Table 2. Universal influenza virus primers.

Primer pairs for the amplification of the HA segments of influenza A²⁷ and B²⁸ viruses and their respective thermocycler conditions.

	Forward Primer (5' to 3')	Reverse Primer (5' to 3')	Thermocylcer conditions
IAV	TATTCGTCTCAGGGAGCAAAAGCAGGGG	ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT	42 °C for 60 min, 94 °C for 2 min/5 cycles of 94 °C for 20 s, 50 °C for 30 s and 68 °C for 3 min 30 s, followed by 40 cycles of 94 °C for 20 s, 58 °C for 30 s, and 68 °C for 3 min 30 s with a final extension time at 68 °C for 10 min
IBV	GGGGGGAGCAGAAGCAGAGC	CCGGGTTATTAGTAGTAACAAGAGC	45 °C for 60 min, 55 °C for 30 min, 94 °C for 2 min/5 cycles of 94 °C for 20 s, 40 °C for 30 s and 68 °C for 3 min 30 s, followed by 40 cycles of 94 °C for 20 s, 58 °C for 30 s, and 68 °C for 3 min 30 s with a final extension time at 68 °C for 10 min