Skip to main content
. Author manuscript; available in PMC: 2011 Jun 1.
Published in final edited form as: J Dent Res. 2010 Feb 19;89(6):597–602. doi: 10.1177/0022034510363363

Table.

Primer Sets for Semi-quantitative and Quantitative RT-PCR

Gene Primer Name Exons Sequence (5′-3′) Size Temp°C
DSPP RT mDSPP-S 4/5 agcatgtccttctgggaaga 208 bp 60
DSPP RT mDSPP-AS 4/5 actgtgggcagctgatttct 60
DMP-1 RT mDMP-1-S 5/6 aggaatcgcatcccaatatg 221 bp 60
DMP-1 RT mDMP-1-AS 5/6 gctgtgcgtgtggtcactat 60
NMA/BAMBI NMA-S 2/3 cgcaatggatcgccactcc 500 bp 60
NMA/BAMBI NMA-AS 2/3 cgcaatggatcgccactcc 60
GAPDH GAPDH-S 5/7 caaagttgtcatggatgacc 407 bp 60
GAPDH GAPDH-AS 5/7 ccatggagaaggctgggg 60