##gff-version 3
##sequence-region 10 1 133797422
10	Ensembl	gene	114239330	114291513	.	+	.	ID=ENSG00000165816;Name=ENSG00000165816;biotype=protein_coding
10	Ensembl	transcript	114239330	114291513	.	+	.	ID=ENST00000392982;Name=ENST00000392982;Parent=ENSG00000165816;biotype=protein_coding
10	Ensembl	exon	114239330	114239569	.	+	.	Name=ENSE00001369253;Parent=ENST00000392982
10	Ensembl	exon	114248704	114248765	.	+	.	Name=ENSE00003663321;Parent=ENST00000392982
10	Ensembl	exon	114253651	114253725	.	+	.	Name=ENSE00003550071;Parent=ENST00000392982
10	Ensembl	exon	114254915	114255048	.	+	.	Name=ENSE00003521910;Parent=ENST00000392982
10	Ensembl	exon	114261186	114261295	.	+	.	Name=ENSE00003672089;Parent=ENST00000392982
10	Ensembl	exon	114272740	114272934	.	+	.	Name=ENSE00003516409;Parent=ENST00000392982
10	Ensembl	exon	114277914	114278047	.	+	.	Name=ENSE00003686850;Parent=ENST00000392982
10	Ensembl	exon	114278719	114278851	.	+	.	Name=ENSE00003631480;Parent=ENST00000392982
10	Ensembl	exon	114282516	114282571	.	+	.	Name=ENSE00003473205;Parent=ENST00000392982
10	Ensembl	exon	114284863	114284970	.	+	.	Name=ENSE00003543392;Parent=ENST00000392982
10	Ensembl	exon	114285939	114286511	.	+	.	Name=ENSE00003514201;Parent=ENST00000392982
10	Ensembl	exon	114288938	114289489	.	+	.	Name=ENSE00001449373;Parent=ENST00000392982
10	Ensembl	exon	114290240	114290365	.	+	.	Name=ENSE00001449371;Parent=ENST00000392982
10	Ensembl	exon	114291218	114291513	.	+	.	Name=ENSE00001613715;Parent=ENST00000392982
10	Ensembl	CDS	114248714	114248765	.	+	0	Name=ENSP00000376708;Parent=ENST00000392982
10	Ensembl	CDS	114253651	114253725	.	+	2	Name=ENSP00000376708;Parent=ENST00000392982
10	Ensembl	CDS	114254915	114255048	.	+	2	Name=ENSP00000376708;Parent=ENST00000392982
10	Ensembl	CDS	114261186	114261295	.	+	0	Name=ENSP00000376708;Parent=ENST00000392982
10	Ensembl	CDS	114272740	114272934	.	+	1	Name=ENSP00000376708;Parent=ENST00000392982
10	Ensembl	CDS	114277914	114278047	.	+	1	Name=ENSP00000376708;Parent=ENST00000392982
10	Ensembl	CDS	114278719	114278851	.	+	2	Name=ENSP00000376708;Parent=ENST00000392982
10	Ensembl	CDS	114282516	114282571	.	+	1	Name=ENSP00000376708;Parent=ENST00000392982
10	Ensembl	CDS	114284863	114284970	.	+	2	Name=ENSP00000376708;Parent=ENST00000392982
10	Ensembl	CDS	114285939	114286511	.	+	2	Name=ENSP00000376708;Parent=ENST00000392982
10	Ensembl	CDS	114288938	114289489	.	+	2	Name=ENSP00000376708;Parent=ENST00000392982
10	Ensembl	CDS	114290240	114290365	.	+	2	Name=ENSP00000376708;Parent=ENST00000392982
10	Ensembl	CDS	114291218	114291237	.	+	2	Name=ENSP00000376708;Parent=ENST00000392982
10	.	primer	114239148	114239169	.	+	.	Name=PB45;Note=anneals on the + strand after bisulfite conversion
10	.	PCR_product	114239148	114239447	.	.	.	Name=PCR region 1
10	.	primer	114239423	114239447	.	-	.	Name=PB46;Note=anneals on the reverse complementary of the + strand after bisulfite conversion
10	.	primer	114239424	114239447	.	+	.	Name=P65;Note=anneals on the + strand after bisulfite conversion
10	.	PCR_product	114239424	114239920	.	.	.	Name=PCR region 2
10	.	TF_binding_site	114239444	114239455	.	.	.	Name=E-box
10	.	primer	114239867	114239886	.	-	.	Name=P67
10	.	primer	114239898	114239917	.	+	.	Name=P159;Note=anneals on the + strand after bisulfite conversion
10	.	PCR_product	114239898	114240073	.	.	.	Name=PCR region 3
10	.	primer	114239900	114239920	.	-	.	Name=P68;Note=anneals on the reverse complementary of the + strand after bisulfite conversion
10	.	nuclease_binding_site	114239966	114239973	.	.	.	Name=NotI
10	.	RFLP_fragment	114239966	114240060	.	.	.	Name=MS-AFLP Band C-5
10	.	primer	114240054	114240073	.	-	.	Name=P162;Note=anneals on the reverse complementary of the + strand after bisulfite conversion
10	.	primer	114240059	114240079	.	+	.	Name=PB24;Note=anneals on the + strand after bisulfite conversion
10	.	PCR_product	114240059	114240374	.	.	.	Name=PCR region 4
10	.	primer	114240352	114240374	.	-	.	Name=PB25;Note=anneals on the reverse complementary of the + strand after bisulfite conversion
10	.	primer	114278822	114278841	.	+	.	Name=PB66;Note=GTGCTGGCTGCACACTGTC
10	.	primer	114284907	114284927	.	-	.	Name=PB67;Note=GTAGCCGTCCAGTCCTTCTG
10	.	primer	114248756	114248765	.	+	.	ID=PB271;Name=PB271;Note=TTTTCCAGAGTGCCCCCATC;Note=anneals on exons 2-3 junction
10	.	primer	114253651	114253660	.	+	.	ID=PB271;Name=PB271;Note=TTTTCCAGAGTGCCCCCATC;Note=anneals on exons 2-3 junction
10	.	primer	114255014	114255033	.	-	.	Name=PB272;Note=GTCCAGACCGTCACAGACTG
10	.	primer	114248717	114248737	.	+	.	Name=PB273;Note=CCCCTTTCCTGTTGCTGGAA
10	.	primer	114254971	114254990	.	-	.	Name=PB274;Note=TCAAAGCTCCCTTTCCCGAC
12	.	primer	6534838	6534855	.	+	.	Name=GAPDH-F; Note=GAAGGTGAAGGTCGGAGT
12	.	primer	6536765	6536785	.	-	.	Name=GAPDH-R; Note=GAAGATGGTGATGGGATTTC
13	.	primer	45340121	45340139	.	+	.	Name=TPT1-R;Note=GATCGCGGACGGGTTGT
13	.	primer	45340731	45340748	.	-	.	Name=TPT1-F;Note=TTCAGCGGAGGCATTTCC
10	Ensmbl	CpG_island	114239250	114239844	.	.	.	Name=CGI
10	Eponine	TSS	114239371	114239376	.	.	.	Name=TSS predicted by eponine
10	Ensmbl	TSS	114239330	114239331	.	.	.	Name=TSS (ENSMBL)