Table 1.

Summary and description of BRCA2 mutations identified by circulating tumor DNA analysis.

	Mutation (HGVS designation)	Protein (HGVS designation)	Indel type	Functional consequence	Indel length (nt)	Net nt loss resulting from	Mutant allele fraction in ctDNA	Cis/trans to germline mutation
ALLELE 1	c.5946delT*	p.SeM982fs	Deletion	Germline loss of function	−1	NA	42.4%	N/A
	c.5946_5990delTGGAAAATCTGTCCAGGTATCAGATGCTTCATTACAAAACGCAAG	p.Ser1982_Ala1996del	Deletion	Somatic reversion	−45	−46	1.0%	cis
	C.5949_5952dupAAAA	p.Ser1985fs	Duplication	Somatic reversion	+4	−3	0.5%	cis
	c.5964_5998delATCAGATGCTTCATTACAAAACGCAAGACAAGTGT	p.Ser1989fs	Deletion	Somatic reversion	−35	−36	0.4%	cis
	c.5959_596SclelCAGGTATC	p.Gln1987fs	Deletion	Somatic reversion	−8	−9	0.3%	cis
	c.5992_6005delCAAGTGTTTTCTGA	p.Gln1998fs	Deletion	Somatic reversion	−14	−15	0.3%	cis
	c.5941_5956delGCAAGTGGAAAATCTGinsA	pAla1981_Val1986delinslle	Insertion-Deletion	Somatic reversion	−15	−15	0.3%	cis
	c.599_5S99delAGTGTTinsTATC	p.Gln1998fs	Insertion-Deletion	Somatic reversion	−3	−3	0.2%	cis
	c.5998_6008demTTCTGAAATinsCAA	p.Phe2000fs	Insertion-Deletion	Somatic reversion	−8	−9	0.2%	cis
	c.5944_5952delAGTGGAAAA	p.Ser1982_Lys1984del	Deletion	Somatic reversion	−9	−9	0.1%	cis
ALLELE 2	c.5754_5755dBlAT	p.His1918fs	Deletion	Somatic secondary mutation	−2	NA	23.6%	trans
	c.5736pelA	p.Glu1912fs	Deletion	Somatic reversion	−1	−3	0.2%	tranŝ
	c.5748_5754delTTCACATinsC	p.Seri917_His1918del	Insertion-Deletion	Somatic reversion	−6	−6	0.1%	tranŝ

The c.5946delT mutation corresponds to the 6174delT mutation in BRCA2. c.5946delT uses the Human Genomic Variation Society (HGVS) nomenclature and 6174delT, the Breast Cancer International Consortium (BIC) nomenclature. Indel = Insertion or deletion or compound insertion/deletion. nt = nucleotide.