Melanin Externalization in Candida albicans Depends on Cell Wall Chitin Structures

Abstract

The fungal pathogen Candida albicans produces dark-pigmented melanin after 3 to 4 days of incubation in medium containing l-3,4-dihydroxyphenylalanine (l-DOPA) as a substrate. Expression profiling of C. albicans revealed very few genes significantly up- or downregulated by growth in l-DOPA. We were unable to determine a possible role for melanin in the virulence of C. albicans. However, we showed that melanin was externalized from the fungal cells in the form of electron-dense melanosomes that were free or often loosely bound to the cell wall exterior. Melanin production was boosted by the addition of N-acetylglucosamine to the medium, indicating a possible association between melanin production and chitin synthesis. Melanin externalization was blocked in a mutant specifically disrupted in the chitin synthase-encoding gene CHS2. Melanosomes remained within the outermost cell wall layers in chs3Δ and chs2Δ chs3Δ mutants but were fully externalized in chs8Δ and chs2Δ chs8Δ mutants. All the CHS mutants synthesized dark pigment at equivalent rates from mixed membrane fractions in vitro, suggesting it was the form of chitin structure produced by the enzymes, not the enzymes themselves, that was involved in the melanin externalization process. Mutants with single and double disruptions of the chitinase genes CHT2 and CHT3 and the chitin pathway regulator ECM33 also showed impaired melanin externalization. We hypothesize that the chitin product of Chs3 forms a scaffold essential for normal externalization of melanosomes, while the Chs8 chitin product, probably produced in cell walls in greater quantity in the absence of CHS2, impedes externalization.

Candida albicans is a major opportunistic fungal human pathogen that causes a wide variety of infections (9, 68). In healthy individuals C. albicans resides as a commensal within the oral cavity and gastrointestinal and urogenital tracts. However, in immunocompromised hosts, C. albicans causes infections ranging in severity from mucocutaneous infections to life-threatening disseminated diseases (9, 68). Research into the pathogenicity of C. albicans has revealed a complex mix of putative virulence factors (7, 60), perhaps reflecting the fine balance this species strikes between commensal colonization and opportunistic invasion of the human host.

Melanins are biological pigments, typically dark brown or black, formed by the oxidative polymerization of phenolic compounds. They are negatively charged hydrophobic molecules with high molecular weights and are insoluble in both aqueous and organic solvents. Their insolubility makes melanins difficult to study, and no definitive structure has yet been found for them; they probably represent an amorphous mixture of polymers (35). There are various types of melanin in nature, including eumelanin and phaeomelanin (76). Two principal types of melanin are found in the fungal kingdom. The majority are 1.8-dihydroxynapthalene (DNH) melanins synthesized from acetyl-coenzyme A (CoA) via the polyketide pathway (5). DNH melanins have been found in a wide range of opportunistic fungal pathogens of humans, including dark (dematiaceous) molds, such as Cladosporium, Fonsecaea, Phialophora, and Wangiella species, and as conidial pigments in Aspergillus fumigatus and Aspergillus niger (41, 80, 87, 88). However, several other fungal pathogens, including Blastomyces dermatitidis, Coccidioides posadasii, Cryptococcus neoformans, Histoplasma capsulatum, Paracoccidioides brasiliensis, and Sporothrix schenckii, produce eumelanin (3,4-dihydroxyphenylalanine [DOPA]-melanin) through the activity of a polyphenol oxidase (laccase) and require an exogenous o-diphenolic or p-diphenolic substrate, such as l-DOPA (16, 30, 63–65, 67, 79).

The production of melanin in humans and other mammals is a function of specialized cells called melanocytes. Particles of melanin polymers, sometimes, including more than one melanin type, are built up within membrane-bound organelles called melanosomes (76), and these are actively transported along microtubules to the tips of dendritic outgrowths of melanocytes, from where they are transferred to neighboring cells (32, 81). The mechanism of intercellular transfer of melanosomes has not yet been established, but the export process probably involves the fusion of cell and vesicular membranes rather than secretion of naked melanin (82). In pathogenic fungi, melanins are often reported to be associated with or “in” the cell wall (35, 36, 50, 72, 79). However, there is variation between species: the melanin may be located external to the wall, e.g., in P. brasiliensis (79); within the wall itself (reviewed in reference 42); or as a layer internal to the wall and external to the cell membrane, e.g., in C. neoformans (22, 45, 85). However, mutants of C. neoformans bearing disruptions of three CDA genes involved in the biosynthesis of cell wall chitosan, or of CHS3, encoding a chitin synthase, or of CSR2, which probably regulates Chs3, all released melanin into the culture supernatant, suggesting a role for chitin or chitosan in retaining the pigment polymer in its normal intracellular location (3, 4). However, vesicles externalized from C. neoformans cells also show laccase activity (21), so the effect of chitin may be on vesicle externalization rather than on melanin itself. Internal structures compatible with mammalian melanosomes have been observed in Cladosporium carrionii (73) and in Fonsecaea pedrosoi (2, 26). Remarkably, F. pedrosoi also secretes melanin and locates the polymer within the cell wall (1, 2, 25, 27, 74).

Melanization has been found to play an important role in the virulence of several human fungal pathogens, such as C. neoformans, A. fumigatus, P. brasiliensis, S. schenckii, H. capsulatum, B. dermatitidis, and C. posadasii (among recent reviews are references 29, 42, 62, 74, and 79). From these and earlier reviews of the extensive literature, melanin has been postulated to be involved in a range of virulence-associated properties, including interactions with host cells; protection against oxidative stresses, UV light, and hydrolytic enzymes; resistance to antifungal agents; iron-binding activities; and even the harnessing of ionizing radiation in contaminated soils (15). The most extensively studied fungal pathogen for the role of melanization is C. neoformans, which possesses two genes, LAC1 and LAC2, encoding melanin-synthesizing laccases (52, 69, 90). It has been known since early studies with naturally occurring albino variants of C. neoformans (39) that melanin-deficient strains are attenuated in mouse models of cryptococcosis. Deletion of both the LAC1 and LAC2 genes reduced survival of C. neoformans in macrophages (52), and a study based on otherwise isogenic LAC1⁺ and LAC1⁻ strains confirmed the importance of LAC1 in experimental virulence (66). Other genes in the regulatory pathway for LAC1 are similarly known to be essential to virulence (12, 84).

C. albicans has been shown to produce melanin with DOPA as a substrate for production of the polymer (53). The cells could be treated with hot acids to produce typical melanin “ghosts,” and antibodies specific for melanin reacted with the fungal cells by immunohistochemistry with tissues from experimentally infected mice, demonstrating that C. albicans produces melanin in vivo (53). However, no candidate genes encoding laccases have yet been identified in the C. albicans genome (http://www.candidagenome.org/). In this study, we investigated the production of melanin by C. albicans and showed that its normal externalization from wild-type cells, including formation of melanosomes, can be altered to an intracellular and intrawall location by mutation of genes involved in chitin synthesis. C. albicans has four genes encoding chitin synthase enzymes. CHS1 is an essential gene under normal conditions (59), and its product is the main enzyme involved in septum formation (83). Chs3 forms the bulk of the chitin in the cell wall and the chitinous ring at sites of bud emergence (8, 51, 57), while Chs2 contributes to differential chitin levels found between yeast and hyphal forms of the fungus, and Chs8 influences the architecture of chitin microfibrils (43, 51, 55, 57, 58). We found that melanin externalization was unaffected in a chs8Δ mutant but was reduced or abrogated in chs2Δ and chs3Δ mutants. Expression profiles of melanin-producing cells grown in the presence of l-DOPA did not identify any potential laccase-synthesizing genes.

MATERIALS AND METHODS

Strains and growth conditions.

The C. albicans strains used in this study are listed in Table 1. Cultures were maintained on solid Sabouraud medium (4% [wt/vol] glucose, 1% [wt/vol] mycological peptone, 2% [wt/vol] Micro agar). Yeast cell cultures for inocula were grown at 30°C in Sabouraud broth with shaking at 200 rpm.

Table 1.

C. albicans strains and mutants used in this study

Strain	Genotype	Name used in paper	Reference
SC5314	Clinical isolate	SC5314	24
NGY152	ura3Δ::λimm434/ura3Δ::λimm434 RPS1/rps1Δ::CIp10	NGY152	7, 24
C154	ura3Δ::imm434/ura3Δ::imm434 chs2Δ::hisG/chs2Δ::hisG-URA3-hisG	chs2Δ	51
Myco3	ura3Δ::imm434/ura3Δ::imm434 chs3-2Δ::hisG/chs3-3Δ::hisG-URA3-hisG	chs3Δ	8
NGY137	ura3Δ::imm434/ura3Δ::imm434 chs2Δ::hisG/chs2Δ::hisG, chs8Δ::hisG/chs8Δ::hisG-URA3-hisG	chs2Δ chs8Δ	58
C156	ura3Δ::imm434/ura3Δ::imm434 chs2Δ::hisG/chs2Δ::hisG chs3Δ::hisG/chs3Δ::hisG-URA3-hisG	chs2Δ chs3Δ	51
NGY126	ura3Δ::imm434/ura3Δ::imm434 chs8Δ::hisG/chs8Δ::hisG-URA3-hisG	chs8Δ	58
RML2U	ecm33Δ:: hisG/ecm33Δ::hisG ura3Δ::imm434/ura3Δ::imm434::URA3	ecm33Δ	47
DSY168	cht2Δ::hisG-URA3-hisG/cht2Δ::hisG	cht2Δ	75
SPY24	cht3Δ::hisG cht3Δ::hisG-URA3-hisG	cht3Δ	75
DSY1741	cht2Δ::hisG-URA3-hisG/cht2Δ::hisG cht3Δ::hisG/cht3Δ::hisG	cht2/3Δ	75
FY1679-11D	MATaura3-52 LEU2 trp1Δ63 his3Δ200 GAL2	S. cerevisiae

Melanin production by C. albicans.

C. albicans yeast cells were grown overnight in 10 ml Sabouraud broth and centrifuged to concentrate the cells in the pellet. To generate semisynchronous yeast populations for inocula in some experiments, a sterile sucrose density gradient (17) comprising 30 ml each of 15%, 5%, and 2% sucrose solutions was set up in a 100-ml measuring cylinder. The C. albicans cells were layered on the gradient and allowed to stand for 2 h. The top layer of cells above the 2% sucrose layer was removed and centrifuged at 1,000 × g for 5 min and then resuspended in phosphate-buffered saline (PBS). The fungi were inoculated at 2 ×10⁶ cells ml⁻¹ in a defined liquid minimal medium (15.0 mM glucose, 10.0 mM MgSO₄, 29.4 mM KH₂PO₄, 13.0 mM glycine, 3.0 M vitamin B₁, pH 5.5) with or without 1.0 mM l-3,4-dihydroxyphenylalanine (DOPA) (Sigma, Dorset, England) at 35°C in the dark in a rotary shaker at 200 rpm. Under these conditions, C. albicans produces visible brown pigment, previously specifically identified as melanin, after several days of incubation (53). Samples were taken for melanin estimation at daily intervals. An absorption spectrum for melanized cultures measured against matched cell suspensions grown without DOPA indicated an absorption peak at 310 nm whose optical density (OD) correlated linearly with the amount of dark pigmentation in a dilution series, notwithstanding the probable contribution of light-scattering effects to the overall reading. Melanin production was therefore first approximated by measurement of the OD at 310 nm (OD₃₁₀) of the culture versus a matched, nonmelanized blank. It subsequently became apparent that the dark color of the cultures included soluble oxidation products of DOPA, so measurement of dark pigment presumed to be mainly melanin was achieved by determination of the OD₃₁₀ of centrifuged cell pellets resuspended in water to their original volume. Additional substrates, including N-acetylglucosamine (NAG) and glucosamine, were added to the medium in some experiments to investigate the possible influence of chitin substrates on melanin production previously demonstrated for C. neoformans (3, 4), since addition of NAG to C. albicans cultures stimulates chitin synthesis (13) and increases the cell wall chitin content (unpublished data). calcofluor white, an inhibitor that binds to cell wall chitin (28) and interferes with normal wall development (70), was added to cultures to a concentration of 100 μg ml⁻¹ in some experiments.

TEM.

C. albicans cultures were harvested by centrifugation, and the pellets were fixed in 2.5% (vol/vol) glutaraldehyde in 0.1 M sodium phosphate buffer (pH 7.3) for 24 h at 4°C. Samples were encapsulated in 3% (wt/vol) low-melting-point agarose prior to being processed in Spurr resin following a 24-h schedule on a Lynx tissue processor (secondary 1% OsO₄ fixation; 1% uranyl acetate contrasting; ethanol dehydration and infiltration with acetone/Spurr resin). Additional infiltration was provided under vacuum at 60°C before the samples were embedded in TAAB capsules (TAAB Laboratories, Amersham, United Kingdom) and polymerized at 60°C for 48 h. Semithin survey sections 0.5 μM thick were stained with1% toluidine blue to identify the areas with the best cell density. Ultrathin sections (60 nm) were prepared with a Diatome diamond knife on a Leica UC6 ultramicrotome and stained with uranyl acetate and lead citrate for examination with a Philips CM10 transmission microscope (FEI UK Ltd., Cambridge, United Kingdom) and imaging with a Gatan Bioscan 792 (Gatan UK, Abingdon, United Kingdom). Samples were also prepared by high-pressure freezing with a Leica EM PACT2 (Leica Microsystems [UK] Ltd, Milton Keynes, United Kingdom), as it is less prone to fixation artifacts. After being frozen, the cells were freeze-substituted in substitution reagent (1% OsO₄-0.1% uranyl acetate in acetone) with a Leica EM AFS2. Samples were cut and stained as described above. In some experiments, fixation and processing with osmium and uranium salts were omitted to determine whether unstained melanin could be detected by transmission electron microscopy (TEM).

Scanning electron microscopy (SEM).

Cultures were pelleted and resuspended in PBS. The cells were then incubated on coverslips coated with 0.01% polylysine and fixed with 2.5% glutaraldehyde in 0.1 M sodium phosphate buffer (pH 7.3) for 24 h at 4°C. The cells were postfixed with 1% OsO₄; dehydrated in 70%, 90%, 95%, and 100% ethanol; and critical-point dried in CO₂. The cells were sputter coated with gold using an EMitech K550 Sputter Coater and viewed in a JEOL 35CF scanning electron microscope at a voltage of 10 kV. A field emission scanning electron microscope was also used on some of the coated samples (see Fig. 3b and c and 10a and b).

Fig. 3.

Scanning electron micrographs of C. albicans SC5314 from cultures after 5 days with no addition of 1 mM DOPA (a) or with addition of 1 mM DOPA (b and c). Bar, 1 μm.

Fig. 10.

Electron micrographs possibly showing the process of externalization of melanin through the C. albicans SC5314 cell wall. (a and b) Field emission scanning electron micrographs with incompletely externalized melanin granules (bars, 1 μm [a] and 100 nm [b]). (c and d) Conventional TEM (c) and high-pressure frozen/freeze-substituted TEM (d) of cell walls containing probable melanin granules in the process of externalization. Bars, 0.2 μm.

Measurement of chitin synthase activity.

Mixed membrane fractions were prepared from exponential-phase yeast cells, and their chitin synthase activities were measured as described previously (56). Briefly, standard reaction mixtures were composed of 50 μg protein (measured with the Pierce Coomassie Protein Assay kit), 25 mM NAG, and 1 mM UDP-NAG, which included 25 nCi UDP-[U-¹⁴C]NAG, 50 mM Tris-HCl, pH 7.5, and 10 mM MgCl₂. The reaction mixtures were incubated at 30°C for 2 h, and the reactions were stopped by the addition of 1 ml of 66% (vol/vol) ethanol. The reaction mixtures were filtered through GF/C filter discs (Whatman), and the filters were washed four times with 2 ml of 66% (vol/vol) ethanol, trapping radiolabeled chitin on the filters. Radioactivity was then measured with a scintillation counter. Specific activities were expressed as nmol UDP-NAG incorporated into chitin min⁻¹ mg protein⁻¹. Assays were done in triplicate.

Measurement of pigment production in mixed membrane fractions.

Mixed membrane fractions as described above, containing 50 μg protein and the same buffer used for chitin synthase assays, were incubated with or without 1.0 mM DOPA in a Versamax tunable microplate reader (Molecular Devices, Wokingham, United Kingdom) with shaking at 35°C for 2 h. Melanin production in the mixed membrane fractions was measured by OD increase at 340 nm during the last 60 min of incubation. During this period, a linear OD change was detected in pilot experiments. Activities were expressed as OD increase h⁻¹ 50 μg protein⁻¹.

Expression profiling of RNA.

To identify genes highly expressed in melanized cells of C. albicans, quadruplicate samples from cultures with and without 1 mM DOPA were collected at 6-, 24-, 48-, and 72-h time points. The cells were flash frozen in liquid nitrogen, and RNA was extracted as described by Hayes et al. (33). Transcript profiles of C. albicans were determined as previously described (14, 23), but with the C. albicans oligonucleotide arrays Cersiono 1.1.3 from Operon Technologies (Huntsville, AL) in place of arrays supplied by Eurogentec. The arrays were printed with an Omnigrid 300 arrayer by Genomic Solutions (Ann Arbor, MI) on Corning UltraGap amino-saline-coated glass slides (Fisher Scientific, Pittsburgh, PA). Data were LOWESS (locally weighted scatterplot smoothing) normalized with GeneSpring software and sorted by median values to determine genes with RNA levels higher or lower by a factor of at least 2 in DOPA-grown cells versus cells grown for the same time in the absence of DOPA. Gene annotations were obtained from the Candida Genome Database (77).

Disruption of IPF18645.

IPF18645 was disrupted in the strain CAI4 (24) by the “mini-ura-blaster” strategy (89). For synthesis of the disruption cassette, the primer pair 5′-ATGATACATCAACGTACATTTTCAACTGATTCATTTAGTCCTAATAACAAACACAACAGCACCAGTACAATGTGGAATTGTGAGCGGATAand 5′-TTATTTACATAATTCTCTTAATGAATTAAGGAATTCAATTTCATAACCAACATTAACATATCGATAAGTAGTTTTCCCAGTCACGACGTT (sequences complementary to the 5′ and 3′ ends of the open reading frame [ORF] are underlined) was used to amplify by PCR the dp1200-URA3-dp1200 cassette from the plasmid pDDB57 (89). After the first round of transformation, the URA3 marker was recycled on selective medium (0.67% [wt/vol] yeast nitrogen base with ammonium sulfate and without amino acids, 2% [wt/vol]glucose, 0.077% [wt/vol] complete supplement mixture minus uracil, 50 μg ml⁻¹ uridine, and 1 mg ml⁻¹ 5-fluoroorotic acid), and disruption of the remaining allele was achieved following a second round of transformation.

Statistical tests.

SPSS version 18.0 was used for statistical analyses. Associations between melanin production and strain clades or strain virulence were tested by parametric and nonparametric correlations and by regression analysis with the general linear model.

Microarray data accession number.

The array data can be accessed at the Gene Expression Omnibus website (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE20338.

RESULTS

Kinetics of melanin production by C. albicans.

C. albicans SC5314, when incubated for 5 days in growth medium containing DOPA, produced a dark pigment with absorbance at 310 nm that was presumed to be melanin (Fig. 1a). Inocula were semisynchronous in all experiments illustrated in Fig. 1. No visible dark pigment was detectable over the same period in the absence of DOPA, regardless of additions of glucosamine or NAG (Fig. 1), and cells grown without DOPA were used as blanks for OD measurement. Dark coloration of the culture was visible to the eye by day 4. Addition of 1 mM NAG to the culture medium stimulated faster and greater production of melanin, and addition of 5 mM NAG resulted in strong production of visible pigment in the culture by day 2 (Fig. 1a). Increasing the DOPA concentration from 1 mM to 5 mM (Fig. 1b) enhanced the rate, but not the maximum OD, of pigment production. The combination of 5 mM DOPA and 5 mM NAG led to peak production of pigment on day 2 (Fig. 1b).

Fig. 1.

Melanin production by C. albicans SC5314 determined by OD₃₁₀ for whole cultures (a and b) and in resuspended cell pellets (c) in daily samples from cultures with various additions. The points are means of replicate experiments (n = 3 to 6), and the error bars indicate standard errors of the mean. (a) Open squares, cultures with 1 mM DOPA; open triangles, cultures with 1 mM DOPA and 1 mM NAG; open circles, cultures with 1 mM DOPA and 5 mM NAG. (b) Open squares, cultures with 5 mM DOPA; open triangles, cultures with 5 mM DOPA and 1 mM NAG; open circles, cultures with 5 mM DOPA and 5 mM NAG. (c) Mean ± standard deviation (SD) OD₃₁₀ for resuspended pellets of SC5314 cultures sampled at daily intervals. Open squares, cultures with 1 mM DOPA; open triangles, cultures with 1 mM DOPA and 1 mM NAG; open circles, cultures with 1 mM DOPA and 1 mM glucosamine (measured to 4 days only).

Centrifugation of the cultures to pellet the C. albicans cells showed that much of the dark pigment remained in the supernatant. However, high-speed centrifugation (600,000 × g) of the supernatant showed the pigment remained in solution. We interpret this as indicating that the supernatant pigment was a soluble oxidation product produced from DOPA and that pigment attributable to melanin remained bound to the cells. We therefore measured the OD₃₁₀ of the resuspended cell pellets as an approximation of the extent of cell-associated melanin. Figure 1c confirms that addition of NAG boosted the extent of cell-associated melanin and also indicates that addition of 1 mM glucosamine to the cultures only slightly stimulated melanin production in comparison with the more pronounced effects of NAG.

Subcellular location of melanin in C. albicans.

The production of melanin by C. albicans was seen by TEM as increasing numbers of electron-dense clumps located around the cell periphery. Similar clumps were never observed in DOPA-free cultures (Fig. 2a). Such particles have previously been established as melanin granules (53). In the presence of DOPA, small dark flecks were seen in and around the walls of some cells by day 3 (Fig. 2b), and larger melanin clumps were evident in 30 to 60% of the cell population by day 4 (Fig. 2c) and day 5 (Fig. 2d). By SEM (Fig. 3), the melanin clumps appeared as variably sized extracellular granules loosely adherent to the pseudohyphae (Fig. 3b) and yeasts (Fig. 3c). Similar structures were never seen in cultures grown without DOPA (Fig. 3a). We interpret these structures to be melanosomes that had been transported to the cell exterior, where they remained attached to the cell wall. While melanosomes in human melanocytes typically show a delimiting membrane by electron microscopy (76), a similarly self-evident bounding membrane is noted only for a minority of fungal melanosomes (2, 27, 73). When TEM sections were prepared without exposure to osmium and uranium salts, the externalized melanosomes remained electron dense and were seen clearly in cultures of C. albicans grown in the presence of DOPA (Fig. 4). The increased melanin production achieved by addition of NAG to the medium (Fig. 1a) appeared by TEM in the form of cells with a greater average number of melanosomes associated with the cell periphery (Fig. 5). While control cells remained free of external black granules in any form (Fig. 5a), some cells grown in DOPA plus 5 mM NAG were entirely coated with the melanosomes (Fig. 5b and c).

Fig. 2.

Transmission electron micrographs of C. albicans SC5314 from cultures after 5 days with no addition of 1 mM DOPA (a) or with addition of 1 mM DOPA sampled after 3 days (b), 4 days (c), and 5 days (d). Bars, 0.5 μm.

Fig. 4.

Transmission electron micrographs of unstained C. albicans SC5314 cultures after 5 days without DOPA (a) and with addition of 1 mM DOPA (b). The samples were not exposed to heavy metals at any stage of processing of fixation or processing of the sections. (b) The granules assumed to be melanosomes external to the yeast cell surface appear electron dense even without stain. Bars, 0.5 μm.

Fig. 5.

Transmission electron micrographs of C. albicans SC5314 grown for 5 days under control cultures (a) and in cultures containing 1 mM DOPA plus 5 mM NAG (b and c). (b and c) Profuse accumulations of melanosomes are seen surrounding cells grown with DOPA and NAG. Bars, 0.5 μm.

High-pressure frozen/freeze-substitution TEM retained greater detail of the C. albicans cell periphery (Fig. 6). In sections prepared by freeze-substitution, control cells showed a fimbriate layer external to the cell wall (Fig. 6a and b) that has been shown previously to be heavily enriched with mannoprotein (61). The melanosomes appeared to bind to the tips of these fimbriae (Fig. 6c and d). In none of the electron micrographs (Fig. 2 to 6) were the C. albicans melanosomes obviously enclosed in membranes, unlike some other illustrations of fungal melanosomes (2, 26, 73), but the size and form of the dark granules was otherwise consistent with the interpretation that they were indeed melanosomes.

Fig. 6.

High-pressure frozen/freeze-substitution TEM of C. albicans SC5314 grown without DOPA (a and b) and with 1 mM DOPA (c and d). (a and b) In control cells, a fimbriate outer cell wall layer was revealed by this technique. (c and d) In cells with a melanin coat, the melanin particles appeared to adhere to the tips of the hairy strands. Bars, 200 nm (a and c) or 100 nm (b and d).

Melanin production by clinical isolates of C. albicans.

We undertook a preliminary screen for melanin production among 43 clinical isolates of C. albicans that represented the four main clades of C. albicans strain types and a range of virulence levels for mice (44). After 5 days in medium containing 1 mM DOPA and 5 mM NAG, 13 isolates produced sufficient externalized melanin to generate resuspended pellets with OD₃₁₀ values of 0.3 or greater (Fig. 7). Eighty percent of the 8 isolates in clade 2 produced detectable pigment compared with fewer than 50% of isolates in other clades. Nevertheless, statistical analysis for possible associations between melanin production and clade or mouse virulence showed no significant results. The single isolate of Saccharomyces cerevisiae tested (Fig. 7) was a poor melanin producer. SC5314, the clade 1 strain used throughout these studies, was among the most prolific producers of melanin in this screen.

Fig. 7.

Melanin production by a selection of C. albicans isolates from each of the four major strain clades. The optical densities shown are for supernatants of cultures in DOPA plus NAG after 5 days of incubation. The experiment was performed only once.

Influence of DOPA on C. albicans SC5314 expression profiles.

In the absence of genomic information indicating a putative laccase in C. albicans, we sought to identify candidate genes encoding melanin biosynthetic functions by expression profiling experiments designed to identify genes significantly upregulated by growth in medium containing 1 mM DOPA. Samples were taken for profiling after 6 h, 24 h, 48 h, and 72 h of growth. We reasoned that any gene(s) involved in melanin biosynthesis might show increased expression by 48 h and 72 h, at which time visible dark pigment was apparent in the cultures. We assumed the relatively late appearance of dark pigment in the cultures indicated that melanin was probably a secondary metabolic product, produced after the exponential phase of growth, which was complete by 24 h.

Remarkably few genes showed altered expression levels in terms of RNA in DOPA-grown cells versus cells grown without the addition of DOPA to the culture. Table 2 lists genes at the four sample times with RNA levels in cultures containing DOPA that were at least 2-fold higher or lower than those in DOPA-free cultures. Only four genes appeared to be changed more than 2-fold in DOPA-grown cells in more than one sample: CUP5 was downregulated at 24 h and 48 h and IPF11713 was downregulated at 48 h and 72 h, while UGT51C1 and IPF18645 were upregulated more than 2-fold at 48 h and 72 h. None of the gene ontology (GO) annotations for any of these genes suggested an obvious role in melanogenesis. A double disruption of IPF18645 was achieved successfully, as demonstrated by replacement of the ORF by the dp1200 sequence (not shown). The mutant produced melanin in a manner comparable to that of wild type cells and so was not studied further.

Table 2.

C. albicans genes showing significant (>2-fold) transcriptional changes in DOPA-grown cells (from expression profiling with oligonucleotide arrays)

Sample time (h)	ORFa	Gene namea	Putative functionb	Avg change (log2 scale)
6
24	orf19.2765	PGA62	Putative GPI-anchored protein	−1.0
	orf19.5886	CUP5	Transporter	−1.1
48	orf19.2616	UGT51C1	UDP-glucose:sterol glucosyltransferase	1.1
	orf19.3216	IPF18645	Similar to Rab GTPase activators	1.0
	orf19.5886	CUP5	Transporter	−1.0
	orf19.1151	IPF11713	Induced in core stress response	−1.3
72	orf19.3216	IPF18645	Similar to Rab GTPase activators	2.4
	orf19.4890	CLA4	Protein serine/threonine kinase activity	1.9
	orf19.610	EFG1	Transcriptional repressor	1.8
	orf19.5231	IPF11273	ATP synthesis-coupled proton transport	1.8
	orf19.2616	UGT51C1	UDP-glucose:sterol glucosyltransferase	1.7
	CA00218_01	??c	??	1.6
	orf19.6029	ROT1	Similar toS. cerevisiae Rot1	1.3
	orf19.1435	TEF1	Translation elongation factor 1-alpha	1.1
	orf19.5505	HIS7	Putative imidazole glycerol phosphate synthase	1.1
	orf19.2515	IPF12799	Unknown	1.1
	orf19.4755	KEX2	Subtilisin-like protease	1.0
	orf19.706	NMD3	RNA binding protein	−1.0
	orf19.5872	SNF5.5f	Unknown	−1.1
	orf19.4889	HOL2	Predicted membrane transporter	−1.1
	orf19.2480.1	AUT7	ER-to-Golgi apparatus vesicle-mediated transport	−1.1
	orf19.3228	IPF171	Unknown	−1.2
	orf19.1151	IPF11713	Induced in core stress response	−1.8
	orf19.1585	ZRT2	Low-affinity zinc ion transporter	−2.5

^aFound by searching the Candida genome database (http://www.candidagenome.org/).

^bGO annotation from Candida genome database. GPI, glycosylphosphatidylinositol; ER, endoplasmic reticulum.

^cAn oligonucleotide with array reference no. CA00218_01 could not be confidently identified with any known gene, even by BLAST search with the Candida genome database.

Melanin production is altered in some chitin pathway mutants of C. albicans.

The boost to melanin production engendered by the addition of NAG to DOPA cultures suggested possible involvement of the chitin synthesis pathway in the synthesis or other aspects of production of melanin by C. albicans. Moreover, deletion of chitin synthase-encoding genes in C. neoformans is known to lead to the appearance of melanin outside the cells (4). A set of C. albicans mutants was therefore tested for melanin production. They included mutants with single and double deletions in genes encoding chitin biosynthesis enzymes and chitinases; ACE2, which encodes a regulator of cytokinesis-associated processes and cell wall metabolism (37); and ECM33, which encodes a protein that regulates cell wall integrity (46, 47). The production of melanin by these mutants with and without addition of NAG to the DOPA medium is summarized in Table 3. Among the chitin synthase mutants tested, melanin was measured at levels comparable to those in wild-type cells in the chs8Δ mutant but was eliminated in the chs2Δ mutant and reduced in the chs3Δ mutant (Table 3), clearly suggesting a relationship between some forms of chitin synthesis and the retention of melanin in the cell. For the chs2Δ chs3Δ double mutant, melanin production data were similar to those for the chs3Δ single mutant, while melanin OD values for the chs2Δ chs8Δ double mutant were similar to those of the wild type in the absence of NAG but lower than those of the wild type when NAG was included in the culture (Table 3).

Table 3.

Melanin production by C. albicans after 5 days of growth

Strain	NAG addeda	Resuspended pellet OD310b
NGY152	−	0.3 ± 0.2
NGY152	+	1.2 ± 0.1
chs2Δ	−	0.0 ± 0.0
chs2Δ	+	0.0 ± 0.0
chs3Δ	−	0.0 ± 0.0
chs3Δ	+	0.2 ± 0.1
chs8Δ	−	0.1 ± 0.1
chs8Δ	+	1.2 ± 0.1
chs2Δ chs3Δ	−	0.0 ± 0.0
chs2Δ chs3Δ	+	0.4 ± 0.0
chs2Δ chs8Δ	−	0.4 ± 0.1
chs2Δ chs8Δ	+	0.5 ± 0.0
cht2Δ	−	0.0 ± 0.0
cht2Δ	+	0.5 ± 0.1
cht3Δ	−	0.0 ± 0.0
cht3Δ	+	0.4 ± 0.1
cht2Δ cht3Δ	−	0.1 ± 0.1
cht2Δ cht3Δ	+	0.5 ± 0.1
ace2Δ	−	0.3 ± 0.0
ace2Δ	+	1.4 ± 0.2
ecm33Δ	−	0.0 ± 0.0
ecm33Δ	+	0.0 ± 0.0

^a+, added; −, not added.

^bMean ODs of duplicate resuspended cell pellets grown for 5 days in medium containing 1 mM DOPA with and without addition of 1 mM NAG.

Among the other chitin pathway mutants tested (Table 3), the ace2Δ mutant produced dark pigment at levels comparable to those of the control strain, while melanization was reduced in the cht2Δ, cht3Δ, and cht2Δ cht3Δ mutants, and no pigmented cells were formed by the ecm33Δ mutant, even when NAG was included in the medium (Table 3), indicating that a functional ECM33 gene is probably required for production of the cell wall chitin component involved in melanin externalization.

Chitin and melanin production by mixed membrane fragments from C. albicans mutants.

The finding of small or negligible amounts of melanin pigment on cells of some chitin pathway mutants prompted us to test the possibility that chitin synthase enzymes are directly involved in the synthesis of melanin. This involved assays with mixed membrane fractions, which have been previously used in our laboratory to investigate chitin synthesis (56). To validate the mixed membrane fractions, the chitin synthesis assay was conducted with NGY152 cells grown for 5 days in liquid minimal medium. The mean specific chitin synthase activity was measured at 0.68 ± 0.38 nmol min⁻¹ mg protein⁻¹ in untreated mixed membrane fractions and 2.2 ± 1.7 nmol min⁻¹ mg protein⁻¹ in membrane fractions activated with trypsin. Addition of 5 μM nikkomycin Z reduced these activities to 0.11 ± 0.05 and 0.14 ± 0.02, respectively. These results confirmed that the control mixed membrane fractions synthesized chitin normally.

Mixed membrane fractions prepared from NGY152 and several mutant strains showed no change or a very slight decrease in OD₃₄₀ during the second hour of incubation at 35°C in the absence of DOPA. The same fractions incubated with 1 mM DOPA included in the mixture showed an OD increase, suggestive of melanin biosynthesis, over the same period, as follows: NGY152, 0.047; chs2Δ, 0.070; chs3Δ, 0.065; chs8Δ, 0.058; chs2Δ chs3Δ, 0.052; chs2Δ chs8Δ, 0.069; cht2Δ, 0.063. These results indicated that all the mutants were able to synthesize melanin from subcellular mixed membrane fractions at essentially similar rates and that the synthesis of melanin was not in itself dependent on chitin synthesis.

Location of melanin in chitin synthase mutants.

High-pressure frozen/freeze-substitution TEM of the various chitin synthase mutants (Fig. 8) illustrated the difference between the synthesis of melanin, shown biochemically to occur similarly in all strains, and the externalization of melanin, which was repressed, particularly in the chs2Δ mutant (Table 3). The micrographs suggested that the location of melanin inside the cells, apparently trapped within the cell wall, or fully externalized as in control cultures, may have depended on the structural type of chitin present in the cell walls. In the absence of DOPA, cells of all the mutants were indistinguishable by TEM from the wild type (Fig. 6a); none of the mutations, therefore, led to phenotypic changes in the cell wall that were visible by TEM. Figure 8a shows a control cell of the chs2Δ chs8Δ mutant as an example. When grown in DOPA (Fig. 8b) or DOPA plus NAG (Fig. 8c), the chs2Δ mutant showed an accumulation of melanin grains and/or melanosomes within the cells with no externalized melanosomes. Occasionally, a melanosome appeared to be embedded within unidentified intracellular material (arrows in Fig. 8c). When grown in DOPA (Fig. 8d), the chs3Δ mutant also appeared to have retained most melanin within the cells. However, when grown in DOPA plus NAG (Fig. 8e and f), while occasional melanosomes were seen outside the cells, the melanin mostly remained within the cells and often appeared to be fixed within the cell wall without being released to the exterior. In contrast, chs8Δ mutant cells showed a wild-type appearance with externalized melanosomes whether grown in DOPA alone (Fig. 8g) or DOPA plus NAG (not shown). Grown in DOPA (Fig. 8h and i) or DOPA plus NAG (Fig. 8j), the chs2Δ chs3Δ double mutant appeared to have all its melanosomes contained within an intracellular substance similar to that seen with the chs2Δ mutant alone (Fig. 8c). However, the chs2Δ chs8Δ double mutant grown with DOPA or DOPA plus NAG externalized melanosomes in the same manner as wild-type cells (Fig. 8k and l). The TEM thus confirmed the results of melanin measurement by OD (Table 3): high OD readings were obtained only with cells of the CHS mutants that externalized melanin.

Fig. 8.

High-pressure frozen/freeze-substitution TEM of C. albicans chitin synthase mutants grown for 5 days under different melanin-inducing conditions: control, medium containing 1 mM DOPA or medium containing 1 mM DOPA plus 5 mM NAG. (a) chs2Δ chs8Δ control cells. (b) chs2Δ cells grown in DOPA. (c) chs2Δ cells grown in DOPA plus NAG (the arrows indicate a melanin granule embedded within an unidentified intracellular material). (d) chs3Δ cells grown in DOPA. (e and f) chs3Δ cells grown in DOPA plus NAG. (g) chs8Δ cells grown in DOPA. (h and i) chs2Δ chs3Δ cells grown in DOPA. (j) chs2Δ chs3Δ cells grown in DOPA plus NAG. (k) chs2Δ chs8Δ cells grown in DOPA. (l) chs2Δ chs8Δ cells grown in DOPA plus NAG. Bars, 0.5 μm in all micrographs except f and i, where the bars are 200 nm.

Effects of calcofluor white on melanin externalization.

Inclusion of calcofluor white at 100 μg ml⁻¹ in the DOPA-based melanin-inducing medium boosted melanin production in a manner similar to the effects of NAG. The melanin pigmentation appeared within 2 days in cultures containing calcofluor white, and the culture OD₃₁₀ reached a mean of 0.98 ± 0.17 after 5 days compared with 0.37 ± 0.10 in the absence of calcofluor white. TEM showed elongated externalized melanosomes, which appeared to contain dark-pigmented melanin and another substance (Fig. 9a). TEM of unstained, calcofluor white-treated cells confirmed the dark component of the externalized bodies to be melanin (compare Fig. 9b and 4b).

Fig. 9.

Transmission electron micrographs with (a) and without (b) heavy metal staining after 5 days of growth in the presence of 1 mM DOPA and 100 μg ml⁻¹ calcofluor white. For comparison, see the control cells in Fig. 2a and 4a. The externalized melanin granules have a different appearance than those in cells grown without calcofluor white (Fig. 2d and 5b). Bars, 0.2 μm.

Extrusion of melanin through the C. albicans cell wall.

The data presented suggested that components of the pathway involved in synthesis and deposition of chitin in the cell wall were involved in externalization of melanosomes: in particular, in the absence of CHS2, no melanin externalization occurred, and in the absence of CHS3, normal melanin externalization was impaired, with melanin retained in the cell wall. This hypothesis depends on the concept that melanosomes are formed intracellularly and exported intact through the cell wall. Throughout our experiments, occasional transmission and scanning electron micrographs of wild type SC5314 cells suggested such an externalization process captured in progress; Fig. 10 provides examples.

DISCUSSION

Whether or not melanin production is a required attribute of C. albicans in its role as a commensal or pathogen, it is unequivocal from this and a previous study (53) that addition of DOPA to a culture of the fungus in a minimal medium readily stimulates melanin formation. Many strains of C. albicans form melanin under DOPA stimulation, though some do so more readily than others (Fig. 7). The melanin is produced after cessation of active growth and is therefore a likely secondary metabolite. Unless C. albicans cultures are synchronized (we used a longstanding approach for separating small single yeast cells that grow semisynchronously [17]), the time of appearance of melanin in DOPA-based cultures can be highly variable, ranging from 4 to 8 days. Some of the interstrain variation seen in our preliminary screen for melanin (Fig. 7) may therefore have resulted from this type of variability.

Our use of optical density measurements with resuspended cells provided a simple but nonspecific assay for melanization. It excluded measurement of soluble pigments that might have been DOPA oxidation products but that gave negative results with mutant strains in which melanin was clearly produced inside the cells (Fig. 8b to d) but in which melanosomes were not externalized (Table 3). The reduced cell pellet ODs for the chs3Δ mutant (Table 3) may reflect the presence of melanin located within the cell wall (Fig. 8e and f) but without full externalization of melanosomes. Throughout the study, we regarded OD measurement as an approximate measure of the extent of melanin externalization; the electron micrographs provide the firm evidence for melanin production and externalization.

At present, no obvious laccase-encoding sequences have been identified in the Candida genome database (http://www.candidagenome.org/), and no gene annotations suggest a role for any of the identified C. albicans ORFs in melanin biosynthesis. C. albicans contains a number of genes encoding multicopper oxidases, the same type of enzyme as laccases (FET3, FET31, FET33, FET34, FET35, and FET99), but none of them showed even minor changes in the expression profiles of DOPA-grown cells (data not shown). A null mutant of C. albicans FET3 was not attenuated in mouse virulence (20). FET34 and FET35 are involved in stress responses (6, 23, 40, 71), while FET99 is involved in iron transport (38). Future work is needed to investigate possible associations of the FET gene family and melanization of cells. Disruption of the IPF18645 gene, chosen from our expression-profiling results on the basis of its prominent upregulation under conditions of pigment formation, did not affect the mutant's melanin phenotype. UGT51C1, the other gene that showed expression differences in DOPA-grown cells (Table 2), has been well characterized as encoding a sterol glucosyl transferase (86) and is therefore unlikely to be a candidate for melanin biosynthesis. Overall, therefore, we were unable to uncover any gene that might be critical for biosynthesis of melanin and thus to investigate its possible role as a virulence factor in vivo. Production of melanin by C. albicans in vivo was established previously (53).

Investigation of C. albicans melanin production by several approaches revealed an interplay between the appearance of melanin in cultures and the biosynthesis or deposition of cell wall chitin. The chitin synthase chs2Δ and chs3Δ null mutants were grossly defective in melanin externalization, although disruption of CHS8 did not alter the process. Disruption of both CHS2 and CHS8 led to a wild-type melanin externalization phenotype, which suggests that the CHS gene products are unlikely themselves to be involved in melanin synthesis, but rather, the forms of chitin they produce in the cell wall play a role in the externalization of melanin. Dark pigment was synthesized at similar rates in mixed membrane preparations from all the CHS deletion mutants, suggesting that biosynthesis of pigment proceeded regardless of chitin synthesis capacity.

Our study with C. albicans shows that in this species, as in C. neoformans (3, 4), a link exists between chitin synthesis and melanin production. In C. albicans, chitin is synthesized by the enzyme products of four genes, CHS1, CHS2, CHS3, and CHS8, and is coordinately regulated by at least three signaling pathways (57). While CHS1 is an essential gene under normal conditions (59), the other three chitin synthase genes are not essential for viability. All four chitin synthase genes are able to compensate for each other functionally, even though they are normally specifically associated with synthesis of chitin in different wall locations and at different stages of the cell cycle; even cells with double gene disruptions in CHS1 and CHS3 retain viability for a small number of generations and form salvage septa, albeit with an aberrant structure, at cell division (83). Chs1 is the dominant synthase involved in the formation of chitinous intercellular primary septa in C. albicans, while Chs3 forms the bulk of “generalized” cell wall chitin and the ring of chitin at sites of bud emergence (8, 51, 56, 57). Chs8 is required for the synthesis of chitin in the form of long fibrils, while Chs3 deposits chitin in the wall as short rodlets (43). No definable chitin micromorphology has yet been found for the products of Chs1 and Chs2. It seems likely that generalized deposition of chitin in C. albicans cell walls results from the activities of Chs2 and Chs8, as well as Chs3, with different contributions to wall synthesis in the yeast and hyphal forms of the fungus (43, 51, 55, 57).

Our study provides clear evidence that melanosomes are formed intracellularly in C. albicans and travel through the cell wall to the exterior: the various CHS gene family mutants all synthesize pigment assumed to be melanin in mixed membrane fractions but show aberrations in the externalization process in intact cells. Moreover, some electron micrographs (Fig. 10) provided visual evidence consistent with melanin granules passing through the cell wall. Because melanin externalization differs according to which member of the CHS gene family is specifically disrupted, we conclude that it is the finished chitin product in the cell wall that regulates melanin externalization, rather than the chitin synthase enzymes themselves. Melanosomes are retained within the cell cytoplasm in the absence of a functional CHS2 gene and cannot be externalized (Fig. 8b and c). In the absence of Chs3, melanin production progresses to a location within the cell wall structure but without complete externalization (Fig. 8f). Normal melanin externalization can proceed in the absence of Chs8 (Fig. 8g), and deletion of CHS8 in a chs2Δ mutant restored externalization. We interpret these findings as indicating that the Chs8-dependent chitin product, i.e., long microfibrils, is a factor that blocks melanin externalization but that this product is not abundant in wild-type cell walls. We hypothesize that, in the absence of Chs2, Chs3, or both enzymes, the amount of cell wall chitin synthesized by Chs8 increases and reduces or prevents externalization of melanin. When CHS8 is disrupted in a chs2Δ background, the absence of cell wall chitin from Chs8 allows melanin to externalize normally. Our model also implies a role for chitin from Chs3 in the melanin externalization process. The short chitin rodlets synthesized by Chs3 are required in the cell wall for melanin granules to pass completely through the complex C. albicans wall structure: in their absence, the chs3Δ and chs2Δ chs3Δ mutants accumulate melanosomes within the cell wall layers, and few pass beyond the wall to the exterior. This model implies no specific role for chitin synthesized by Chs2 in wild-type melanin externalization beyond occupying places in the cell wall that might otherwise be occupied by the Chs8 product. Because conditional mutants in CHS1 survive for only a small number of generations under repressing conditions (83), we were unable to investigate a possible specific role for the Chs1 enzyme product in melanin externalization. CHS1 expression was upregulated in all the CHS mutants we tested, except chs2Δ (57), yet their melanin phenotypes differ markedly. Moreover, since the known main function of Chs1 is related more to synthesis of septa than to synthesis of cell wall chitin (57, 59), we consider that chitin synthesized by Chs1 is unlikely to play an important role in melanin externalization.

Further pieces of evidence corroborate our model of melanin externalization dependent on the types of chitin present in the C. albicans cell wall. The dose-dependent boost of melanin formation by NAG (Fig. 1) was nonspecific, since NAG increased melanin externalization by all tested strains and mutants except chs2Δ. NAG in C. albicans culture medium boosts chitin synthase activity (13), and exogenous NAG or glucosamine leads to elevated cell wall chitin levels (K. K. Lee, H. M. Mora-Montes, S. Selvaggini, C. A. Munro, and N. A. R. Gow, unpublished data). We therefore assume that the effect of NAG on melanin production is to augment externalization by stimulation of chitin levels in cell walls. While the specific roles of the four chitinase genes in C. albicans has not yet been fully defined, they are known to function, as in other fungi, as determinants of cell morphology and cell separation after mitosis (18, 19, 34, 48, 49). They may also be involved in the modeling and remodeling of chitin fibrils (31), a concept supported by the finding that the CHS and CHT genes are both regulated (though not coupled) during C. albicans morphogenesis (75). Our finding that melanization was reduced in the cht2Δ, cht3Δ, and cht2Δ chs3Δ mutants is therefore compatible with the view of chitin microarchitecture as the major influence on melanin externalization. Similarly, the reduced melanization of cells of the ecm33Δ mutant is predictable from the known role of Ecm33 as a key regulator of C. albicans cell wall structure (46, 47); in A. fumigatus, the homologous gene has been shown to affect the cell wall chitin content (11). In contrast, C. albicans Ace2, although a contributor to regulation of chitinase activity (37), plays a much wider gene regulatory role in cytokinesis of yeasts (37, 54, 78). Disruption of ACE2 in C. albicans did not affect the externalization of melanin.

In many transmission electron micrographs of CHS mutants grown under melanizing conditions, melanosomes were located within amorphous, electron-lucent material in C. albicans cells (Fig. 8b, c, e, h, i, and j). A similar appearance of melanosomes is shown in one set of micrographs of F. pedrosoi (26). In human melanocytes, the melanosomes are sometimes complexed with an electron-lucent lipid-protein aggregate called lipofuscin (76). It is tempting to speculate that some equivalent encapsulation of melanosomes may explain the material found surrounding them in C. albicans.

It is possible that C. albicans may represent a model organism for the study of rudimentary melanosome formation and transport, since our CHS mutants appear to arrest the processes at specific stages of cross wall transport and externalization. A growing body of evidence implicates vesicular transport mechanisms as the basis for the transport of macromolecules across fungal cell walls (10, 21). The ready visual identification of melanin in electron micrographs further suggests that the C. albicans melanin model may offer useful insights into such processes.