Primer #	Name	Sequence	Description
BK053	rpsG fwd	TCAATTTAAGTAGCCCAAAGCGGG	binds rpsG 5' end, binds the 3' end of the I rpsG mutant construct
BK054	 rpsG rev	TGCTGCACACATTACATCGCTCA	binds tusB 3' end, binds the 5' end of the  rpsG mutant construct
BK069	rpsG ver fwd	GATACCGATGTTACGGTAGCGTGC	binds 72 bp upstream of rpsG mutant construct insert site
BK055	 rpsF fwd	AAGTGTGATGAACTTCAAATCAGCG	binds 198bp upstream of 3' end of rpsF, binds the 3' end of rpsF mutant construct
BK056	rpsF rev	CTAGTCTCCAGAATCTATCAATTCAATCTGCTCG	binds the 3' end of priB, binds the 5' end of  rpsF mutant construct
BK071	rpsF ver fwd	CAATGATAAAGAAGTTGATGGTG	binds 62 bp upstream of rpsF mutant construct insert site
BK072	rpsF ver rev	ATCTCTTGAACGCCTTCC	binds 48 bp downstream of rpsF mutant construct insert site
BK065	ybeD verification fwd	GGCTGAAGACCGAGCTGG	binds 44 bp upstream of ybeD mutant construct insert site
BK066	ybeD verification rev	CCCGCTGGTTGTGTTGCA	binds 103bp downstream of ybeD mutant construct insert site
BK067	Vtuf anc v fwd	GCATCATTTGCTTTCGCTTTTCCCG	binds 388bp upstream of VtufA mutant construct insert site. This primer can amplify and verify any tuf insert at the E. coli tufA site.
BK068	Vtuf anc v rev	GCCGTAATTGAAGCCCGTGGTAAATAAG	binds immediately downstream of VtufA mutant construct insert site. This primer can amplify and verify any tuf insert at the E. coli tufA site.
BK061	FRT us of kanR fwd	GGATCTTGAAGTTCCTATTCCGAAG	binds the FRT site upstream of kanR, amplifies upstream of kanR sequence
BK062	FRT ds of kanR rew	ATCTCATGCTGGAGTTCTTCGCC	binds the FRT site downstream of kanR, amplifies downstram of kanR sequence
BK063	kanR fwd	ATGATTGAACAAGATGGATTGCACG	binds the 3' end of kanR
BK064	kanR rev	TCAGAAGAACTCGTCAAGAAGGC	binds the 5' end of kanR