KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit anti-SLF2 | Abcam | Cat#ab122480; RRID: AB_11129755 |
| Rabbit anti-VPRBP/DCAF1 | Abcam | Cat#ab202587; RRID: RRID: AB_2885060 |
| Rabbit anti-Histone H3 | Abcam | Cat#ab1791; RRID: AB_302613 |
| Rabbit anti-Histone H3K9me3 | Abcam | Cat#ab8898; RRID: AB_306848 |
| Rabbit anti-HLTF | Bethyl Laboratories | Cat#A300-230A; RRID: AB_2117307 |
| Mouse anti-CD4-APC | Biolegend | Cat#317416; RRID: AB_571945 |
| Mouse anti-LNGFR-PE | Biolegend | Cat#345106; RRID: AB_2152647 |
| Rabbit anti-Histone H3K4me3 | Cell Signaling | Cat#9751; RRID: AB_2616028 |
| Rabbit anti-Histone H3K9ac | Cell Signaling | Cat#9649; RRID: AB_823528 |
| Rabbit anti-Histone H3K27me3 | Cell Signaling | Cat#9733; RRID: AB_2616029 |
| Rabbit anti-SMC6 | GeneTex | Cat#GTX116832; RRID: AB_10630494 |
| Rabbit anti-NSMCE1 | GeneTex | Cat#GTX107136; RRID: AB_1951030 |
| Mouse anti-Vif | NIH AIDS Reagent Program | Cat#6459; (Simon et al., 1995) |
| Mouse anti-UNG2 | Origene | Cat#TA503563; RRID: AB_11126624 |
| Rat anti-HA | Roche | Cat#11867423001; RRID: AB_390918 |
| Goat anti-lamin B1 | Santa Cruz | Cat#sc-6217; RRID: AB_648158 |
| Mouse anti-β-actin | Sigma-Aldrich | Cat#A5316; RRID: AB_476743 |
| Rabbit anti-ANKRD32/SLF1 | Sigma-Aldrich | Cat#SAB2701555; RRID: AB_2885061 |
| Goat anti-mouse HRP | Jackson ImmunoResearch | Cat#115-035-146; RRID: AB_2307392 |
| Goat anti-rabbit HRP | Jackson ImmunoResearch | Cat#111-035-144; RRID: AB_2307391 |
| Goat anti-rat HRP | Jackson ImmunoResearch | Cat#112-035-143; RRID: AB_2338138 |
| Bacterial and Virus Strains | ||
| pLTR-Tat-IRES-GFP | Eric Verdin | pEV731 |
| pHRSIN.pSFFV-GFP | This paper | N/A |
| pHRSIN.pSFFV-mCherry | This paper | N/A |
| pHRSIN.pSFFV-iRFP | This paper | N/A |
| pNL4-3-ΔEnv-Nef-P2A-SBP- ΔLNGFR (NL4-3LNGFR) | (Naamati et al., 2019 | N/A |
| pNL4-3-ΔEnv-Nef-P2A-SBP- ΔLNGFR-ΔVpr (ΔVpr NL4-3LNGFR) | (Naamati et al., 2019) | N/A |
| pNL4-3-ΔEnv-eGFP (NL4-3GFP) | NIH AIDS Reagent Program, Drs Haili Zhang, Yan Zhou, and Robert Siliciano (Zhang et al., 2004) | Cat#11100 |
| pNL4-3-ΔEnv-eGFP-ΔVpr (ΔVpr NL4-3GFP) | (Greenwood et al., 2019) | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Raltegravir | Cayman Chemical | Cat#16071 |
| MLN4924 | Millipore | Cat#5054770001 |
| IL-2 | PeproTech | Cat#200-02 |
| 7-AAD | Stratech | Cat#17501 |
| Protein G magnetic beads | Pierce | Cat#88848 |
| Anti-HA magnetic beads | Pierce | Cat#88837 |
| SYBR Green PCR master mix | Applied Biosystems | Cat#4309155 |
| AMPure XP | Beckman Coulter | Cat#A63881 |
| Critical Commercial Assays | ||
| RNAscope ISH reagent kit | ACD | |
| Dynabeads Untouched Human CD4 T Cells kit | Invitrogen | Cat#11346D |
| Dynabeads Human T-Activator CD3/CD28 | Gibco | Cat#11132D |
| Dynabeads Biotin Binder | Invitrogen | Cat#11047 |
| TDE1 Tagment DNA Enzyme | Illumina | Cat#20034197 |
| Deposited Data | ||
| CRISPR-Cas9 KO screen data | This paper | GEO: GSE156630 |
| ATAC-seq data | This paper | GEO: GSE156630 |
| Experimental Models: Cell Lines | ||
| CEM-T4 | NIH AIDS Reagent Program, Dr JP Jacobs (Foley et al., 1965) | Cat. #117 |
| Jurkat T cells | ATCC | Clone E6-1, TIB-152 |
| HEK293 | Lehner Lab stock | RRID: CVCL_0063 |
| Oligonucleotides | ||
| iRFP ChIP, forward primer: 5’-CTTCGATCGGGTGATGATCT | This paper, Sigma-Aldrich | N/A |
| iRFP ChIP, reverse primer: 5’- GCAGGCCTAGTTTTGACTCG | This paper, Sigma-Aldrich | N/A |
| Recombinant DNA | ||
| Vpr target sgRNA library, see sgRNA sequences in Table S1 | This paper | N/A |
| pKLV-U6-sgRNA.pGK-Puro-2A-BFP; see sgRNA sequences in Table S2 | This paper | N/A |
| pCMV.SPORT6-mCherry | This paper | N/A |
| pCMV.SPORT6-Vpr | This paper | N/A |
| pCMV.SPORT6-Vpr(Q65R) | This paper | N/A |
| pCMV.SPORT6-Vpr(H71R) | This paper | N/A |
| pHR-SIREN-shControl.pGK-HygroR (GTTATAGGCTCGCAAAAGG) | (Greenwood et al., 2019) | N/A |
| pHR-SIREN-shDCAF1.pGK-HygroR (GTTATAGGCTCGCAAAAGG) | (Greenwood et al., 2019) | N/A |
| pHRSIN.pSFFV-SLF2.pGK-PuroR | This paper | N/A |
| pHRSIN.pSFFV-SLF2(590-1173).pGK-PuroR | This paper | N/A |
| pHRSIN.pRSV-3xHA-Vpr.pUb-Emerald | (Greenwood et al., 2019) | N/A |
| pHRSIN.pRSV-HA-Vpr(NL4-3).pUb-Emerald | (Greenwood et al., 2019) | N/A |
| pHRSIN.pRSV-HA-Vpr(SIVcpzPtt).pUb-Emerald | (Greenwood et al., 2019) | N/A |
| pHRSIN.pRSV-HA-Vpr(rcm).pUb-Emerald | (Greenwood et al., 2019) | N/A |
| pHRSIN.pRSV-HA-Vpr(agm).pUb-Emerald | (Greenwood et al., 2019) | N/A |
| pHRSIN.pRSV-HA-Vpr(mus).pUb-Emerald | (Greenwood et al., 2019) | N/A |
| pHRSIN.pRSV-HA-Vpr(smm).pUb-Emerald | (Greenwood et al., 2019) | N/A |
| pHRSIN.pRSV-HA-Vpr(HIV-2 7312a).pUb-Emerald | (Greenwood et al., 2019) | N/A |
| pHRSIN.pSFFV-3xHA-HBx.pGK-PuroR | This paper | N/A |
| pHRSIN.pSFFV-3xHA-NSMCE2.pGK-PuroR | This paper | N/A |
| Software and Algorithms | ||
| FlowJo 10.7.1 | FlowJo, LLC | RRID: SCR_008520 |
| Prism 8.4.2 | Graphpad | RRID: SCR_002798 |
| Gen5 | Biotek | RRID: SCR_017317 |
| Bowtie2 | (Langmead and Salzberg, 2012) | RRID: SCR_005476 |
| FastX Toolkit | Hannon laboratory | RRID: SCR_005534 |
| MAGeCK | (Li et al., 2014) | https://bitbucket.org/liulab/mageck/src/master/ |
| Proteome Discoverer 2.1 | Thermo Scientific | RRID: SCR_014477 |
| FastQC | Babraham Bioinformatics, 2010 | https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ |
| cutadapt | (Martin, 2011) | RRID: SCR_011841 |
| BWA-MEM | (Li and Durbin, 2009) | RRID: SCR_010910 |
| sambamba | (Tarasov et al., 2015) | https://academic.oup.com/bioinformatics/article/31/12/2032/214758 |
| SAMtools | (Li et al., 2009) | RRID: SCR_002105 |
| BEDTools | (Quinlan and Hall, 2010) | RRID: SCR_006646 |
| ggplot2 | (Wickham, 2016) | RRID: SCR_014601 |
| ATACseqQC | (Ou et al., 2018) | DOI:10.18129/B9.bioc.ATACseqQC |
| IGV 2.8.0 | (Thorvaldsdóttir et al., 2013) | RRID: SCR_011793 |
| Detailed data analysis algorithms deposited on: | This paper | https://github.com/LDUP92/hiv-compaction |