Abstract
Background:
Toxocariasis is one of the most neglected zoonotic diseases, predominantly caused by Toxocara canis. We aimed to evaluate the expression of microRNAs 21 and 103a in seropositive individuals for human toxocariasis as diagnostic biomarkers.
Methods:
This study was conducted on 324 individuals for ELISA test on toxocariasis in Tehran and Karaj, Iran 2019. Then positive samples for anti-Toxocara IgG were obtained to quantitative Real-time PCR (qRT-PCR) assays to investigate the transcriptional profiles of miRNAs predicted to be involved in developmental and reproductive processes. qPCR was employed to assess levels of transcription for miRNAs of 103a and 21 in plasma samples.
Results:
After the experiments, the results were evaluated by REST software, Livak formula and quantitative t-test. The analyzes performed on human samples showed that in the case group compared to the control group, only in Tc-miR-21 gene, a 0.3-fold increase in expression was obtained with REST software (Fold change ≤ 1.5, P>0.05), which was statistically significant by t-test (P<0.05).
Conclusion:
To our knowledge, this is the first study to evaluate miR-21 and miR-103a in toxocariasis, which shed light on the fundamental role of it as a biomarker and diagnostic tool. However, due to the changes in expression of these miRNAs were not vast to be used as biomarkers in diagnosis. Despite of that the changes in the expression of these miRNAs were not vast but they could serve as novel promising biomarkers for diagnosis of toxocariasis.
Keywords: Toxocariasis, MicroRNAs-expression, Polymerase chain reaction
Introduction
Toxocara species are one of the most prevalent zoonotic helminths, and are an intestinal nematode of dogs (T. canis) and cats (T. cati), which are the causative agent of human infection globally (1, 2). Humans, particularly children, may be infected by accidental ingestion of embryonated Toxocara eggs from contaminated soil, water, raw vegetables, fruit or infective larvae in raw/undercooked meats (3). After ingestion of embryonated eggs, larvae can invade multiple tissues or organs, causing visceral larvae migrans (VML), ocular larva migrans larvae (OLM), neurotoxocariasis or covert toxocariasis (1, 4). Globally, the prevalence of Toxocara spp. is varying and about one fifth (19%) of the world’s human population is seropositive to Toxocara. Africa showed the highest seroprevalence rates (37.7%) and the lowest in the Eastern Mediterranean region (8.2%) (5). Misdiagnosis of toxocariasis because of nonspecific clinical presentation, may lead to prolonged morbidity and health complications. The diagnosis based on clinical, radiographic and laboratory investigations of the disease (6, 7). Toxocara diagnostic methods in humans include histopathological examination, or detection of specific larval DNA and the main diagnostic method is the serological or immunological for detection of anti-Toxocara antibodies (IgG) (3).
Recently, molecular methods and the knowledge of the genome and transcriptomes play a fundamental role in understanding the molecular biology, biochemistry and physiology of Toxocara (8, 9). MicroRNAs (miRNAs) were first detected in a free-living nematode; these small RNAs are post-transcriptional regulators of gene expression and showed association with different immune-related diseases (10). The quantitative detection of miRNAs by polymerase chain reaction (PCR) in different body fluids such as blood, urine and saliva has increased the ability for using as biomarkers and diagnostic tools (11). The identification of miRNAs in biological samples, easily collected and their stability improve their use as a diagnostic tool for infectious parasitic diseases (11). Evaluating changes in the expression of different genes in different evolutionary stages of parasites can indicate their role in diagnosis, host-angel communication, and drug resistance. Therefore, for some reason, including an increase in the number of miRNAs detected in parasites, the presence of circulating miRNAs derived from worms in helminthic infection, and their persistence in host samples, the change in miRNAs expression in host or parasite should be considered more serious for diagnostic and therapeutic purposes (12).
The objectives of the present study were to evaluate the expression of T. canis miR-21 (Tc-miR-21) and T. canis miR-103a (Tc-103) and using it as a biomarker and diagnostic tool for human toxocariasis in the people with anti- T. canis immunoglobulin G.
Materials and Methods
Ethics statement
All tests on individuals were carried out according to the guidelines of the Tehran University of Medical Sciences Ethics Committee (Ethics ID # IR.TUMS.SPH.REC.1398.096).
Subjects
This study was conducted on 324 individuals referred to the Teaching Hospitals of Alborz University of Medical Sciences, Karaj, Iran in 2019. Whole blood samples were centrifuged (1500 g for 10 min). The isolated plasma was again centrifuged (1500 g for 5 min). Finally, plasma samples were stored at −80 °C until analyses were carried out. Plasma samples had the ability to isolate and detect more specific miRNAs than serum and whole blood samples due to the lack of stress of coagulation reactions (13).
Detection of anti-Toxocara canis immunoglobulin G by indirect ELISA
Anti-T. canis antibodies were detected by commercial ELISA kit (NOVATEC GmbH, Dietzenbach, Germany). The specificity and sensitivity of the kit was more than 95%, following the manufacture’s instruction. In brief, the wells of 96 well microtiter plates were coated with Toxocara canis antigens in coating buffer (0.06 M carbonate buffer, pH 7.2). Plasma samples (1:100 diluted in PBS; 100 μl/well) were dispensed in duplicates and incubated (at 37 °C for 1 hour). After this step, each well was washed 3 times (PBS; 1:20 diluted 0.2 M pH=7.2). In next step, wells were incubated with HRP conjugated anti-IgG antibodies (100 μl/well) for 30 min at 25 °C. Finally, wells were washed five times by addition of TMB/H2O2 substrate (100 μl/well) the color was developed. After 15 min of incubation, reaction was stopped by addition of H2SO4 (2 N; 50 μl/well) and the optical density was measured at 450 nm. All plasma samples were stored at −80 °C for molecular analysis.
Quantitative Real-time PCR (qRT-PCR) assays
To investigate the transcriptional profiles of miRNAs predicted to be involved in developmental and reproductive processes, qRT-PCR was employed to assess levels of transcription for miRNAs Tc-miR-21 and Tc-miR-103a in 60 plasma samples (30 control samples and 30 case samples). Total RNAs was extracted separately from the plasma samples using TRIzol (TRI reagent). The extracted RNAs were approved by qualitative (agarose gel electrophoresis) and quantitative (NanoDrop spectrophotometer) methods. Then, RNAs were polyadenylated and transcribed into first-strand cDNA, according to the manufacturer’s protocol in kit (BON-Stem miR cDNA synthesis, Iran). To estimate transcription levels, a two-step qPCR was carried out using a transcript BON-miR qPCR Kit employing the following cycling protocol: 95 °C hold for 2 min, 95 °C for 5 sec, followed by 40 cycles of 60 °C for 30 sec. The oligonucleotide probes used for labeling and hybridization are as shown in Table 1.
Table 1:
Sequences of primers used for qRT-PCR amplification
| Primers | Sequences | References |
|---|---|---|
| Tc-miR-21 (Forward) | ACGTGTTAGCTTATCAGACTGA | [36] |
| Tc-miR-21 (Stem loop RT primer) | GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACTCAAC | [34] |
| Tc-miR-103a-3P (Forward) | UACAGUACUGUGAUAACUGAA | [34] |
| Tc-miR-103a-3P (Stem loop RT primer) | GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACTTCAGT | [34] |
| U6 (Forward) | GCTTCGGCAGCACATATACT | [34] |
| Reverse (Universal) | GAGCAGGGTCCGAGGT | [36] |
Based on studies conducted, U6 housekeeping gene (HKG) was selected in this study for normalization (14–16).
Statistical analysis
Two independent replicates were performed, and the relative transcription level was established using the Livak formula (2−ΔΔCt; CT: threshold cycle), relative expression software tool (REST 2009) and t-test (17–21). Statistical evaluations were performed with SPSS (ver. 19.0, Chicago, IL, USA). Chi-square test and Fisher’s exact test were used for categorical data. A P-value<0.05 was considered statistically significant.
Results
ELISA
Of 324 plasma samples, 30 were positive (anti-T. canis IgG) by ELISA technique (9.2%). The average age of the positive cases was 45.3 and there was no significant difference between gender and infection (17 males and 13 females, P=0.997).
Real-time PCR
The expression of Tc-miR-21 by Real-time PCR method in patients with anti-T. canis IgG (cases) and the people without anti-T. canis antibodies (controls) plasma samples with ELISA shown in Table 2 and Fig. 1. Moreover, the case and control samples matched in terms of age and gender.
Table 2:
The expression of Tc-miR-21 in the people studied using plasma samples and Real-time PCR based on Livak formula
| CASE | Tc-miR-21 (avg) | U6 (avg) | Δ Ctcase Tc-miR-21-U6 | CONTROL | Tc-miR-21 (avg) | U6 (avg) | ΔCtcontrol Tc-miR-21-U6 | ΔΔCt | Fold change |
|---|---|---|---|---|---|---|---|---|---|
| H1a | 33.23 | 28.05 | 5.19 | C1a | 34.90 | 26.89 | 8.02 | −2.83 | 7.110741 |
| H2a | 33.23 | 26.45 | 6.78 | C2a | 36.00 | 27.21 | 8.79 | −2.01 | 4.027822 |
| H3a | 33.88 | 26.80 | 7.09 | C3a | 34.90 | 27.06 | 7.84 | −0.76 | 1.687632 |
| H4a | 32.59 | 26.44 | 6.15 | C4a | 34.95 | 26.58 | 8.38 | −2.23 | 4.675109 |
| H5a | 32.21 | 27.06 | 5.15 | C5a | 35.35 | 27.27 | 8.09 | −2.94 | 7.647563 |
| H6a | 32.27 | 26.69 | 5.59 | C6a | 35.01 | 26.18 | 8.83 | −3.25 | 9.480742 |
| H7a | 32.04 | 24.93 | 7.12 | C7a | 35.56 | 26.80 | 8.76 | −1.64 | 3.116658 |
| H8a | 33.04 | 25.19 | 7.85 | C8a | 33.85 | 25.46 | 8.39 | −0.54 | 1.448942 |
| H9a | 34.51 | 25.93 | 8.58 | C9a | 35.13 | 29.60 | 5.53 | 3.05 | 0.121161 |
| H10a | 34.50 | 25.88 | 8.63 | C10a | 34.10 | 26.02 | 8.09 | 0.54 | 0.687771 |
| H11a | 33.77 | 25.62 | 8.15 | C11a | 34.23 | 26.88 | 7.35 | 0.81 | 0.572362 |
| H12a | 33.90 | 25.66 | 8.24 | C12a | 34.23 | 23.26 | 10.97 | −2.73 | 6.634556 |
| H13a | 34.34 | 26.20 | 8.14 | C13a | 34.90 | 23.91 | 10.10 | −2.86 | 7.235035 |
| H14a | 31.00 | 26.18 | 4.83 | C14a | 35.00 | 27.66 | 7.34 | −2.52 | 5.715977 |
| H15a | 35.11 | 26.38 | 8.73 | C15a | 34.06 | 26.87 | 7.19 | 1.54 | 0.343885 |
| H16a | 34.95 | 26.75 | 8.20 | C16a | 34.75 | 23.67 | 11.08 | −2.88 | 7.336032 |
| H17a | 36.10 | 26.80 | 9.30 | C17a | 35.90 | 26.68 | 9.22 | 0.08 | 0.946058 |
| H18a | 32.88 | 26.49 | 6.39 | C18a | 36.53 | 26.56 | 9.97 | −3.58 | 11.95879 |
| H19a | 33.03 | 27.00 | 6.03 | C19a | 34.15 | 25.57 | 8.59 | −2.56 | 5.876675 |
| H20a | 32.01 | 26.87 | 5.14 | C20a | 34.55 | 25.15 | 9.40 | −4.26 | 19.09337 |
| H21a | 34.65 | 26.77 | 7.88 | C21a | 34.99 | 25.90 | 9.09 | −1.21 | 2.305373 |
| H22a | 33.80 | 26.05 | 7.75 | C22a | 34.17 | 26.31 | 7.87 | −0.12 | 1.086735 |
| H23a | 32.33 | 23.99 | 8.34 | C23a | 33.68 | 25.25 | 8.43 | −0.09 | 1.06437 |
| H24a | 33.47 | 26.49 | 6.98 | C24a | 35.00 | 26.21 | 8.79 | −1.81 | 3.506423 |
| H25a | 35.76 | 26.92 | 8.84 | C25a | 37.06 | 25.88 | 11.18 | −2.34 | 5.04551 |
| H26a | 34.92 | 23.25 | 11.68 | C26a | 35.24 | 26.00 | 9.24 | 2.44 | 0.184923 |
| H27a | 33.53 | 24.11 | 9.42 | C27a | 34.17 | 26.46 | 7.71 | 1.71 | 0.30566 |
| H28a | 32.20 | 25.68 | 6.52 | C28a | 35.52 | 27.00 | 8.52 | −2.00 | 3.986161 |
| H29a | 36.04 | 26.56 | 9.48 | C29a | 34.74 | 24.13 | 10.61 | −1.13 | 2.181015 |
| H30a | 35.83 | 24.35 | 11.48 | C30a | 34.27 | 26.37 | 7.90 | 3.58 | 0.08362 |
Fig. 1:
The expression of miRNAs using plasma samples and qRT-PCR in the people with (cases) and without (controls) anti-Toxocara canis immunoglobulin G based on REST. A) Tc-miR-21, and B) Tc-miR-103a
Tc-miR-21 expression is UP-regulated in the case group (in comparison to control group) by a mean factor of 3.311. Tc-miR-21 case group was different to control group [P (H1): 0.035; SE: 0.332–24.556; 95% CI: 0.035–11.279]. Thus, the division of housekeeping expression (U6) into gene expression (Tc-miR-21) indicated the rate of change (⅟3.311=+0.302). In addition, analyzed results by t-test showed that there was a significant relationship between gene expression in the two groups (t-Critical two-tail: 2.001 < t-Stat: 4.198; Pooled Variance: 1.099; P<0.05).
Table 3 and Fig. 1 shows the expression of Tc-miR-103a in sero-positive and sero-negative samples by Real-time PCR. Moreover, the case and control samples matched in terms of age and gender. The present findings showed that Tc-miR-103a expression was the same in both groups [Expression: 1.038; SD: 0.278–2.480; 95% CI: 0.110–8.240; P (H1): 0.505]. Thus, the division of HKG expression (U6) into gene expression (Tc-miR-103a) indicated the rate of change (⅟1.038∼1). In addition, analyzed results by t-test showed that there was not a significant relationship between gene expression in the two groups (t-Critical two-tail: 2.001 > t-Stat: 0.056; Pooled Variance: 1.792; P > 0.05). Moreover, changes in the expression of Tc-miR-21 and Tc-miR-103a in all case samples, based on the analysis of previous studies, were not significantly correlated (Expression ≤ 1.5, Fold change ≤ 5, P ≥ 0.05).
Table 3:
The expression of Tc-miR-103a in the individuals studied using plasma samples and Real-time PCR based on Livak method
| CASE | Tc-miR-103a (avg) | U6 (avg) | ΔCtcase Tc-miR-103a-U6 | CONTROL | Tc-miR-103a (avg) | U6 (avg) | ΔCtcontrol Tc-miR-103a-U6 | ΔΔCt | Fold change |
|---|---|---|---|---|---|---|---|---|---|
| H1a | 35.6 | 28.05 | 7.56 | C1a | 34.90 | 26.89 | 8.02 | −0.46 | 1.375542 |
| H2a | 35.12 | 26.45 | 8.67 | C2a | 36.00 | 27.21 | 8.79 | −0.12 | 1.086735 |
| H3a | 34.73 | 26.80 | 7.94 | C3a | 34.90 | 27.06 | 7.84 | 0.10 | 0.936272 |
| H4a | 34.56 | 26.44 | 8.12 | C4a | 34.95 | 26.58 | 8.38 | −0.26 | 1.193336 |
| H5a | 35.16 | 27.06 | 8.11 | C5a | 35.35 | 27.27 | 8.09 | 0.02 | 0.986233 |
| H6a | 34.62 | 26.69 | 7.93 | C6a | 35.01 | 26.18 | 8.83 | −0.90 | 1.866066 |
| H7a | 33.25 | 24.93 | 8.33 | C7a | 35.56 | 26.80 | 8.76 | −0.43 | 1.347234 |
| H8a | 34.33 | 25.19 | 9.14 | C8a | 33.85 | 25.46 | 8.39 | 0.76 | 0.592546 |
| H9a | 34.57 | 25.93 | 8.64 | C9a | 35.13 | 29.60 | 5.53 | 3.11 | 0.116226 |
| H10a | 35.00 | 25.88 | 9.13 | C10a | 34.10 | 26.02 | 8.09 | 1.04 | 0.486327 |
| H11a | 36.00 | 25.62 | 10.38 | C11a | 34.23 | 26.88 | 7.35 | 3.04 | 0.122004 |
| H12a | 35.60 | 25.66 | 9.94 | C12a | 34.23 | 23.26 | 10.97 | −1.03 | 2.042024 |
| H13a | 34.69 | 26.20 | 8.49 | C13a | 34.90 | 23.91 | 11.00 | −2.51 | 5.676493 |
| H14a | 35.36 | 26.18 | 9.19 | C14a | 35.00 | 27.66 | 7.34 | 1.85 | 0.278355 |
| H15a | 36.24 | 26.38 | 9.86 | C15a | 34.06 | 26.87 | 7.19 | 2.67 | 0.157127 |
| H16a | 37.00 | 26.75 | 10.26 | C16a | 34.75 | 23.67 | 11.08 | −0.82 | 1.765406 |
| H17a | 35.30 | 26.80 | 8.50 | C17a | 35.90 | 26.68 | 9.22 | −0.72 | 1.647182 |
| H18a | 35.26 | 26.49 | 8.78 | C18a | 36.53 | 26.56 | 9.97 | −1.20 | 2.289448 |
| H19a | 34.56 | 27.00 | 7.56 | C19a | 34.15 | 25.57 | 8.59 | −1.03 | 2.034959 |
| H20a | 34.33 | 26.87 | 7.46 | C20a | 34.55 | 25.15 | 9.40 | −1.94 | 3.823781 |
| H21a | 35.87 | 26.77 | 9.10 | C21a | 34.99 | 25.90 | 9.09 | 0.02 | 0.989657 |
| H22a | 34.49 | 26.05 | 8.44 | C22a | 34.17 | 26.36 | 7.87 | 0.58 | 0.671286 |
| H23a | 33.25 | 23.99 | 9.26 | C23a | 33.68 | 25.25 | 8.43 | 0.83 | 0.562529 |
| H24a | 36.90 | 26.49 | 10.42 | C24a | 35.00 | 26.21 | 8.79 | 1.63 | 0.32421 |
| H25a | 35.32 | 26.92 | 8.40 | C25a | 37.06 | 25.88 | 11.18 | −2.78 | 6.84476 |
| H26a | 34.26 | 23.25 | 11.01 | C26a | 35.24 | 26.00 | 9.24 | 1.77 | 0.293209 |
| H27a | 34.11 | 24.11 | 10 | C27a | 34.17 | 26.46 | 7.71 | 2.29 | 0.204476 |
| H28a | 33.90 | 25.68 | 8.22 | C28a | 35.52 | 27.00 | 8.52 | −0.30 | 1.231144 |
| H29a | 35.10 | 26.56 | 8.54 | C29a | 34.74 | 24.13 | 10.61 | −2.07 | 4.18434 |
| H30a | 35.03 | 24.35 | 10.69 | C30a | 34.27 | 26.37 | 7.90 | 2.79 | 0.145088 |
Discussion
In the past several years, an impressive research effort has been directed toward identification and role of miRNAs in parasites (including nematodes). Circulating miRNAs in body fluids have been considered as potentially valuable biomarkers in diagnosing, treatment and follow-up in diseases (22). MiRNAs, which are relatively stable in the circulatory system, may serve as molecular valuable biomarkers for identification of disease status (23). In recent years, intracellular miRNAs or tissues are found to be extracellular and biologically active, such as plasma, urine, CNS and saliva (24).
The use of miRNAs in the diagnosis of parasitic helminths infections has been proven (25–28). However, genomic, transcriptomic and proteomic investigations on parasitic nematodes such as Toxocara are in early stages due to the lack of recognition of the role of miRNAs in parasites and hosts. Several studies worldwide have examined the miRNAs in parasites with assigning a specific role to them. MiRNAs may have a role in drug resistance in nematodes (29). Diversity was studied in parasitic nematode genomes (30). MiRNAs’ expression might reflect adaptations to different lifestyles and environments. A previous study showed the expression of miR-36 of filarial nematode and its effect on the life cycle of Brugia malayi (31). MiRNAs can have a role of adaptation to the life cycle and pathogenicity of Ascaris (32). In the following, studies conducted on T. canis revealed that there are 342 conserved miRNAs. The miRNAs of miR-2305 and miR-6090 play a regulatory role in reproduction, embryo and larval development, let-7-5P, miR-34, and miR-100 appeared to be involved in host-parasite interactions. The common markers such as miR-2861, miR-2881, and miR-5126 in T. might have implications for the prediction of drug resistance (33, 34). The expression of miR-21 and miR-103a in the larval stage of T. canis have been increased and decreased in comparison with eggs and adults’ stages of the parasite, respectively.
These miRNAs may have a role in the maturation and development of T. canis (Unpublished data). In addition, these miRNAs were identified using reputable sites such as miRNAs and NBC (35). Therefore, we decided to investigate the potentials of Tc-miR-21 and Tc-miR-103a for the diagnosis of human toxocariasis.
Conclusion
The present study is the first, to the best of our knowledge, to analyze the circulating miR-21 and miR-103a in human toxocariasis. Although increased expression of miR-21 was observed in case study samples, due to gene expression changes less than 1.5-fold in case samples, miR-21 and miR-103a in the diagnosis of human toxocariasis, cannot have the full characteristics for introducing as a diagnostic biomarker.
Acknowledgements
The authors would like to thank all the patients who participated in the present study. Moreover, the authors express their thanks to the Staffs of the Parasitology Lab of Alborz and Tehran University of Medical Sciences for technical assistance. The results described in this paper formed part of Ph. D student thesis (Vahid Raissi) that supported financially by a grant from the School of Public Health, Tehran University of Medical Sciences, Tehran, Iran (Grant No. 25088).
Footnotes
Conflict of interest
The authors declare that there is no conflict of interest.
References
- 1.Raissi V, Raiesi O, Etemadi S, et al. Environmental soil contamination by Toxocara species eggs in public places of Ilam, Iran. Ann Agric Environ Med. 2020;27(1):15–18. [DOI] [PubMed] [Google Scholar]
- 2.Raissi V, Sohrabi Z, Getso M, et al. Risk factors and prevalence of toxocariasis in pregnant women and diabetic patients compared to healthy adults in Ilam province, western Iran. EXCLI J. 2018;17:983–988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Raissi V, Taghipour A, Navi Z, et al. Seroprevalence of Toxoplasma gondii and Toxocara spp. infections among pregnant women with and without previous abortions in the west of Iran. J Obstet Gynaecol Res. 2020;46(3):382–388. [DOI] [PubMed] [Google Scholar]
- 4.Zibaei M, Sadjjadi SM, Uga S. Experimental Toxocara cati infection in gerbils and rats. Korean J Parasitol. 2010;48(4):331–333. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Rostami A, Riahi SM, Holland CV, et al. Seroprevalence estimates for toxocariasis in people worldwide: A systematic review and meta-analysis. PLoS Negl Trop Dis. 2019;13(12):e0007809. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Zibaei M, Sadjjadi SM, Sarkari B, et al. Evaluation of Toxocara cati Excretory-Secretory Larval Antigens in Serodiagnosis of Human Toxocariasis. J Clin Lab Anal. 2016;30(3):248–253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chen J, Liu Q, Liu G, et al. Toxocariasis: a silent threat with a progressive public health impact. Infect Dis Poverty. 2018;7(1):59. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Gasser RB. A perfect time to harness advanced molecular technologies to explore the fundamental biology of Toxocara species. Vet Parasitol. 2013;193(4):353–364. [DOI] [PubMed] [Google Scholar]
- 9.Zhu XQ, Korhonen PK, Cai H, et al. Genetic blueprint of the zoonotic pathogen Toxocara canis. Nat Commun. 2015;6:6145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Gu HY, Marks ND, Winter AD, et al. Conservation of a microRNA cluster in parasitic nematodes and profiling of miRNAs in excretory-secretory products and microvesicles of Haemonchus contortus. PLOS Negl Trop Dis. 2017;11(11):e0006056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Manzano-Román R, Siles-Lucas M. MicroRNAs in parasitic diseases: potential for diagnosis and targeting. Mol Biochem Parasitol. 2012;186(2):81–86. [DOI] [PubMed] [Google Scholar]
- 12.Hakimi MA, Cannella D. Apicomplexan parasites and subversion of the host cell microRNA pathway. Trends Parasitol. 2011;27(11):481–486. [DOI] [PubMed] [Google Scholar]
- 13.Wang K, Yuan Y, Cho J-H, et al. Comparing the MicroRNA spectrum between serum and plasma. PloS One. 2012;7(7):e41561. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Tsui NBY, Ng EKO, Lo YMD. Stability of endogenous and added RNA in blood specimens, serum, and plasma. Clin Chem. 2002;48(10):1647–1653. [PubMed] [Google Scholar]
- 15.Gevaert AB, Witvrouwen I, Vrints CJ, et al. MicroRNA profiling in plasma samples using qPCR arrays: Recommendations for correct analysis and interpretation. PloS One. 2018;13(2):e0193173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Wang L, Wang HC, Chen C, et al. Differential expression of plasma miR-146a in sepsis patients compared with non-sepsis-SIRS patients. Exp Ther Med. 2013;5(4):1101–1104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002;30(9):e36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Rao X, Huang X, Zhou Z, et al. An improvement of the 2ˆ (-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat Bioinforma Biomath. 2013;3(3):71–85. [PMC free article] [PubMed] [Google Scholar]
- 19.Giorgi G, Marcantonio P, Del Re B. LINE-1 retrotransposition in human neuroblastoma cells is affected by oxidative stress. Cell Tissue Res. 2011; 346(3):383–391. [DOI] [PubMed] [Google Scholar]
- 20.Chen X, Li ZY, Maleewong W, et al. Serum aca-mir-146a is a potential biomarker for early diagnosis of Angiostrongylus cantonensis infection. Parasitol Res. 2014; 113(9):3221–3227. [DOI] [PubMed] [Google Scholar]
- 21.Nunes S, Silva IB, Ampuero MR, et al. Integrated analysis reveals that miR-193b, miR-671, and TREM-1 correlate with a good response to treatment of human localized cutaneous leishmaniasis caused by Leishmania braziliensis. Front Immunol. 2018;9:640. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Macha MA, Seshacharyulu P, Krishn SR, et al. MicroRNAs (miRNAs) as biomarker(s) for prognosis and diagnosis of gastrointestinal (GI) cancers. Curr Pharm Des. 2014;20(33):5287–5297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.MacLellan SA, MacAulay C, Lam S, et al. Pre-profiling factors influencing serum microRNA levels. BMC Clin Pathol. 2014;14:27. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Turchinovich A, Cho W. The origin, function and diagnostic potential of extracellular microRNA in human body fluids. Front Genet. 2014;5:30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Britton C, Winter AD, Marks ND, et al. Application of small RNA technology for improved control of parasitic helminths. Vet Parasitol. 2015;212(1–2):47–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Li Z, Chen X, Zen X, et al. MicroRNA expression profile in the third- and fourth-stage larvae of Angiostrongylus cantonensis. Parasitol Res. 2014;113(5):1883–1896. [DOI] [PubMed] [Google Scholar]
- 27.Sun J, Wang S, Li C, et al. Novel expression profiles of microRNAs suggest that specific miRNAs regulate gene expression for the sexual maturation of female Schistosoma japonicum after pairing. Parasit Vectors. 2014;7:177. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Zhao GH, Xu MJ, Zhu XQ. Identification and characterization of microRNAs in Baylisascaris schroederi of the giant panda. Parasit Vectors. 2013;6:216. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ahmed R, Chang Z, Younis AE, et al. Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes. Genome Biol Evol. 2013;5(7):1246–1260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Devaney E, Winter AD, Britton C. microRNAs: a role in drug resistance in parasitic nematodes?. Trends Parasitol. 2010;26(9):428–433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Winter AD, Weir W, Hunt M, et al. Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel. BMC Genomics. 2012;13(1):4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Poole CB, Davis PJ, Jin J, et al. Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi. Mol Biochem Parasitol. 2010; 169(2):87–94. [DOI] [PubMed] [Google Scholar]
- 33.Wang J, Czech B, Crunk A, et al. Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles. Genome Res. 2011;21(9):1462–1477. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Ma G, Luo Y, Zhu H, et al. MicroRNAs of Toxocara canis and their predicted functional roles. Parasit Vectors. 2016;9:229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Kozomara A, Birgaoanu M, Griffiths-Jones S. miRBase: from microRNA sequences to function. Nucleic Acids Res. 2019;47(D1): D155–D162. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Zibaei M, Sadjjadi SM, Maraghi S. The occurrence of Toxocara species in naturally infected broiler chickens revealed by molecular approaches. J Helminthol. 2017;91(5):633–636. [DOI] [PubMed] [Google Scholar]