for light regulation (Terzaghi & Cashmore, 1995); See S000345;",Box II; Box 2; CHS; chs; light regulation;,parsley (Petroselinum crispum),"Block A, Dangl JL, Hahlbrock K, Schulze-Lefert P Functional borders, genetic fine structure, and distance requirements of cis elements mediating light responsiveness of the parsley chalcone synthase promoter Proc Natl Acad Sci USA 87:5387-5391(1990) PubMed:  2371277 Terzaghi WB, Cashmore AR Light-regulated transcription Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) Nakashima K, Fujita Y, Katsura K, Maruyama K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K. Transcriptional regulation of ABI3- and ABA-responsive genes including RD29B and RD29A in seeds, germinating embryos, and seedlings of Arabidopsis. Plant Mol Biol. 60: 51-68 (2006) PubMed: 16463099"
YAB1,24,1.988085415,0.000726451,0.014680363,gxe.haldown.filup,NA,NA,NA,NA,NA,NA