Skip to main content
PLOS One logoLink to PLOS One
. 2018 Sep 28;13(9):e0204905. doi: 10.1371/journal.pone.0204905

Genetic characterization of the artisanal mud crab fishery in Myanmar

Iris Segura-García 1,*, Thu Yain Tun 2, Stephen J Box 1,2
Editor: Tzen-Yuh Chiang3
PMCID: PMC6161904  PMID: 30265718

Abstract

Fish are important for food supply, especially in developing countries. In Southeast Asia, including Myanmar, the mud crab fishery is an important livelihood that represents a valuable source of income and food to coastal communities. However, the increasing demand for mud crab in domestic and international markets and poor management has generated concern about the status of this fishery across Southeast Asia. In this region, at least four species of mud crab in the genus Scylla are recognised but their correct identification and occurrence remain to be fully explained. Relying on accurate taxonomic identification of mud crab species represents the cornerstone of the successful implementation of management plans as life history biology and relative exploitation rates may vary by species due to gear susceptibility. Toward this aim, tissue samples from mud crabs were collected from four fishing communities of the Mergui archipelago, in the Tanintharyi region of southern Myanmar. All crab samples were DNA barcoded for species identification through sequencing. This study is the first genetic characterization of the mud crab fishery in Myanmar and revealed that Scylla olivacea was the only species found in the sampled fisheries of the Tanintharyi region. The populations studied across the Mergui archipelago did not show evidence of genetic structure, but gene flow appeared to be limited among conspecifics from neighbouring countries.

Introduction

Mud crabs in the genus Scylla (de Hann 1833) are large edible crustaceans associated with mangroves throughout the Indo-West Pacific region [1,2]. They are a valuable marine food product in domestic and export markets that constitute an important source of income for coastal fishing communities [3,4]. Unfortunately, the lack of adequate management to regulate catches by small-scale fisheries has generate a concern about the status of this fishery. The knowledge of the species molecular identity, composition and population dynamics of the fishing stocks are still scarce, thus precluding the appropriate management actions.

Mud crab species in the genus Scylla exhibit high polymorphism in coloration and size, with overlapping morphologies and habitats between species, which has resulted in a controversial taxonomy since the early description of Cancer serratus from the Red Sea in 1775 by Forskål [5]. Several attempts to clarify these nomenclatural and identification difficulties have been conducted locally in Southeast Asia including the Philippines [6], Vietnam [7], and Japan [8]. These studies led to a revised taxonomy of mud crabs in the genus Scylla across the Indo-Pacific, using external morphology and genetic variations, to recognize four currently accepted non-hybridizing species; S. serrata (Forskål 1775), S. tranquebarica (Fabricius 1798), S. olivacea (Herbst 1796), and S. paramamosian (Estampador 1949) [5,9]. Local evaluations across Southeast Asia were also conducted following Keenan et al. (1998) taxonomic review to reveal the actual species occurring locally in Vietnam [10], China [11], Bangladesh [12], Thailand [13], Japan [14], and India [15].

In Myanmar, “crabbing” is a flourishing practice mostly practiced throughout the mangroves and tidal flats of the Ayeyarwaddy delta in Rakhine state [4] and the Tanintharyi region in south Myanmar. Despite their commercial importance little is known about the occurrence of mud crab species in the fishery, which is a major constraint for stock assessment, the development of aquaculture and regulation of the fishery [16]. The correct identification of species occurring in Myanmar and their contribution to the mud crab fishery represent a critical starting point to characterize and to promote appropriate regulations base on species biology. In this regard, DNA barcoding provides a well-established method for species identification by using standard fragments of the mitochondrial DNA cytochrome oxidase subunit I gene (mtDNA COI) to detect differences among species [17]. This method has been successfully used to identify a broad range of marine organisms (see [18]).

The aim of the present study was to identify the species of harvested mud crab from the fishery communities in the Mergui archipelago using DNA barcoding, and to investigate the genetic diversity and population structure across the Mergui archipelago, in the Tanintharyi region, the largest crabbing region in Myanmar. We resolve the taxonomy of locally harvested mud crabs and population structure based on mtDNA COI data, as critical information contributing to the broader understanding of the mud crab fishery in the region.

Method

Sampling and DNA extraction

In Myanmar, mud crabs are caught using baited traps, normally with sardine, which are set at the beginning of the high tide and retrieved at the end of the high tide (4–6 h later). The daily catch is normally stored in warehouses until export or transport to soft-shelled crab farms where the individuals are kept alive until they molt. While mud crabs were being prepared for storage, tissue samples, typically leg segments, were collected in four major crabbing communities of the Mergui archipelago in the Tanintharyi region and from a mud crab aggregating center in Myeik city during 2016–2017 (Fig 1). For each individual crab sampled, we recorded sex and size as internal carapace width (CW in mm). Tissue samples were dry-preserved in silica gel until processed for DNA barcoding. Genomic DNA was extracted using the DNeasy extraction kit (Qiagen, CA).

Fig 1. Studied area in the Mergui archipelago showing fishing communities included in this study and sample sizes.

Fig 1

DNA barcoding and PCR-based species identification

Fragments of 515 base pairs (bp) of the gene COI were amplified in 25 μL volume PCRs, consisting of 25 nM Tris-HCL, 25 nM NaCl, 2.5 mM MgCl2, 0.4 mM each dNTP and 0.08 mM of each primer: C/N 5' TT AAG TCC TAG AAA ATG TTG RGG GA 3' and mtd10 5' T TGA TTT TTT GGT CAT CCA GAA GT 3' [19], and 0.5 units of GoTaq Flexi (Promega). The cycling profile consisted of a denaturation step of 5 min at 94°C, followed by 35 amplification cycles of 30 sec at 52°C, 45 sec at 72°C and 30 sec at 94°C and a final elongation step of 5 min at 72°C. PCR products were purified with Exo-SAP-IT (Affymetrix, Inc., Santa Clara, CA, USA). PCR products were sequenced using BDX64 enhancing buffer (MCLAB, San Francisco, CA, USA) and the Big Dye Terminator v3.1 cycle sequencing (Applied Biosystems, Foster City, CA, USA) following the MCLAB BDX64 protocol and analyzed on an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA) at the Smithsonian Laboratory for Applied Biology in Washington, DC. Sequences were checked for base call using the software Geneious 10.0.5 (http://www.geneious.com, [20]), and were aligned using CLUSTAL X [21]. All checked sequences were compared to homologous mt DNA COI sequences using two searchable databases: BOLD to search the Barcode of Life Data Systems and NCBI nucleotide repository with BLASTn on GenBank. We established confidence values for both BLASTn (identity > 98%) and BOLD (similarity > 98%) to ensure the reliable identification of species for each sample.

Samples resulting in an ambiguous BLASTn or BOLD score (>98%) for congeneric species, e.g. between S. serrata and S. olivacea, were amplified for species-specific COI fragments using a set of primers previously developed for PCR-based species identification (see [22]).

Genetic characterization of the mud crab population

Unique mtDNA COI haplotypes were identified using DNAsp version 6 [23]. Haplotype diversity (h), nucleotide diversity (π), Tajima’s D and Fu’s Fs test for selective neutrality, and inbreeding coefficients (FST and ΦST),were estimated using ARLEQUIN 3.5.2.2 [24]. Comparisons against conspecifics from neighboring countries were for 460 bp of COI overlapping sequence for samples from the Bay of Bengal (GenBank accession numbers KT964568KT964599), Malaysia [25], India [22], and Bangladesh (GenBank accession numbers KX959992-KX959996), for ΦST analysis conducted in ARLEQUIN 3.5.2.2 [24]. In addition, DNA divergence between S. olivacea and S. serrata [26] was estimated as implemented in DNAsp version 6 [23].

Phylogenetic relationships among mtDNA COI haplotypes (515 bp) of S. olivacea were examined with a median-joining network (MJN) rooted with homologous sequences from S. serrata as an outgroup. The network was generated with the program NETWORK 4.5.1.0 [27]. Historical demography was investigated using mismatch distributions, the frequency distributions of pairwise differences between sequences [28]. An index of time since expansion expressed in mutational time (τ = 2μt, where μ is the mutation rate/generation and t is time in generations), was estimated by a generalized non-linear least square approach using ARLEQUIN 3.5.2.2 [24].

Results

Genetic species identification

A total of 284 mud crabs out of 286 analysed were identified as Scylla olivacea, two samples could not be identified due to low DNA sequence quality. Partial sequences of 515 bp of the mtDNA COI gene were successfully obtained for N = 282 mud crabs, of these 208 sequences returned an unambiguous hit (>98% identity) to S. olivacea with BLASTn, only 74 sequences returned an ambiguous match between S. olivacea and S. serrata showing high percentage of identity ranging from 97.9–100% for both species when compared to existing barcodes in BLASTn. The BOLD search resulted in all sequences with an ambiguous match between these two species, also with a high percentage of similarity scores (S1 Table). The amplification of an additional fragment of 212 bp of the mtDNA COI gene by species-specific PCR resolved the species ambiguity and confirmed identification of 284 crabs as S. olivacea. Likewise, DNA divergence between COI sequences of S. olivacea, this study, and published data from S. serrata was higher than divergence between S. olivacea from two different localities (Table 1).

Table 1. DNA divergence of COI haplotypes between Scylla olivacea and S. serrata.

S. olivacea
Myanmar
S. olivacea
Bay of Bengal
S. olivacea
Malaysia
S. serrata
Indo-West Pacific
Scylla olivacea
Myanmar
3.752 3.997 48.822
Scylla olivacea
Bay of Bengal
0.009
4.477 69.736
Scylla olivacea
Malaysia
0.011
0.009
69.448
Scylla serrata
Indo-West Pacific
0.152 0.153 0.152

DNA Divergence of COI haplotypes (515 bp) between conspecific populations and between Scylla olivacea and S. serrata. Lower diagonal: Dxy = Average number of nucleotide substitutions per site between species, upper diagonal: average number of differences between groups. The large interspecific divergence between S. olivacea and S. serrata is shown in bold.

Genetic characterization of the mud crab population

Among the 282 sequences analyzed of 515 bp, 40 COI haplotypes showing 39 variable sites were identified (Table 2). Overall, estimates of haplotype diversity were high, ranging from 0.719 to 0.791, and nucleotide diversities were low (Table 3).

Table 2. Scylla olivacea COI haplotype alignment and frequency by sampling location.

Nucleotide position Locations
Haplotype 1111111112222222223333333333333333445 592225789990123455790000133445556789450
430363162584387035040369836891476246197
MK TN PZ PN MA
Hap1 CTTTAGATCCGCTCATAGACATTTCACCCATCTACTTGA 14 35 16 22 13
Hap2 ..........A.............T.............. 1 3 1
Hap3 .......C...........................C... 1
Hap4 ...........................T.......C... 1
Hap5 ....GA...............C.............C.A. 10 38 16 13 17
Hap6 ...............C........T.............. 1
Hap7 T..................................C... 2
Hap8 ....GA......C........C.............C.AG 1
Hap9 ....GA...........A.................C... 1
Hap10 ....GA....A..........C.............C.A. 3
Hap11 ....GA.......T.......C.............C.A. 1
Hap12 ..C.GA...............C.........T...C.A. 2
Hap13 ..C.GA.............T.C.............C.A. 1 2 2 2
Hap14 ....GA...............C.......T.....C.A. 1 1
Hap15 ....GA...............C.......T...G.C.A. 1
Hap16 ....GA...............C..........C..C.A. 1
Hap17 ....GA...............C.......G.....C.A. 1 1
Hap18 ....GAG..............C.............C.A. 1
Hap19 .C..GA............G..C.............C.A. 3 5 6 2 7
Hap20 .C.CGA.....T......G..C.............C.A. 1
Hap21 .C..GA............G..C..T..........C.A. 1 1
Hap22 CC.CGA............G............C....TA. 1
Hap23 .............................T.....C... 1 1
Hap24 .....C...T...................T....TC... 1
Hap25 ..C....................C...........C... 2 1 1
Hap26 ........A..............C...........C... 2 1 2 1
Hap27 .........................G.........C... 1
Hap28 .........TA........................C... 1
Hap29 T..............................T...CC.. 1
Hap30 .........T.........................C... 1 1
Hap31 ............................T......C... 1
Hap32 .................C.................C... 1
Hap33 .............................G.....C... 1
Hap34 ..............G........C...........C... 1
Hap35 ..........A...............T............ 1
Hap36 ..............................C....C... 1
Hap37 ......G............................C... 1
Hap38 ....GA..............GC.............C.A. 1
Hap39 .C..GA............G..CC............C.A. 1
Hap40 ................G.................—— 1

List of COI haplotypes (515 bp) derived for Scylla olivacea showing alignment, variable sites and frequency by locations. Location abbreviations: MK = Myeik, TN = Taw Naukle, PZ = Pan Zin, PN = Pha Nut, MA = Ma Aing.

Table 3. Genetic diversity, tests for neutrality and population expansion indexes.

Myeik Taw Naukle Pan Zin Pha Nut Ma Aing Overall
π 0.092 0.085 0.104 0.081 0.115 0.129
h 0.719 0.739 0.791 0.745 0.789 1
tau 4.852 4.469 5.197 4.121 6.188 4.5
Expansion time (years) 242 600 223 450 259 850 206 050 309 400 225 000
D -0.712 -0.941 -0.206 -1.001 -0.119 -1.563
D (p) 0.252 0.19 0.48 0.169 0.54 0.032
Fs 0.353 -6.315 -2.299 -3.75 -0.627 -25.722
Fs (p) 0.613 0.029 0.183 0.057 0.425 <0.001
Mismatch p 0.04 <0.001 <0.001 0.02 <0.001 <0.001
Raggedness index 0.319 0.236 0.209 0.232 0.187 0.373

Genetic diversity indexes and tests for neutrality and population expansion based on mtDNA COI haplotypes (515 bp). Parameter symbols: π = nucleotide diversity, h = haplotype diversity, tau = divergence time, D = Tajima’s D, Fs = Fu’s Fs, p = p-value.

Fine scale haplotype geographic distribution and the number of shared haplotypes (Table 2) resulted in non-significant genetic differentiation (FST = -0.001, p = 0.531; ΦST = 0.526, p<0.00001) (Fig 2). Genetic structure analyses revealed significant differences in haplotype frequencies among haplotypes resulting in a highly significant fixation index (FST = 0.0296, p = 0.002). All FST pairwise comparisons between Myanmar and neighbor populations were significant, the strongest differentiation was against Malaysia (FST = 0.071, p<0.001) (Fig 3). All ΦST comparisons were low and non-significant. Both tests for neutrality, Tajima’s D and Fu’s Fs values were significant for pooled data suggesting evidence for an expansion signal, but were non-significant in all individual populations estimates (Table 3). The mismatch distribution showed a multimodal pattern and significant deviation from the model for expansion (Table 3, S1 Fig), suggesting population stability consistent with the haplotype phylogenetic reconstruction (Fig 4).

Fig 2. Fine-scale genetic differentiation estimated as Fst based on 515 bp of mtDNA COI.

Fig 2

Heat-map of FST pairwise comparisons between the five mud crab sampling locations, MK = Myeik, TN = Taw Naukle, PZ = Pan Zin, PN = Pha Nut, MA = Ma Aing estimated as Fst values indicating broad gene flow between fishing communities within the Mergui archipelago.

Fig 3. Regional genetic differentation estimated as Fst based on 460 bp of mtDNA COI.

Fig 3

Heat-map of FST pairwise comparisons between populations of Scylla olivacea from Myanmar, Bay of Bengal, Malaysia, Bangladesh, and India indicating the restricted gene flow between neighbouring countries.

Fig 4. Median-joining network of the 40 COI haplotypes (515bp) of Scylla olivacea.

Fig 4

Phylogenetic reconstruction of Scylla olivacea COI haplotypes. Circle diameter is proportional to haplotype frequency, and color are coded by location. Scylla serrata, gray circle, was used as the outgroup.

Discussion

Species identification

Our results found that Scylla olivacea was the only species harvested from the mangrove creeks across the Mergui archipelago, in southern Myanmar, as identified using DNA barcoding the first study of its kind in Myanmar’s marine fisheries. This is in accordance with the catch composition of the mud crab fisheries of Malaysia [25], Bangladesh [12], and Philippines [29], where S. olivacea is the only or the dominant species harvests from mangroves fishing grounds. The giant mud crab S. serrata was previously thought to be the most common species harvested across Southeast Asia, but more studies have revealed that S. olivacea is indeed the most common species [12,15,29]. Likewise, S. olivacea is the most common species found in the markets in Southeast Asia [2] and the most important crab for commercial culture in the Indo-West Pacific region leading to high prices in both local and international markets [30].

The absence of other Scylla congeneric species in this study does not mean that other species do not occur in the country. In close geographical proximity to Myanmar S. olivacea and S. serrata have been found in sympatry, e.g. in India [15,22,31], Thailand [13], and Bangladesh [12]. Our results indicate that S. olivacea is the main species harvested across the Mergui archipelago during the time of this study, but other species may occur or may be susceptible to other fishing gear. Fishers in the Tanintharyi region use only baited traps deployed in the mangrove intertidal zone, while in other countries fishers use different gears such as traps, lift and skate nets, fish in different habitats so may catch other Scylla species (see [29]). Habitat separation among congeneric species has been noticed, although not well explored, but suggests a strong preference of S. olivacea for the intertidal zone in mangrove habitats [3,29,32]. While S. tranquebarica was found commonly sub-tidally, and S. serrata occurs in lower temperatures [33].

COI species-specific fragments, (212 bp and 138 bp, for S. olivacea and S. serrata, respectively, [22]) confirmed the species identification using DNA barcode sequences generated in this study. Moreover, the estimates of high genetic divergence for S. serrata comparisons also support the species distinction (Table 3). Ambiguous results were returned when comparing our sequences against different public databases (GenBank and BOLD) suggesting that some COI sequences had been generated from species misidentified in previous studies when S. serrata was thought to be the dominant species. Therefore, caution must be taken when using public databases for species with controversial or recently reviewed taxonomy.

The correct identification of species being harvested in mud crab fisheries is the first step in developing effective and sustainable management practices. The biological information necessary to implement fishery regulations differs among species. For example setting a minimum size based on size of maturity needs to be linked to species specific reproductive biology. The current results can now help Myanmar develop fishery management and regulations in the Tanintharyi region focused on Scylla olivacea.

Genetic characterization of Scylla olivacea

Mud crabs, S. olivacea, across the Tanintharyi region showed a high COI haplotype diversity and low nucleotide diversity (Table 2), which is explained by the numerous haplotypes, which differed from each other by only few mutations (see Table 1). This pattern of genetic diversity appears to be characteristic among crustacean species [3436] including S. olivacea in Malaysia [25] and S. serrrata in East Africa [37]. This pattern suggests that S. olivacea has experienced genetic bottleneck events that caused the extinction of some haplotypes [38] and subsequent population expansion, thus enabling the retention of new mutations without sufficient time for accumulation of large differentiation among haplotypes [39]. Tajimas’s D and Fu’s Fs indexes were negative but non-significant for all populations, consistent with the excess of rare mutations observed, and consistent with a population at drift-mutation equilibrium. However, the negative and significant Fu’s Fs statistical value estimated for the pooled data provides strong evidence for past population expansion [40]. This is in agreement with mismatch distribution, the multimodal (including bimodal observed in the pooled data) distributions and the high raggedness indices estimated (Table 3) are characteristic of admixture of historically isolated populations, and a ragged distribution suggests that the lineage was widespread [28,41].

Moreover, the MJN star-like shaped phylogeny reconstruction (Fig 4), shows two well-defined lineages with a central haplotype, where Hap 1 and Hap 5 are the most probable ancestral haplotypes, surrounded by several haplotypes that show little base pair differences. This topology is typical for a population that has recently expanded in size from a small number of founders following a population bottleneck [42].

Overall, the distribution and frequency of the 40 COI haplotypes (Table 1), resulted in both negative and non-significant FST and ΦST values, indicative of no genetic structure among the five localities compared. These results suggests extensive gene flow among the sampled localities, likely driven by female reproductive behaviour [13,43], with migration up to 50 km from the mangroves out to sea to release larvae [44]. In addition, the dispersal capabilities could be extensive with the planktonic larva stage lasting up to four weeks [26,45], and strongly influenced by tide conditions and mixing floods during Monsoon season [46].

Despite the potential dispersal capabilities of early life stages of the species, the hypothesis of unrestricted gene flow among conspecifics from neighbouring countries was rejected, as estimated by the fixation index FST based on differences in haplotype frequencies. Pairwise comparisons showed a complex pattern of genetic differentiation, as expected given the fairly complex circulation of the Andaman Sea, where surface currents change seasonally depending on the northeast monsoon (December–February) and the southwest monsoon (June–September) [46,47]. Comparisons between Myanmar and Malaysia were the most differentiated (Fig 3), indicating a restricted gene flow regardless of their close geographic location, which is likely caused by the prevailing anti-cyclonic circulation during northeast monsoon and the weak transport through the Malacca Strait during southwest monsoon resulting in a limited mixing between water flowing through the straight and from the Myanmar coast [48]. A similar pattern of population structure among conspecifics was documented in S. serrata from East Africa, where ocean dynamics impose barriers to gene flow between geographically close populations, while promoting gene flow to further locations [37]. Likewise, the Asiatic mangrove, Rhizophora mucroanta, showed the most distinct genetic differentiation between the Andaman Sea and the Malacca Strait, which can be explained by the prevailing ocean currents in this region dictating the dispersal of propagules [48]. The less genetic differentiation among Myanmar, India, Bay of Bengal and Bangladesh might be maintained by the equatorial forcing and the local winds forcing the coastal circulations entering the Andaman Sea and around islands transporting waters from India into the north of the Andaman Sea [47].Ocean circulation and dynamics must be explored locally in greater detail to explain this complex pattern of genetic structure and to further investigate the geographical scale and dynamics of mud crab dispersion in this region. The fixation index ΦST was non-significant for all population pairwise comparisons, as expected given the low nucleotide diversity found in the species in this study and in Malaysia [25].

Conclusions

These results suggest Scylla olivacea is the main or only species harvested in the mud crab fishery in the Mergui archipelago. Moreover, S. olivacea exhibits an extensive gene flow among the populations, but restricted gene flow among neighbouring countries Therefore, the population of S. olivacea in the Mergui archipelago may be susceptible to local depletion from overfishing as neighbouring countries may not contribute to replenish its fishing stocks, and so local management of the Myanmar mud crabbing is fundamental. These findings represent a critical baseline for further studies to assess the effect of fishing, overfishing, pollution, and habitat loss on the mud crab population and on the levels of genetic diversity, which is directly affected by the ability of the species to successfully adapt to natural and anthropogenic changes in the environment.

Supporting information

S1 Table. Results for Scylla species identification from comparisons to databases in BLASTn and BOLD.

Showing only results for unique haplotypes (n = 40).

(PDF)

S1 Fig. Mismatch distribution for each five localities in this study, and overall five populations.

MK = Myeik, TN = Taw Naukle, PZ = Pan Zin, PN = Pha Nut, MA = Ma Aing.

(PDF)

Acknowledgments

We thank Mr. Hla Htay from the village of TauNaukle for the logistic support and accessibility to data and samples to conduct fieldwork. We also thank Aung Myo Chit, SI in-country program coordinator and the Myanmar Department of Fisheries for providing the permits and assistance to conduct this study. This is contribution no. 1098 of the Smithsonian Marine Station.

Data Availability

All DNA sequences generated in this study are available from the Gen Bank database (accession number(s) MH370560 -MH370599).

Funding Statement

This study was funded by the Helmsley Charitable Trust (grant number 504604- 2017) awarded to SB. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Macnae W. A General Account of the Fauna and Flora of Mangrove Swamps and Forests in the Indo-West-Pacific Region. Adv Mar Biol. 1969;6(C). [Google Scholar]
  • 2.Ng P. Crabs. In: FAO species identification guide for fishery purposes. 1998. p. 1397–2068. [Google Scholar]
  • 3.Overton JL, Macintosh DJ. Estimated size at sexual maturity for female mud crabs (genus Scylla) from two sympatric species within Ban Don Bay, Thailand. J Crustac Biol. 2002;22 (4)(4):790–7. [Google Scholar]
  • 4.FAO. Myanmar aquaculture and inland fisheries Myanmar aquaculture and inland fisheries. 2003;
  • 5.Keenan CP, Davie PJF, Mann DL. A Revision Of The Genus Scylla De hann, 1833 (Crustacea: Decapoda: Brachyura: Portunidae). Raffles Bull Zool. 1998;46(1):217–45. [Google Scholar]
  • 6.Estampador EP. Studies on Scylla (Crustacea: Portunidae). I. Revision of the genus. Philipp J Sci. 1949;78(1):95–108. [Google Scholar]
  • 7.Serène R. Les especes du genre Scylla à Nhatrang (Viet-Nam). In: Indo-Pacific Fisheries Council 3rd Meeting. 1952. p. 132–7.
  • 8.Fuseya R, Watanabe S. Genetic Variability in the Mud Crab Genus Scylla (Brachyura: Portunidae). Fish Sci [Internet]. 1996;62(5):705–9. Available from: http://www.scopus.com/inward/record.url?eid=2-s2.0-0013674269&partnerID=tZOtx3y1 [Google Scholar]
  • 9.Imai H, Cheng J. Identification of four mud crab species (genus Scylla) using ITS-1 and 16S rDNA markers. Aquat Living … [Internet]. 2004;34:31–4. Available from: http://journals.cambridge.org/production/action/cjoGetFulltext?fulltextid=8211541 [Google Scholar]
  • 10.Sangthong P, Jondeung A. Classification of three crab morphs in the genus Scylla using morphometric analysis. Kasetsart J—Nat Sci. 2006;40(4):958–70. [Google Scholar]
  • 11.Ma L.B., Zhang F.Y., Ma C. Y., Qiao ZG. Scylla paramamosian (Estamapador) themost common mud crab (genus Scylla) in China: evidence from mtDNA. Aquat Res. 2006;37:1694–8. [Google Scholar]
  • 12.Sarower MG, Shahriar SIM, Nakamura H, Rouf MA, Okada S. Taxonomic confirmation of mud crab species (genus Scylla) in Bangladesh by nuclear and mitochondrial DNA markers. Mitochondrial DNA Part A DNA Mapping, Seq Anal. 2017;28(6):935–40. [DOI] [PubMed] [Google Scholar]
  • 13.Jirapunpipat K. Population structure and size at maturity of the orange mud crab Scylla olivacea in Klong Ngao mangrove swamp, Ranong Province, Thailand. Kasetsart J—Nat Sci. 2008;42(1):31–40. [Google Scholar]
  • 14.Ogawa CY, Hamasaki K, Dan S, Obata Y, Kitada S. Species composition, reproduction, and body size of mud crabs, Scylla spp., caught in urado Bay, Japan. J Crustac Biol. 2012;32(5):762–8. [Google Scholar]
  • 15.Mandal A, Varkey M, Mani AK, Sobhanan SP, Thampi-Samraj YC. Identification of Indian Mangrove Mud Crab Genus Scylla spp. (Brachyura: Portunidae) using Rapd and Pcr-Rflp Markers. J Shellfish Res [Internet]. 2014;33(2):503–10. Available from: http://www.bioone.org/doi/abs/10.2983/035.033.0219 [Google Scholar]
  • 16.MacIntosh DJ, Overton JL, Thu HVT. Confirmation of two common mud crab species (genus Scylla) in the mangrove ecosystem of the Mekong Delta, Vietnam. J Shellfish Res [Internet]. 2002;21:259–65. Available from: //wos [Google Scholar]
  • 17.Hebert PDN, Cywinska A, Ball SL, DeWaard JR. Biological identifications through DNA barcodes. Proc R Soc B Biol Sci [Internet]. 2003. February 7 [cited 2018 Feb 15];270(1512):313–21. Available from: http://www.ncbi.nlm.nih.gov/pubmed/12614582 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Geller J, Meyer C, Parker M, Hawk H. Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys. Mol Ecol Resour. 2013;13(5):851–61. 10.1111/1755-0998.12138 [DOI] [PubMed] [Google Scholar]
  • 19.Roehrdanz RL. An improved primer for PCR amplification of mitochondrial DNA in a variety of insect species. Insect Mol Biol. 1993;2(2):89–91. [DOI] [PubMed] [Google Scholar]
  • 20.Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. Geneious [Internet]. Vol. 28, Bioinformatics (Oxford, England). 2012. p. 1647–9. Available from: http://bioinformatics.oxfordjournals.org/content/28/12/1647.short [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ. Multiple sequence alignment with Clustal X. Trends Biochem Sci. 1998;23(10):403–5. [DOI] [PubMed] [Google Scholar]
  • 22.Mandal A, Varkey M, Sobhanan SP, Mani AK, Gopalakrishnan A, Kumaran G, et al. Molecular markers reveal only two mud crab species of genus Scylla (Brachyura: Portunidae) in Indian coastal waters. Biochem Genet. 2014;52(7–8):338–54. 10.1007/s10528-014-9651-z [DOI] [PubMed] [Google Scholar]
  • 23.Rozas J, Ferrer-Mata A, Sánchez-DelBarrio JC, Guirao-Rico S, Librado P, Ramos-Onsins SE, et al. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol Biol Evol [Internet]. 2017. December 1 [cited 2018 Mar 23];34(12):3299–302. Available from: http://academic.oup.com/mbe/article/34/12/3299/4161815 10.1093/molbev/msx248 [DOI] [PubMed] [Google Scholar]
  • 24.Excoffier L, Lischer H. An Integrated Software Package for Population Genetics Data Analysis. Evol Bioinform Online [Internet]. 2015;1(1):47–50. Available from: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2658868&tool=pmcentrez&rendertype=abstract [PMC free article] [PubMed] [Google Scholar]
  • 25.Rosly HA-AM, Nor SAM, Yahya K, Naim DM. Mitochondrial DNA diversity of mud crab Scylla olivacea (Portunidae) in Peninsular Malaysia: a preliminary assessment. Mol Biol Rep [Internet]. 2013;40(11):6407–18. Available from: http://link.springer.com/10.1007/s11033-013-2755-4 10.1007/s11033-013-2755-4 [DOI] [PubMed] [Google Scholar]
  • 26.Fratini S, Vannini M. Genetic differentation in the mud crab Scylla serrata (Decapoda: Portunidae) within the Indian Ocean. J Exp Mar Bio Ecol. 2002;272:103–16. [Google Scholar]
  • 27.Bandelt HJ, Forster P, Röhl A. Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol. 1999;16(1):37–48. 10.1093/oxfordjournals.molbev.a026036 [DOI] [PubMed] [Google Scholar]
  • 28.Hey J, Nielsen R. Multilocus methods for estimating population sizes, migration rates and divergence time, with applications to the divergence of Drosophila pseudoobscura and D. persimilis. Genetics [Internet]. 2004;167(2):747–60. Available from: http://mbe.oxfordjournals.org/content/9/3/552.abstract 10.1534/genetics.103.024182 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lebata MJHL, Le Vay L, Primavera JH, Walton ME, Biñas JB. Baseline assessment of fisheries for three species of mud crabs (Scylla spp.) in the mangroves of Ibajay, Aklan, Philippines. Bull Mar Sci. 2007;80(3):891–904. [Google Scholar]
  • 30.Keenan CP. World status of Portunid aquaculture and fisheries. In: Allan G; Fielder D, editor. Mud crab aquaculture in Australia and Southeast Asia Proceedings of the ACIAR crab aquaculture scoping study and workshop 28–29 April 2003. Jondooburri Conference centre, Bribie Island; 2003. p. 42–4.
  • 31.Shukla ML, Patel BK, Trivedi JN, Vachhrajani KD. Brachyuran Crabs Diversity of Mahi and Dhadhar Estuaries, Gujarat, India. Res J Mar Sci Res J Mar Sci [Internet]. 2013. [cited 2018 Feb 15];1(2):2321–1296. Available from: https://s3.amazonaws.com/academia.edu.documents/32079935/13_%28v%29-MLS_BKP_JNT_KDV-_Crab_Mahi-Dhadhar-_RJMS.pdf?AWSAccessKeyId=AKIAIWOWYYGZ2Y53UL3A&Expires=1518726607&Signature=OZ78%2Bnhh9yQ8UhapavcdmY0xkNg%3D&response-content-disposition=inline%3B filename%3DBrachyuran_Crabs_Diversity_of_Mahi_and_D.pdf [Google Scholar]
  • 32.Moser S, Macintosh D, Laoprasert S, Tongdee N. Population ecology of the mud crab Scylla olivacea: a study in the Ranong mangrove ecosystem, Thailand, with emphasis on juvenile recruitment and mortality. Fish Res [Internet]. 2005. January 1 [cited 2018 Feb 15];71(1):27–41. Available from: https://www.sciencedirect.com/science/article/pii/S0165783604001900 [Google Scholar]
  • 33.Gopurenko D, Hughes JM, Bellchambers L. Colonisation of the south-west Australian coastline by mud crabs: evidence for a recent range expansion or human-induced translocation? Mar Freshw Res [Internet]. 2003. [cited 2018 Feb 15];54(7):833 Available from: http://www.publish.csiro.au/?paper=MF03033 [Google Scholar]
  • 34.Bucklin A, Wiebe P. Low mitochondrial diversity and small effective population sizes of the copepods Calanus finmarchicus and Nannocalanus minor: possible impact of climatic variation during recent glaciation. J Hered [Internet]. 1998. September 1 [cited 2018 Feb 15];89(5):383–92. Available from: https://academic.oup.com/jhered/article-lookup/doi/10.1093/jhered/89.5.383 [DOI] [PubMed] [Google Scholar]
  • 35.Stamatis C, Triantafyllidis A, Moutou KA, Mamuris Z. Mitochondrial DNA variation in Northeast Atlantic and Mediterranean populations of Norway lobster, Nephrops norvegicus. Mol Ecol. 2004;13(6):1377–90. 10.1111/j.1365-294X.2004.02165.x [DOI] [PubMed] [Google Scholar]
  • 36.Supmee V, Ngernsiri L, Sriboonlert A, Wonnapinij P. Along the Andaman Sea Coast of Thailand. 2012;51(7):1040–50. [Google Scholar]
  • 37.Rumisha C. Genetic diversity and connectivity in the East African mangrove crustaceans Scylla serrata and Penaeus monodon in relation to trace metal pollution: implications for fisheries management. Brussels 2017. 2017;1–18. [Google Scholar]
  • 38.Slatkin M, Muirhead CA. Overdominant alleles in a population of variable size. Genetics. 1999;152(2):775–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Stepien CA, Hubers AN, Skidmore JL. Diagnostic Genetic Markers and Evolutionary Relationships among Invasive Dreissenoid and Corbiculoid Bivalves in North America: Phylogenetic Signal from Mitochondrial 16S rDNA. Mol Phylogenet Evol [Internet]. 1999. October 1 [cited 2018 Feb 16];13(1):31–49. Available from: https://www.sciencedirect.com/science/article/pii/S1055790399906668 10.1006/mpev.1999.0666 [DOI] [PubMed] [Google Scholar]
  • 40.Fu YX, Li WH. Statistical tests of neutrality of mutations. Genetics. 1993;133(3):693–709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Excoffier L, Smouse PE, Quattro JM. Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics. 1992;131(2):479–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Slatkin M, Hudson RR. Pairwise Comparisons of Mitochondrial DNA Sequences in Stable and Exponentially Growing Populations. [cited 2018 Feb 16]; Available from: http://ib.berkeley.edu/labs/slatkin/popgenjclub/pdf/slatkin-hudson1999.pdf [DOI] [PMC free article] [PubMed]
  • 43.Hill BJ. Offshore spawning by the portunid crab Scylla serrata (Crustacea: Decapoda). Mar Biol. 1994;120(3):379–84. [Google Scholar]
  • 44.Koolkalya S, Thapanand T, Tunkijjanujij S, Havanont V, Jutagate T. Aspects in spawning biology and migration of the mud crab Scylla olivacea in the Andaman Sea, Thailand. Fish Manag Ecol. 2006;13(6):391–7. [Google Scholar]
  • 45.Ong KS. The early developmental stages Scylla serrata reared in the laboratory. In: IPFC. 1964. p. 135–46.
  • 46.Rizal S, Damm P, Wahid MA, Sündermann J, Ilhamsyah Y, Iskandar T, et al. General circulation in the Malacca Strait and Andaman Sea: A numerical model study. Am J Environ Sci. 2012;8(5):479–88. [Google Scholar]
  • 47.Chatterjee A, Shankar D, McCreary JP, Vinayachandran PN, Mukherjee A. Dynamics of Andaman Sea circulation and its role in connecting the equatorial Indian Ocean to the Bay of Bengal Abhisek. J Geophys Res. 2017;(122):3200–18. [Google Scholar]
  • 48.Wee AKS, Takayama K, Asakawa T, Thompson B, Onrizal, Sungkaew S, et al. Oceanic currents, not land masses, maintain the genetic structure of the mangrove Rhizophora mucronata Lam. (Rhizophoraceae) in Southeast Asia. Maggs C, editor. J Biogeogr [Internet]. 2014. May 1 [cited 2018 Mar 19];41(5):954–64. Available from: http://doi.wiley.com/10.1111/jbi.12263 [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Results for Scylla species identification from comparisons to databases in BLASTn and BOLD.

Showing only results for unique haplotypes (n = 40).

(PDF)

S1 Fig. Mismatch distribution for each five localities in this study, and overall five populations.

MK = Myeik, TN = Taw Naukle, PZ = Pan Zin, PN = Pha Nut, MA = Ma Aing.

(PDF)

Data Availability Statement

All DNA sequences generated in this study are available from the Gen Bank database (accession number(s) MH370560 -MH370599).


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES