Omics Signatures	Correlation	Count
DHTKD1_copyNumber	negative with good prognosis	1
PTPN20_copyNumber	negative with good prognosis	1
HSPA1A_protein_RPPA	Not_Sig	1
ZNF419_copyNumber	negative with good prognosis	1
DKK3_geneExp	Not_Sig	1
PSG3_copyNumber	negative with good prognosis	1
ITM2C_geneExp	Not_Sig	1
ATP1A1_geneExp	positive with good prognosis	1
BMS1P1_copyNumber	negative with good prognosis	1
PIK3CA_protein_RPPA	Not_Sig	1
IGFBP2_protein_RPPA	positive with good prognosis	1
BCL2A1_protein_RPPA	Not_Sig	1
TUBA1B_geneExp	negative with good prognosis	1
BID_protein_RPPA	positive with good prognosis	1
NUTM2D_copyNumber	negative with good prognosis	1
MIR22_miRNAExp	negative with good prognosis	1
ANXA1_protein_RPPA	Not_Sig	1
GLUD1P2_copyNumber	negative with good prognosis	1
LENG9_copyNumber	negative with good prognosis	1
LILRB1_copyNumber	negative with good prognosis	1
LOC728218_copyNumber	negative with good prognosis	1
CEACAM1_copyNumber	negative with good prognosis	1
NCEH1_geneExp	Not_Sig	1
HSPA14_copyNumber	negative with good prognosis	1
LRMP_methylation	positive with good prognosis	1
CEACAM16_copyNumber	negative with good prognosis	1
LOC399744_copyNumber	negative with good prognosis	1
MIR5708_miRNAExp	Not_Sig	1
LET7A.3_miRNAExp	positive with good prognosis	1
ZNF468_copyNumber	negative with good prognosis	1
KIAA1549_methylation	positive with good prognosis	1
CYP26A1_copyNumber	negative with good prognosis	1
TSTD1_geneExp	positive with good prognosis	1
MIR3155B_copyNumber	negative with good prognosis	1
RICTOR_protein_RPPA	Not_Sig	1
PPFIBP1_geneExp	Not_Sig	1
ZNF528_copyNumber	negative with good prognosis	1
NDUFA3_copyNumber	negative with good prognosis	1
IGFL2_copyNumber	negative with good prognosis	1
PPM1J_geneExp	Not_Sig	1
IDO1_methylation	positive with good prognosis	1
RRAD_methylation	positive with good prognosis	1
GBE1_methylation	positive with good prognosis	1
RASSF10_methylation	positive with good prognosis	1
LRRC15_methylation	positive with good prognosis	1
ST8SIA6_copyNumber	negative with good prognosis	1
DPM2_methylation	positive with good prognosis	1
TAGLN_methylation	positive with good prognosis	1
RAB15_methylation	negative with good prognosis	1
STAU2_methylation	positive with good prognosis	1
ZNF296_methylation	positive with good prognosis	1
DLL3_geneExp	positive with good prognosis	1
IFI30_methylation	negative with good prognosis	1
DOK7_methylation	positive with good prognosis	1
VIM_methylation	negative with good prognosis	1
DKK1_methylation	positive with good prognosis	1
ENC1_methylation	negative with good prognosis	1
CABLES1_methylation	negative with good prognosis	1
RAPGEFL1_methylation	Not_Sig	1
SPAG9_methylation	positive with good prognosis	1
GSAP_methylation	positive with good prognosis	1
ZNF285_copyNumber	negative with good prognosis	1
MT3_methylation	positive with good prognosis	1
BIRC3_methylation	negative with good prognosis	1
FAM25G_copyNumber	negative with good prognosis	1
PRKCA_protein_RPPA	Not_Sig	1
NLRP2_copyNumber	negative with good prognosis	1
CCNI2_methylation	positive with good prognosis	1
RAB11FIP4_methylation	positive with good prognosis	1
TMEM26_methylation	positive with good prognosis	1
MAP3K1_methylation	positive with good prognosis	1
FGF20_methylation	positive with good prognosis	1
ANXA8_copyNumber	negative with good prognosis	1
FAM25BP_copyNumber	negative with good prognosis	1
BCAN_geneExp	positive with good prognosis	1
PSG9_copyNumber	negative with good prognosis	1
FAM25C_copyNumber	negative with good prognosis	1
GNG8_methylation	positive with good prognosis	1
MAPK3_protein_RPPA	Not_Sig	1
ZNF28_copyNumber	negative with good prognosis	1
"KTI12,chr1:52499071-52499097,+,In_Frame_Del,DEL,GCCCGCCACCTGAGGTCCCGCGATCGGGCCCGCCACCTGAGGTCCCGCGATCGG>--"	Not_Sig	1
"FRMPD2,chr10:49380999-49380999,+,Silent,SNP,TT>TC"	positive with good prognosis	1
"IDH1,chr2:209113113-209113113,+,Missense_Mutation,SNP,GG>GA"	Not_Sig	1
"TP53,chr17:7577121-7577121,+,Missense_Mutation,SNP,GG>AA"	Not_Sig	1
"ARHGAP5,chr14:32561313-32561313,+,Nonsense_Mutation,SNP,CC>CT"	positive with good prognosis	1
"ARHGAP5,chr14:32561316-32561316,+,Nonsense_Mutation,SNP,GG>GT"	positive with good prognosis	1
"ARHGAP5,chr14:32561340-32561340,+,Missense_Mutation,SNP,GG>GA"	positive with good prognosis	1
"RP11-460N20.5,chr7:64559189-64559189,+,RNA,SNP,GG>GA"	positive with good prognosis	1
"DUX4L19,chrY:13488193-13488193,+,RNA,SNP,GG>GT"	positive with good prognosis	1
"EGFR,chr7:55233043-55233043,+,Missense_Mutation,SNP,GG>TT"	positive with good prognosis	1
"ARHGAP5,chr14:32561296-32561296,+,Missense_Mutation,SNP,TT>TC"	Not_Sig	1
"ARHGAP5,chr14:32561340-32561340,+,Missense_Mutation,SNP,GG>AA"	Not_Sig	1
"RNA5-8SP2,chr16:33965459-33965459,+,RNA,SNP,CC>CT"	Not_Sig	1
"ATG2A,chr11:64666182-64666182,+,Missense_Mutation,SNP,CC>CG"	Not_Sig	1
"NFKBIZ,chr3:101572635-101572635,+,Missense_Mutation,SNP,TT>TG"	Not_Sig	1
"IDH1,chr2:209113112-209113112,+,Missense_Mutation,SNP,CC>CT"	positive with good prognosis	1