#!/usr/bin/sh

#########################################################################################################
#The shell script explains how to detect P-element insertions from paired-end reads of hemi-specific PCR
#Shuo Zhang (shuozhang23@gmail.com)
#Erin Kelleher lab
#Program in Ecology and Evolution, Departement of Biology and Biochemistry, University of Houston
#########################################################################################################

#To run this script, put you paired-end reads from each degenerate primer into seperate directories. 
#Then, create a directory and move your direacotories with sequencing data into this created directory, run the shell script after you change to this directory 
module add bowtie2/2.1.0
module add samtools/0.1.19


#The 1st step: align read1 from the paired-end sequencing data to the P-element consensus reference
for i in {1..15}
do 
	cd Sample_lib_R$i  #change to directory containing paired-end reads of a degenerate primer

	#align read1 from the paired-end sequencing data to the P-element consensus reference
	#p_element.ref is the basename of the index for the P-element consensus. For more details, please refer bowtie2 manual
	# read1.fastq is the read1 of paired-end reads
	bowtie2 --local -q --no-unal -x p_element.ref -U read1.fastq -S read1.sam

	#select reads that align to plus strand of P-element
	samtools view -SXF 0x10 read1.sam > plus_strand_mapped_read1.sam

	#pick read pairs that aligned to 3' end of P-element
	perl pick_p_reads.pl plus_strand_mapped_read1.sam read1.fq r1.fq lib*R2_001.fastq read2.fq r2.fq
	cat read1.fq r1.fq > p_read1.fq
	cat read2.fq r2.fq > p_read2.fq
	rm read1.fq r1.fq read2.fq r2.fq
	
	#cut adapter at 3' end and remove 3' end sequence of P element and filter low quality nucleotides
	cutadapt  -a CTGTCTCTTATACACATCTCCGAGCCCAC -A CTGTCTCTTATACACATCTGACGCTGCC  -o cut_p_read1.fq -p cut_p_read2.fq p_read1.fq p_read2.fq 
	cutadapt  -q 20,20 -g CGACGGGACCACCTTATGTTATTTCATCATG  -A CATGATGAAATAACATAAGGTGGTCCCGTCG --minimum-length 20 -o trimmed_p_read1.fq -p trimmed_p_read2.fq cut_p_read1.fq cut_p_read2.fq 
	rm cut_p_read1.fq cut_p_read2.fq
	
	#align trimmed read paired to dm6 
	bowtie2 -q -a --no-unal -x dm6.ref -1 trimmed_p_read1.fq trimmed_p_read2.fq -S trimmed_read_all.sam
	samtools view -XSf 0x2  trimmed_read_all.sam  > proper_trimmed_read_all.sam
	
	#pick uniquely mapping reads and their alignments
	cut -f 1 proper_trimmed_read_all.sam | uniq -c > alignment.txt
	perl pickUniqMulti.pl alignment.txt proper_trimmed_read_all.sam uniq.sam multi.sam
	rm alignment.txt

	#detect the P-element insertions according to uniquely mapping reads
	perl get_insertion_unique.pl -read1_len 30 -read2_len 30 -i uniq.sam -o insertion.out
	cd ..
done