(Fig. 16h). male, field code LR-08-247, GenBank accession number KY066725 for COI and KY081279 for ITS2; Greece, Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605 E, 1270 m, 20 July 2008, V.A. Lukhtanov and N.A. Shapoval leg., deposited in Zoological Institute of the Russian Academy of Science (St. Petersburg).

COI barcode sequence of the holotype, 657 base pairs.

ACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTCTAAGAATTTTAATTCGTATGGAATTAAGAACTCCTGGATCCTTAATTGGAAATGATCAAATTTATAATACTATTGTTACAGCCCATGCATTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTTCCCTTAATATTAGGAGCACCTGATATAGCTTTTCCACGATTAAATAATATGAGATTTTGATTATTACCGCCATCATTAATACTACTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATTGCACATGGAGGATCATCTGTAGATTTAGCAATTTTCTCTCTTCATTTAGCGGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATCATTAATATACGAGTAAATAATTTATCTTTTGATCAAATATCATTATTTATTTGAGCAGTGGGAATTACAGCATTATTATTACTTTTATCATTGCCTGTATTAGCTGGGGCAATTACCATATTATTAACAGATCGAAATCTTAATACCTCATTCTTTGACCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT

Haploid chromosome number of the holotype n=38 (Fig. 4c).

Four males, field codes LR-08-255, LR-08-258, LR-08-273, LR-08-274, forewing length 17–18 mm, the same data as holotype. Male: field code LR-08-205, Greece, Parnassos, 38°33.311'N; 22°34.300 E, 1750 m, 19 July 2008, V.A. Lukhtanov and N.A.Shapoval leg. Five females: forewing length 15–16 mm; Greece, Timfristos Mt, Karpenisi, 38°55.554'N; 21°48.460 E, 1490 m, 21 July 2008, V.A. Lukhtanov and N.A. Shapoval leg. Two females: forewing length 14.5–15.5 mm; Greece, Parnassos, 38°33.311'N; 22°34.300 E, 1750 m, 19 July 2008, V.A. Lukhtanov and N.A. Shapoval leg.. All paratypes are deposited in Zoological Institute of the Russian Academy of Science (St. Petersburg).

(Fig. 16d–i). Forewing length 16.2–18.2 mm. Upperside: ground color completely brown. Discoidal, submarginal and antemarginal marking absent on both fore- and hindwings. Forewings with a developed sex brand and scaletuft. Fringe brown as ground color.

Underside: ground color light brown with yellowish coffee-milk tint. Greenish blue basal suffusion very slight, nearly lacking. One basal black spot is present only on hindwings. Discoidal black spot is present on the forewings, but can be slightly seen on the hindwings (absent or vestigial). Postdiscal black ocelli are encircled by a whitish border. They are prominent on the forewings, forming a strongly curved row. Postdiscal black ocelli on the hindwing small. Submarginal and antemarginal marking is absent on the forewings, and absent or vestigial on the hindwings. White streak on hindwings clearly visible. In one specimen the white streak is vestigial, in one the white streak is almost absent (can be slightly distinguished), and in one specimen there is an additional short streak between postdiscal and submarginal areas of the wing, straight under the main white streak. Fringe brown, slightly darker than the underside ground color.

Genitalia: the male genitalia have a structure typical for other species of the subgenus Agrodiaetus (Coutsis, 1986).

(Fig. 17a–g). Forewing length 15.8–17.5 mm.Upperside: ground color as in males, but lighter dark brown and without sex brand and scaletuft. Fringe greyish brown. Underside: ground color and general design as in males but fringes lighter-colored. Greenish blue basal suffusion almost invisible. White streak on hindwing underside is present in all paratypes and demonstrates a variable level of reduction.

Polyommatus timfristos (n=38) differs by at least three fixed chromosome fusions/fissions from the most closely related and allopatric Polyommatus orphicus orphicus and Polyommatus orphicus eleniae (n=41-42). Polyommatus timfristos (n=38) differs by at least nine fixed chromosome fusions/fissions from allopatric Polyommatus aroaniensis (n=47). From the closely related Polyommatus orphicus and Polyommatus aroaniensis, Polyommatus timfristos differs also by a number of nucleotide substitutions within the studied 657-bp fragment of the mitochondrial COI gene.

The chromosome number in Polyommatus timfristos (n=38) is similar (but not identical) to that found in Polyommatus humedasae (n=39, Vila et al. 2010). However, we are not sure that these karyotypes are related in their origin because they are not found in proximity and separated by an area where Polyommatus orphicus with n=41-42 is distributed. With respect to COI barcodes, the pair Polyommatus timfristos/Polyommatus humedasae is more differentiated than pairs Polyommatus timfristos/Polyommatus aroaniensis and Polyommatus timfristos/Polyommatus orphicus.

From sympatric and syntopic Polyommatus ripartii pelopi the new species can usually be distinguished by the absence of submarginal marking and strong reduction of greenish blue basal suffusion. These characteristics are usually (but not always) better expressed in Polyommatus ripartii pelopi specimens. In doubtful cases, the separation is only possible on the base of chromosomal and molecular markers since these species are different: the chromosome number of Polyommatus ripartii pelopi is n=90; they also have fixed differences in 33 positions within the studied 657-bp fragment of COI gene.

Polyommatus timfristos sp. n. inhabits xerothermic and xeromontane localities and dry meadows from 1200 to 1800 m altitude (Figs 32–35). It was found in complete syntopy with Polyommatus ripartii pelopi and Polyommatus admetus.

Timfristos is a mountain in the eastern part of Evrytania and the western part of Phthiotis in Central Greece. The name is a noun.