Interleukin-1 receptor antagonist overexpression in mesenchymal stem cells improves hemorrhagic cystitis outcomes via HtrA serine peptidase 3

Abstract

Background

Hemorrhagic cystitis (HC), a frequent complication of hematopoietic stem cell transplantation (HSCT), significantly affects quality of life and may worsen prognosis. Mesenchymal stem cells (MSCs) are known for their anti-inflammatory and tissue-regenerative properties. IL-1 receptor antagonist (IL-1Ra) blocks IL-1α and IL-1β by binding IL-1 receptors, offering potential therapeutic benefits. The aim of this study was to explore the therapeutic effect of MSCs overexpressing IL-1Ra on HC and investigate the underlying mechanisms.

Methods

MSCs were isolated from human umbilical cord tissues, and IL-1Ra-overexpressing MSCs (oeIL-1Ra-MSCs) were generated using lentiviral transfections. HC was induced in rats by cyclophosphamide administration. Rats received tail vein injections of either oeIL-1Ra-MSCs or control MSCs (Mock-MSCs). Hematuria and bladder tissue changes were assessed using test strips and hematoxylin & eosin (HE) staining. Immunohistochemistry detected molecular changes in bladder tissues. Gene expression differences between the two MSC groups were analyzed by mRNA sequencing and ChIP techniques.

Results

Treatment with oeIL-1Ra-MSCs significantly alleviated hematuria and reduced bladder edema and hemorrhage, and reduced mRNA expression levels of IL-1β, IL-6, and TNF-α in bladder tissues, compared with those in the Mock-MSC treatment group. Immunohistochemical staining showed a higher presence of CD105-positive cells (a marker for human MSCs) and CD31-positive vessels in bladder tissues treated with oeIL-1Ra-MSCs, indicating enhanced MSC migration and vascular stability. In vitro migration assay demonstrated a higher migration capacity of IL-1Ra overexpressing MSCs compared with that of control MSCs. Moreover, angiopoietin-1 (Ang-1) expression increased, while Angiopoietin-2 (Ang-2) expression decreased in bladder tissues treated with oeIL-1Ra-MSCs, suggesting enhanced blood vessel stabilization. Conditioned medium from oeIL-1Ra-MSC cultures stimulated human umbilical vein endothelial cell (hUVEC) migration, proliferation, and angiogenesis more effectively compared with that in control MSCs. mRNA sequencing revealed elevated HtrA3 expression in oeIL-1Ra-MSCs compared with that in control MSCs. Molecular analysis suggested that IL-1Ra overexpression in MSCs upregulated HtrA3 expression through inhibition of the JNK-c-Jun pathway and activation of the ERK–Egr-1 pathway.

Conclusion

Overexpression of IL-1Ra significantly enhances the therapeutic efficacy of MSCs in HC by promoting MSC migration to damaged bladder tissues, suppressing inflammation, stabilizing blood vessels, and upregulating angiogenesis via activation of HtrA3 signaling pathways.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13287-025-04443-x.

Background

Hemorrhagic cystitis (HC) is a common and serious complication in hematology, affecting approximately 12.2%–36.9% of patients undergoing hematopoietic stem cell transplantation (HSCT) [1, 2]. HC is clinically characterized by hematuria and bladder irritation, which substantially impair the quality of life of patients and can lead to severe outcomes, including death. HC is often associated with the use of cyclophosphamide for chemotherapy, BK virus infection, and HSCT-induced graft-versus-host disease (GVHD) [3]. Current clinical treatments, such as sodium mesylate prophylaxis, hyperbaric oxygen, and continuous bladder irrigation, are often insufficient, and cystectomy may be required in severe cases [4].

Mesenchymal stem cells (MSCs), first identified by Friedenstein and colleagues in 1970 [5], are adult stem cells found in various tissues [6]. Besides helping injured tissues heal [6], MSCs can control the development of inflammation by regulating innate immune cells such as macrophages and mast cells, and play immunomodulatory roles in inflammatory diseases by secreting key biological molecules such as transforming growth factor-β1, nitric oxide, indoleamine 2,3-dioxygenase, and tumor necrosis factor-stimulating gene 6 [7, 8]. Consequently, MSCs have been used in preclinical studies and trials to treat GVHD, rheumatoid arthritis, and other inflammatory conditions [9–11].

Interleukin-1 receptor antagonists (IL-1Ra) are natural inhibitors of IL-1α and IL-1β, and have been widely used to treat autoinflammatory and rheumatic diseases, including pericarditis [12], diabetes [13], and even coronavirus disease-2019 [14]. Although MSCs can secrete IL-1Ra [15], their expression levels are typically low, and only a limited subset of MSCs express IL-1Ra [16]. Genetically modifying MSCs represents a promising strategy for enhancing their therapeutic potential. Previous findings demonstrated the benefits of overexpressing factors such as C-X-C chemokine receptor type 4 and IL-10 in MSCs to improve their chemotactic and anti-inflammatory properties [17, 18].

In this study, we generated MSCs that stably overexpressed and secreted IL-1Ra (oeIL-1Ra-MSCs). Treatment with oeIL-1Ra-MSCs significantly alleviated hematuria, bladder edema, and hemorrhage. Furthermore, our results revealed that overexpressing IL-1Ra in MSCs led to increased HtrA serine peptidase 3 (HtrA3) expression. We also observed that IL-1Ra overexpression promoted MSC migration to the bladder. These findings highlight a potential therapeutic approach for HC, especially in conditions of severe disease.

Materials and methods

This work has been reported in line with the ARRIVE guidelines 2.0.

Sex as a biological variable

We used male Wistar rats in this study because males are associated with HC in allogeneic HSCT [19].

Cell isolation and culture

Human umbilical cord-derived MSCs were generated and expanded as previously described [20]. Isolated MSCs were incubated in 90% Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (FBS; 10 mL/100 mL), 0.272 g/L l-glutamine, 10 ng/mL fibroblast growth factor, 100 U/mL penicillin, and 0.1 mg/mL streptomycin at 37 °C in an incubator containing 5% CO₂. Human umbilical vein endothelial cells (hUVECs) and 293 T cells were purchased from the American Type Culture Collection. The hUVEC cells were grown in 95% endothelial cell medium with 5% FBS, penicillin (100 U/mL), and streptomycin 100 µg/mL, and grown at 37 °C in an incubator with 5% CO₂.

Establishment of oeIL-1Ra-MSCs

The recombinant expression vector, oeIL-1Ra-GV367, was constructed by inserting the target gene into the GV367 vector (Ubi-MCS-SV40-EGFP-IRES-puromycin) using the NM_000577.5 sequence published in GenBank. This study was approved by Shanghai GeneChem Co. Ltd., China. MSCs were seeded at a density of 2 × 10⁵ cells/well in 6-well plates and infected with a synthetic lentivirus at a multiplicity of infection of 10. Cells with stable IL-1Ra expression were selected using puromycin at a concentration of 2 µg/mL.

Animals and model establishment

Male Wistar rats (250–280 g, 6 weeks old) were housed in the animal laboratory of the Second Hospital of Shandong University and maintained under a 12 h light/dark cycle at 24 ± 2 °C. The rats were acclimatized for 1 week before the beginning of the experiment. We randomly divided 24 rats into four groups (n = 6/group), including a normal control group (Con), HC model group (HC), Mock-MSC group (Mock), and oeIL-1Ra-MSC group (oeIL-1Ra). The rat model of HC was established via intraperitoneal injection of cyclophosphamide, following a previously published protocol [21]. Briefly, on day 0, rats in the HC, Mock, and oeIL-1Ra groups were intraperitoneally injected with cyclophosphamide (150 mg/kg). The Mock-MSC and oeIL-1Ra-MSC groups were administered 1 × 10⁶ Mock-MSCs or oeIL-1Ra-MSCs via intravenous injection on days 1 and 3.

HE and IHC staining for histopathological analysis

The rats were euthanized on day 7 after MSC infusion (euthanasia via an overdose of carbon dioxide inhalation in a euthanasia chamber with 100% carbon dioxide; the rats rapidly lost consciousness, minimizing suffering to the extent possible). Rat bladder tissues were retained with 4% paraformaldehyde and embedded in paraffin, and 4 μm paraffin sections were prepared for hematoxylin & eosin (HE) and immunohistochemical (IHC) staining according to standard methods. Histological damage was assessed according to previously established criteria [22].

Paraffin sections were antigenically repaired with sodium citrate antigen-repair solution and blocked using endogenous peroxidase (PV9001, ZSGB-BIO, Beijing, China). Subsequently, primary antibodies against anti-human CD105 (A23956, Abclonal, Wuhan, China), anti-Rat CD80 (A16039, ABclonal), anti-Rat CD206 (GB113497, Servicebio, Wuhan, China), anti-Rat CD31 (GB120005, Servicebio), anti-Rat Ang1 (A3757, ABclonal), and Ang2 (A11306, ABclonal) were added dropwise to the sections. All primary antibodies were diluted according to the manufacturer’s instructions. The sections were incubated overnight at 4 °C. On the following day, reaction enhancement solution and enzyme-labeled goat anti-rabbit IgG (PV9001, ZSGB-BIO, Beijing, China) were added dropwise to the sections, followed by color development using a DAB Kit (ZSZLI-9018, ZSGB-BIO), and hematoxylin re-staining, and sealing. The ImageJ software was used to analyze positive tissues or cells.

Conditioned media acquisition

Mock-MSCs or oeIL-1Ra-MSCs were seeded in 6-well plates at a density of 8 × 10⁴ cells/well, and the cells were allowed to adhere overnight, after which the serum-free medium was replaced to continue the culture for 24 h. The supernatants were collected via centrifugation at 300 × g for 5 min, filtered through a 0.22 μm filter, and frozen at − 70 °C for cryopreservation.

Transwell migration assay

Migration assays were performed in 24-well plates with 8.0 µm pore polyester membrane inserts (3464, Corning, NY, USA). For the hUVEC-migration assays, we added 100 µL (1 × 10⁴ cells/mL) of serum-starved hUVECs to the upper chamber and 600 µL (5 × 10⁴ cells/mL) of Mock-MSCs or oeIL-1Ra-MSCs with 10% FBS to the lower chamber.

To study MSC migration, 100 µL of serum-free Mock-MSCs or oeIL-1Ra-MSCs (1 × 10⁴ cells/mL) were added to the upper chamber, and 600 µL (5 × 10⁴ cells/mL) of culture medium with 20% serum was added to the lower chamber. After 24 h, the excess liquid in the upper chamber was removed, and the cells were fixed with paraformaldehyde for 20 min at room temperature. The cells were stained with 0.5% crystal violet for 10 min. The number of migrated cells was counted in three random fields under a microscope, and the experiment was repeated three times. Cell migration was quantified using ImageJ.

Cell Proliferation assay

MSC and hUVEC proliferation were detected using an 5-Ethynyl-2′-deoxyuridine (Edu) Cell Proliferation Assay Kit (C0075S; Beyotime, Shanghai, China). hUVECs were cultured in Mock-MSC or oeIL-1Ra-MSC-conditioned medium or with blank control (Con) medium for 24 h. The hUVECs were seeded in 96-well plates at a density of 5000 cells per well, and cell proliferation was recorded at 0, 12, and 24 h (three replicate wells/group; three independent experiments). Mock-MSCs or oeIL-1Ra-MSCs were seeded in 96-well plates at a density of 1000 cells/well, and cell proliferation was recorded at 0, 12, and 24 h (three replicate wells/group; three independent experiments). The percentage of Edu-positive cells was analyzed using ImageJ.

Tube formation assay

We added 50 µL of matrix gel (354230, Corning) to 96-well plates and refrigerated the plates overnight at 4 °C. On the following day, the 96-well plates were incubated at 37 °C to allow the matrix gel to cure. The hUVECs were adjusted to 20,000 cells/50 μL on a matrix gel and pre-cultured in Mock-MSC- or oeIL-1Ra-MSC-conditioned medium or blank control medium for 24 h. Subsequently, images were taken after 2 and 3 h to record blood vessel formation. The number of blood vessels was also recorded.

Real-time qPCR analysis

HUVECs, MSCs, and rat bladder tissue RNA were extracted using a Steady Pure Quick RNA Extraction Kit (AG21023, Accurate Biology, Hunan, China). The RNA was reverse transcribed into complementary DNA (cDNA) using Hifair® III 1st Strand cDNA Synthesis SuperMix for quantitative polymerase chain reaction (qPCR) (11141ES60, Yeasen, Shanghai, China). The resulting cDNA was analyzed using ChamQ Universal SYBR qPCR Master Mix (Q711-02, Vazyme, Nanjing, China). The primer sequences are shown in Table 1. qPCR assays were performed using the QuantStudio™ 5 real-time fluorescence quantitative PCR system (ThermoFisher Scientific, USA). Relative gene-expression levels were calculated using the 2^−ΔΔCt method.

Table 1.

The sequences of primers for real-time qPCR 

Gene	Forward	Reverse
IL-1Ra (homo)	CTGGAGGACCTGTTCTGGGA	GGTATTGTCCACGGCCTTCA
HtrA3 (homo)	TGTGTTGTTGCTGGGTCACT	CCAGTGAGGGGGCTTTGAT
GAPDH (homo)	AATGAATGGGCAGCCGTTAG	GCAGGAGGCATTGCTGATGAT
IL-1β (rat)	GGGCCTCAAGGGGAAGAATC	TTTGGGATCCACACTCTCCAG
IL-6 (rat)	AGAGACTTCCAGCCAGTTGC	TGCCATTGCACAACTCTTTTC
TNF-α (rat)	ATGGGCTCCCTCTCATCAGT	GCTTGGTGGTTTGCTACGAC
Zo-1 (rat)	GCCCAGAGTGAAGGCAATTC	TCACAGTGTGGCAAGCGTAG
HtrA3 (rat)	AGCTCTTTCTGAGGCACCCT	GTGAGTTGGGAACGACCTCT
GAPDH (rat)	CCGCATCTTCTTGTGCAGTG	CGATACGGCCAAATCCGTTC

Western blot analysis

oeIL-1Ra-MSCs were pre-treated with JNK-activator Anisomycin (5 μM, HY-18982, MedChem Express, USA), recombinant IL-1β protein (10 ng/mL [23, 24], HZ-1164, Proteintech, Wuhan, China), JNK inhibitor SP600125 (20 μM, HY-12041, MedChem Express, USA), and Erk inhibitor Ravoxertinib (GDC-0994, MedChem Express, USA). Nuclear proteins were extracted using a Nuclear and Cytoplasmic Protein Extraction Kit (P0027, Beyotime), and the remaining cells were resuspended in RIPA buffer (R0010, Solarbio, Beijing, China) containing 1% protease inhibitor and 1% phosphatase inhibitor, and placed on ice for 30 min. The cells were then centrifuged at 12,000 rpm for 20 min and the supernatant was collected. A BCA kit was used to determine protein concentrations (ZJ102, Epizyme Biomedical Technology, Shanghai, China), and the protein samples were heated at 95 °C for 5 min by adding 5 × loading buffer. Equal amounts of protein were separated via 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and then transferred to a polyvinylidene fluoride (PVDF) membrane (IPVH00005, Merck Millipore, Billerica, MA, USA). Primary antibodies against the following protein targets were used: IL-1Ra (A23956, ABclonal), HtrA3 (Abs101856, Absin, Shanghai, China), c-Jun (9165, Cell Signaling Technology (CST), Danvers, MA, USA), p-c-Jun (91952, CST), histone-H3 (A17562, ABclonal), JNK (9252, CST), p-JNK (4668, CST), ERK (4695, CST), p-ERK (4370, CST), early growth response 1 (Egr-1; A23424, ABclonal), and GAPDH (A19056, ABclonal). According to the manufacturer’s instructions, all the primary antibodies were diluted and incubated with PVDF membranes overnight at 4 °C. On the following day, the membranes were incubated with a horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (AS014, ABclonal) for 1 h at 22 °C, and bands were detected with chemiluminescent substrate (RM00021, ABclonal) under chemiluminescence.

Enzyme-linked immunosorbent assay (ELISA)

Supernatants of Mock-MSCs or oeIL-1Ra-MSCs were collected using the conditioned-medium collection method, and the IL-1Ra or HtrA3 concentrations were determined using the Human IL-1Ra (MULTI SCIENCES, EK1132) and HtrA3 ELISA Assay Kit (EH116196, BYabscience, Nanjing, China); the concentration of each sample was calculated using an enzyme marker to detect the absorbance using a standard curve.

Dual-luciferase assay

We identified three potential Egr-1 binding sites within the HtrA3 promotor region using the JASPAR database (https://jaspar.elixir.no). Plasmids encoding HtrA3, Egr-1, and a control vector, as well as three HtrA3 mutant constructs (HtrA3 mut-1, mut-2, and mut-3) corresponding to the predicted binding sites, were synthesized by Abiotech, Jinan, China. The HtrA3 and mutation sequences are provided in Additional File 1. The plasmid encoding HtrA3 was co-transfected into 293 T cells along with either the plasmid encoding Egr-1 or the control vector. Additionally, the Egr-1 plasmid was co-transfected with HtrA3 mutant plasmids (mut-1, mut-2, or mut-3) into 293 T cells, using Lipofectamine 3000 (Thermo Fisher Scientific, L3000015). At 24 h post-transfection, the transfectants were lysed using a Dual Luciferase Reporter Gene Assay Kit (Yeasen, 11402ES60), and firefly and Renilla luciferase intensities were measured using an enzyme marker.

siRNA transfection

An siRNA targeting human HtrA3 (sense strand: 5′-CGCUACAAGUUCAACUUCAUUTT-3′; antisense strand: 5′-AAUGAAGUUGAACUUGUAGCGTT-3′) was purchased from HanBio (Wuhan, China). The siRNA was transfected into target cells at 30%–50% confluence using Lipofectamine 3000, and the cells were cultured for 24 h for subsequent experiments.

ChIp experiments

Using the ChIP Assay Kit (P2080S, Beyotime), Mock-MSCs and oeIL-1Ra-MSCs cells were crosslinked with 1% formaldehyde for 10 min at 37 °C and then sonicated, enabling the DNA to break into 200–1000 base-pair fragments. The lysates were then mixed and suspended overnight at 4 °C with either an IgG antibody (2729, CST) or anti-Egr-1 antibody (A23424, ABclonal), after which they were mixed with Protein A/G Magnetic Beads for 60 min at 4 °C. The precipitates were eluted and subjected to agarose gel electrophoresis to separate the PCR products. The primers used in PCR are presented in Table 2. Input was total genomic DNA as the positive control and DNA bound to IgG antibody as the negative control.

Table 2.

The sequences of primers in PCR followed ChIP

	Forward	Reverse
Primer1	GGTGCTATTGCCCCTTGTCA	AGGCGTTGAGTAGGGAGCG
Primer2	AGGACCCCTGCGTGTCTGTA	ACCAGCTCCCTCCAGCCT

Statistical analyses

All data are expressed as the mean ± SEM. Student’s t-test and one-way analysis of variance were performed using GraphPad Prism 8 software (La Jolla, CA, USA) to assess differences between groups.

Results

Establishment of oeIL-1Ra-MSCs

In this study, MSCs were transduced with a lentiviral vector that drove IL-1Ra overexpression, and puromycin was used to screen for clonal cell lines with stable IL-1Ra expression. qPCR and western blotting analyses confirmed that IL-1Ra expression was upregulated in oeIL-1Ra-MSCs (Fig. S1A, B). ELISA analysis of cell culture supernatants revealed that oeIL-1Ra-MSCs secreted more IL-1Ra than Mock-MSCs (Fig. S1C). In addition, the doubling time of oeIL-1Ra-MSCs was shorter than that of Mock-MSCs, as shown by Edu proliferation assays, which revealed that oeIL-1Ra-MSCs proliferated more rapidly than Mock-MSCs at 12 and 24 h (Fig. S1D).

oeIL-1Ra-MSCs significantly alleviated hematuria and bladder oedema in HC rats

A rat model of HC was prepared via intraperitoneal cyclophosphamide injection. The rats showed obvious hematuria, as assessed by a hematuria test paper after 24 h (Fig. S2A). After euthanasia, clear edema and hemorrhaging were visible in the rat bladders, suggesting that the model was successfully established (Fig. S2B, C). Hematuria was assessed and scored using hematuria test paper on day 7. Hematuria was significantly relieved, and the hematuria score was lower in oeIL-1Ra-MSC-treatment rats than it was in Mock-MSCs (Fig. 1A, B). We obtained bladder tissues from the euthanized rats and found that hemorrhaging in the oeIL-1Ra-MSC treatment group was significantly relieved at the macro level (Fig. 1C). The bladder tissues of the rats were weighed, and the wet bladder weight of the oeIL-1Ra-MSC group was significantly lower than that of the Mock-MSC group (Fig. 1D). HE staining was performed on the bladder tissues of rats in all four groups separately to observe pathological changes and score hemorrhaging and edema. The results indicated that oeIL-1Ra-MSC treatment significantly reduced bladder edema and hemorrhaging, accompanied by a decrease in pathology scores (Fig. 1E).

Fig. 1.

oeIL-1Ra-MSCs significantly alleviated hematuria and bladder oedema in HC rats. A Representative hematuria test-strip presentations for each group in the same experiment. B Hematuria test-strip score collected from two experiments and performed statistics (n = 3). C Naked eye view of a rat bladder. D Wet weight of rat bladders (n = 6). E HE staining of rat bladder tissues and rat bladder tissue hemorrhagic edema scores based on HE staining (n = 3). F Stained rat bladder tissue for CD105 expression and the number of CD105-positive cells in bladder tissue of rats treated with Mock-MSCs or oeIL-1Ra-MSCs on Day 7 (n = 3). G Transwell assays conducted to detect differences in the migratory abilities of Mock-MSCs and oeIL-1Ra-MSCs. Scale bar = 100 μm or 50 μm. Data are presented as the mean ± standard error of the mean (SEM) of three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

IL-1Ra overexpression promoted MSC migration

To assess MSC accumulation in HC bladder tissues, we performed IHC staining of rat bladder tissues by labeling human MSCs with anti-CD105 antibodies. A significantly higher number of CD105-positive cells were observed in rat bladder tissues treated with oeIL-1Ra-MSCs compared to those treated with Mock-MSCs on both Day5 and Day7 (Fig. S3, Fig. 1F). In vitro Transwell analysis demonstrated that oeIL-1Ra-MSCs exhibited enhanced migratory capacity compared to Mock-MSCs. These findings suggest that oeIL-1Ra-MSCs possess enhanced migratory capacity in vitro, as well as an increased ability to home to sites of inflammation in vivo.

oeIL-1Ra-MSCs attenuated the inflammatory response in bladder tissues from rats with HC

To assess the immune microenvironment of bladder tissues, M1-type macrophages were labeled with an anti-CD80 antibody and M2-type macrophages were labeled with an anti-CD206 antibody. The results showed that the oeIL-1Ra-MSC treatment significantly reduced abundance of M1-type macrophages (Fig. 2A), while increased the abundance of M2-type macrophages (Fig. 2B). qPCR was conducted to assess expression of inflammatory cytokines IL-1β, IL-6, and tumor necrosis factor-alpha (TNF-α) in bladder tissues from each rat group. Our results demonstrated that the mRNA-expression levels of IL-1β, IL-6, and TNF-α were significantly lower in the oeIL-1Ra-MSCs group (Fig. 2C–E).

Fig. 2.

oeIL-1Ra-MSCs attenuated the inflammatory response in bladder tissues from HC rats. A CD80 staining of rat bladder tissues and CD80-positive cell counts (n = 3). B CD206 staining of rat bladder tissues and CD206-positive cell counts (n = 3). C–E mRNA expression levels of IL-1β, IL-6, and TNF-α in rat bladder tissues (n = 3). Scale bar = 50 μm. Data are presented as the mean ± SEM of three independent experiments. **P < 0.01, ***P < 0.001, ****P < 0.0001

oeIL-1Ra-MSCs promoted angiogenesis and stabilized blood vessels

To further examine changes in blood vessels in rat bladder tissue after oeIL-1Ra-MSC treatment, we performed IHC staining for CD31 to label the associated blood vessels. In the HC group, intact blood vessels in bladder tissues were significantly reduced, exhibiting thin and discontinuous vessel walls. However, after treatment with oeIL-1Ra-MSCs, the number of blood vessels in bladder tissues with intact walls increased significantly (Fig. 3A). IHC staining of rat bladder blood vessels for Ang-1 and Ang-2 revealed that Ang-1 expression increased and Ang-2 expression decreased in rat bladder tissues after oeIL-1Ra-MSC treatment (Fig. 3B, C). qPCR analysis of RNA from bladder tissues in each group of rats was performed to detect tight junction protein zonula occludens-1 (Zo-1), revealing that Zo-1 mRNA expression increased in the oeIL-1Ra-MSCs group. Therefore, we hypothesized that oeIL-1Ra-MSCs possess greater capacity to promote angiogenesis than Mock-MSCs. We selected the hUVEC line for in vitro experiments and studied the cell-migration rate of hUVECs by conducting Transwell-migration assays (Fig. 3D) and scratch wound-healing assays (Fig. S4A). We found that hUVECs treated with oeIL-1Ra-MSC-conditioned medium migrated significantly more than did hUVECs treated with Mock-MSC-conditioned medium (Fig. 3D, E). When performing angiogenesis tube-formation assays, we found that the number of blood vessels formed by hUVECs after 2 or 3 h of culture with oeIL-1Ra-MSCs conditioned medium was significantly higher than that in the control and Mock-MSC-conditioned medium groups (Fig. 3G–I). In our Edu proliferation assays, hUVECs cultured with oeIL-1Ra-MSC-conditioned medium had significantly higher cell-proliferation rates at 12 and 24 h than did hUVECs cultured in Mock-MSC-conditioned medium (Fig. 3J–L). Taken together, the results obtained from both in vivo and in vitro experiments demonstrate that oeIL-1Ra-MSCs enhance angiogenesis.

Fig. 3.

oeIL-1Ra-MSCs promoted angiogenesis and stabilized blood vessels. A CD31 staining of labeled blood vessels and the number of blood vessels in rat bladder tissues (n = 3). B Ang-1 staining in rat bladder tissue and its positive areas (n = 3). C Ang-2 staining in rat bladder tissue and Ang-2-positive areas (n = 3). D and E Numbers of migrating hUVECs following culture in control medium, Mock-MSC-conditioned medium, or oeIL-1Ra-MSC-conditioned medium analyzed in Transwell cell-migration assays (n = 3). F mRNA-expression levels of Zo-1 in rat bladder tissues (n = 3). G–I Angiogenesis of hUVECs after culture in blank medium, Mock-MSC-conditioned medium, or oeIL-1Ra-MSC-conditioned medium, and the number of vessels generated at 2h, 3h (n = 3). J–L Edu proliferation assays performed to analyze the proportion of Edu-positive cells in hUVECs cultured with blank medium, Mock-MSC-conditioned medium, or oeIL-1Ra-MSC-conditioned medium at 12h, 24h (n = 3). Scale bar = 50 μm. Data are presented as the mean ± SEM of three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

Overexpression of IL-1Ra in MSCs increased HtrA3 expression

To further explore the mechanisms whereby oeIL-1Ra-MSCs promote angiogenesis and migration, we performed mRNA sequencing of Mock- and oeIL-1Ra-MSCs (the results of the RNA sequencing are presented in Additional File 3). Scatter plots showed differentially expressed genes in Mock-MSCs and oeIL-1Ra-MSCs (Fig. 4A), and heat maps showed that the top 10 genes (including HtrA3) were significantly upregulated after IL-1Ra overexpression (Fig. 4B). We detected high HtrA3 expression in oeIL-1Ra-MSCs at both the mRNA and protein levels after IL-1Ra (Fig. 4C–E). We also observed increased secretion of HtrA3 in oeIL-1Ra-MSC supernatants via ELISA analysis (Fig. 4F). Subsequently, we detected HtrA3 expression in rat bladder tissues via qPCR analysis and IHC staining, finding that HtrA3 expression was higher in rat bladder tissues at both the mRNA (Fig. 4G) and protein levels after oeIL-1Ra-MSC treatment (Fig. 4H, I).

Fig. 4.

Overexpressing IL-1Ra in MSCs increased HtrA3 expression. A Volcano plot showing differentially expressed genes in Mock-MSCs and oeIL-1Ra-MSCs. B Heat map showing upregulated and downregulated genes in Mock-MSCs and oeIL-1Ra-MSCs. C HtrA3 mRNA expression in Mock-MSCs and oeIL-1Ra-MSCs (n = 3). D and E HtrA3 protein expression in Mock-MSCs and oeIL-1Ra-MSCs (n = 3). F HtrA3 secretion from Mock-MSCs and oeIL-1Ra-MSCs into their supernatants (n = 3). G and H HtrA3 staining of rat bladder tissues and statistical analysis of the positive areas (n = 3). I HtrA3 mRNA expression in rat bladder tissues after treatment with Mock-MSCs or oeIL-1Ra-MSCs (n = 3). Scale bar = 50 μm. Data are presented as the mean ± SEM of three independent experiments. *P < 0.05, ***P < 0.001, ****P < 0.0001

HtrA3 knockdown reduced the therapeutic efficacy of oeIL-1Ra-MSCs

To clarify the therapeutic role of HtrA3 in oeIL-1Ra-MSCs, small-interfering RNA (siRNA) was used to knock down HtrA3 expression in oeIL-1Ra-MSCs (Fig. 5A–C). Our Transwell cell-migration assays showed that knocking down HtrA3 expression decreased the migration ability of oeIL-1Ra-MSCs (Fig. 5D). OeIL-1Ra-MSCs + siHtrA3-conditioned medium was obtained as previously described and cultured with hUVECs, which resulted in decreased HtrA3 expression (Fig. 5E–G). Angiogenesis experiments also showed that hUVECs treated with conditioned medium from oeIL-1Ra-MSCs transfected with siHtrA3 displayed significant lower angiogenesis at 2 and 3 h compared to hUVECs treated with oeIL-1Ra-MSC-conditioned medium (Fig. 5D). Subsequently, a rat model of HC was established using the same animal experimental method described previously. Animal experiments revealed that hematuria in rats treated with oeIL-1Ra-MSCs+siHtrA3 was aggravated (Fig. 5I, J). Collectively, these in vitro and in vivo findings indicate that HtrA3 knockdown partially attenuates the therapeutic effects of oeIL-1Ra-MSCs.

Fig. 5.

HtrA3 knockdown reversed the effects of oeIL-1Ra-MSCs in vitro and in vivo. A–C HtrA3 expression at the mRNA and protein levels in Mock-MSCs, oeIL-1Ra-MSCs, and oeIL-1Ra-MSCs transfected with siHtrA3. D Numbers of migrating Mock-MSCs, oeIL-1Ra-MSCs, and oeIL-1Ra-MSCs transfected with siHtrA3 measured in Transwell cell-migration assays (n = 3). E–G Expression of HtrA3 at the mRNA and protein levels in hUVECs after culture with blank medium, Mock-MSC-conditioned medium, oeIL-1Ra-MSC-conditioned medium, or oeIL-1Ra-MSCs+siHtrA3-conditioned media (n = 3). H HUVECs were incubated with blank medium, Mock-MSCs-conditioned medium, oeIL-1Ra-MSCs-conditioned medium, or oeIL-1Ra-MSCS+siHtrA3-conditioned medium for 24 h. Angiogenesis was observed after 2 and 3 h, and the number of vessels was counted. Scale bar = 50 μm (n = 3). (I and J) Hematuria test strips and rat bladders after treatment with Mock-MSCs, oeIL-1Ra-MSCs, or oeIL-1Ra-MSCs transfected with siHtrA3. Data are presented as the mean ± SEM of three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001,****P < 0.0001

IL-1Ra upregulated HtrA3 expression through the c-Jun N-terminal kinase (JNK)–c-Jun pathway

We further explored the molecular mechanisms underlying HtrA3 upregulation after IL-1Ra overexpression in MSCs. Western blot experiments revealed less phosphorylated c-Jun (p-c-Jun) in nuclear protein extracts and p-JNK in total cellular protein extracts from oeIL-1Ra-MSCs compared to those from Mock-MSCs. Subsequently, we treated oeIL-1Ra-MSCs with 10 ng/mL IL-1β to counteract the effects of IL-1Ra. We observed higher levels of p-JNK in total cellular protein extracts and p-c-Jun in nuclear protein extracts from oeIL-1Ra-MSCs treated with IL-1β, as well as lower HtrA3 levels, when compared with those in oeIL-1Ra-MSCs. To further confirm the role of IL-1Ra in regulating HtrA3 expression via inhibition of the JNK-c-Jun pathway, we treated oeIL-1Ra-MSCs with the JNK activator Anisomycin. This treatment resulted in increased levels of p-JNK in total cellular proteins and p-c-Jun in the cytosol, accompanied by a decrease in HtrA3 expression. Conversely, treatment with the JNK inhibitor SP600125 in the presence of IL-1β led to reduced levels of p-JNK and cytosolic p-c-Jun, along with an increase in HtrA3 expression (Fig. 6A, B).

Fig. 6.

oeIL-1Ra-MSCs promoted high HtrA3 expression by inhibiting the c-Jun pathway and activating the ERK–Egr-1 pathway. A Nuclear p-c-Jun protein expression relative to endogenous reference histone-3 protein expression. B Total protein p-JNK and HtrA3 levels relative to endogenous GAPDH expression. C Total cellular p-ERK, Egr-1, and HtrA3 protein levels measured relative to endogenous GAPDH levels, with or without ravoxertinib treatment. D Predicted sites in the promoter region of the HtrA3 gene binding to Egr-1. E Dual luciferase reporter-gene assays detected Egr-1-dependent initiation of HtrA3 transcription. F ChIP followed by PCR was performed to detect Egr-1 binding to HtrA3. Data are presented as the mean ± SEM of three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

Overexpressing IL-1Ra in MSCs resulted in higher Egr-1 expression and initiated HtrA3 transcription

Our mRNA-sequencing results (in Additional File2) showed that Egr-1 expression was significantly higher in oeIL-1Ra-MSCs than it was in Mock-MSCs (Fig. 4B). Egr-1 is a zinc finger transcription protein that can initiate the transcription of various genes; the University of California at Santa Cruz website (http://genome.ucsc.edu/) was used to predict that Egr-1 may be a transcription factor for HtrA3. To inhibit ERK upstream of Egr-1, the extracellular signal-related kinase (ERK) inhibitor ravoxertinib was applied to oeIL-1Ra-MSCs at a concentration of 5 μM, which significantly downregulated p-ERK, Egr-1, and HtrA3 (Fig. 6C). We predicted three binding sites using JASPAR database where Egr-1 may bind to HtrA3 and initiate transcription with the highest composite score: sites 640–653, 1902–1915, and 1943–1956 in the promoter sequence of the HtrA3 gene (Fig. 6D). To further validate the relationship between HtrA3 and Egr-1, the Dual-Luciferase Assay was conducted to determine the control of HtrA3 transcription by Egr-1. We found that the relative fluorescence ratio in 293 T cells co-transfected with the Egr-1 and HtrA3 plasmids was significantly higher than that transfected with the empty plasmid and HtrA3 plasmid. To determine whether Egr-1 initiates transcription of HtrA3 and to identify its binding sites, HtrA3 mutant plasmids were generated based on the predicted binding regions shown in Fig. 6D and co-transfected with Egr-1 plasmids into 293 T cells. Fluorescence intensity significantly decreased following mutations at binding sites 1, 2, and 3 (Fig. 6E). ChIP assays were then conducted to obtain DNA–protein complexes binding to Egr-1 in both Mock-MSCs and oeIL-1Ra-MSCs. PCR amplification primers were designed to target the predicted binding sites: Primer 1 spanned the site 1, while Primer 2 covered the site 2 and site 3 (Fig. 6D). Subsequent PCR amplification using both Primer 1 and Primer 2 yielded HtrA3-specific bands (Fig. 6F), providing evidence that Egr-1 binds to all three predicted sites in the HtrA3 promoter. Collectively, these results suggest that Egr-1, which is upregulated in oeIL-1Ra-MSCs, directly promotes HtrA3 transcription.

Discussion

HSCT is a critical treatment for hematological malignancies; however, HC is a serious complication of such treatment. HC can increase the length of hospital stays, impose financial burdens on patients, and in severe cases, lead to impaired renal function [25]. Several approaches have been proposed to mitigate the effects of HC [26].

Previously, mouse-derived bone marrow MSCs [27] and dermal MSCs expressing ATP-binding cassette subfamily B member 5 (ABCB5) promoted wound healing by secreting IL-1Ra [28]. In addition to inducing endogenous IL-1Ra secretion [29], human umbilical cord-derived MSCs can also secrete a certain amount of IL-1Ra on their own [30]. In this study, we overexpressed IL-1Ra in MSCs to achieve a synergistic anti-inflammatory effect against cyclophosphamide-induced HC. Our results demonstrate that oeIL-1Ra-MSCs significantly alleviated hematuria and hemorrhagic bladder edema. The therapeutic effect was particularly notable on day 7 of treatment. Our in vivo and in vitro results also showed that IL-1Ra overexpression significantly enhanced MSC migration. This increase in cell migration may contribute to an improved overall therapeutic response mediated by MSC administration.

One of the key mechanisms underlying cyclophosphamide-induced HC is acrolein accumulation in the bladder, which triggers inflammatory responses by activating nuclear factor-kappa B and activator protein-1 signaling pathways, leading to the release of pro-inflammatory cytokines such as IL-1β, IL-6, and TNF-α [31, 32]. In this study, oeIL-1Ra-MSC treatment significantly reduced the levels of inflammatory molecules in bladder tissue compared to Mock-MSC treatment, indicating that IL-1Ra overexpression enhances the anti-inflammatory properties of MSCs.

Moreover, we evaluated macrophages in rat bladder tissues, which are produced in tissues with anti-inflammatory, pro-tissue repair, and anti-fibrotic effects [33], and which can be polarized in the immune system into classically activated macrophages with pro-inflammatory functions (M1) and alternatively activated macrophages with anti-inflammatory functions (M2) [34]; MSCs can preferentially polarize macrophages towards the anti-inflammatory M2 phenotype [35]. As expected, oeIL-1Ra-MSC treatment significantly enhanced abundances of M2 macrophages (CD206⁺) and reduced abundances of pro-inflammatory M1 macrophages (CD80⁺) in rat bladder tissues compared to Mock-MSC treatment. This shift in macrophage polarization likely contributed to the reduced inflammation observed in treated animals. Bladder edema is often present in HC, potentially owing to increased vascular exudation mediated by IL-1β [36]. We found that oeIL-1Ra-MSCs significantly reduced edema in bladder tissues. More importantly, we observed marked elevated expression of angiopoietin (Ang)-1, a stabilizing factor of blood vessels [37] and decreased expression of Ang-2, a factor that destabilizes blood vessels [38]. This shift in the Ang-1/Ang-2 ratio suggests that oeIL-1Ra-MSCs counteract the effects of vascular leakage by stabilizing the blood vessel architecture. Additionally, more pronounced increases in Zo-1 expression, an important component of the endothelial barrier [39], and blood vessel density were observed in bladders treated with oeIL-1Ra-MSCs, which supports the hypothesis that oeIL-1Ra-MSCs may play important roles in maintaining and improving the integrity of the bladder epithelium and angiogenesis.

To explore the mechanisms underlying the enhanced therapeutic effects of oeIL-1Ra-MSCs, we performed mRNA sequencing, which revealed that HtrA3 (a serine protease associated with angiogenesis and tissue repair) was significantly upregulated in MSCs overexpressing IL-1Ra. HtrA3 can promote endothelial cell–matrix interactions and enhance MSC migration [40, 41]. We confirmed that knocking down HtrA3 in oeIL-1Ra-MSCs abrogated their migratory and angiogenic activities and reversed their therapeutic effects on hematuria in animal models. These results suggest that HtrA3 may play a pivotal role in oeIL-1Ra-MSC-associated therapeutic effects in HC.

Given the critical role of HtrA3 in HC in rats, we investigated the mechanism by which MSCs secrete HtrA3 following IL-1Ra overexpression. The JNK–c-Jun pathway is known to be inhibited by IL-1Ra [42], which is involved in HtrA3 transcription [43]. Our results demonstrate that IL-1Ra overexpression in MSCs suppresses JNK phosphorylation, leading to reduced c-Jun activation and increased HtrA3 expression. In addition, using the UCSC database, we predicted that Egr-1 may function as a transcription factor for HtrA3. Consistently, mRNA sequencing analysis revealed that Egr-1 was the most significantly upregulated gene in oeIL-1Ra-MSCs. As an early-response gene, Egr-1 functions as a zinc-finger transcription factor that drives the expression of multiple target genes [44]. Using the JASPAR database, we predicted three Egr-1 binding sites in the promoter region of the HtrA3 gene. Moreover, ChIP and DLA assays confirmed that Egr-1 initiated HtrA3 transcription. To our knowledge, this is the first report demonstrating that Egr-1 directly regulates HtrA3 expression.

Based on our findings and previous reports, we constructed a schematic diagram (Fig. 7) to illustrate the potential molecular mechanisms underlying the enhanced angiogenic and migratory activity of IL-1Ra-overexpressing MSCs in HC. Briefly, IL-1Ra overexpression inhibits the JNK-c-Jun pathway while simultaneously activating the ERK-Egr-1 pathway, both of which lead to upregulation of HtrA3 expression. Increased HtrA3 expression, in turn, promotes angiogenesis and MSC migration.

Fig. 7.

Mechanisms whereby IL-1Ra overexpression in MSCs significantly improved the prognosis of HC through the HtrA3 signaling pathway. oeIL-1Ra overexpression in MSCs increased the ability of MSCs to migrate to damaged tissues, and secreted IL-1Ra inhibited inflammation in HC. In addition, oeIL-1Ra-MSCs inhibited the JNK–c-JUN pathway to promote HtrA3 expression and activated the ERK–Egr-1 pathway to initiate the transcription and high expression of HtrA3, which promoted angiogenesis and MSC migration

Conclusion

Our findings demonstrate that IL-1Ra overexpression in MSCs enhances their migration capacity towards inflamed tissues and improves their therapeutic efficacy in HC. By modulating inflammation response, reducing edema, promoting angiogenesis, and alleviating hematuria, oeIL-1Ra-MSCs emerge as a promising therapeutic strategy for treating HC, with potential applicability to a broader range of inflammatory disorders.

Abbreviations

MSCs

Mesenchymal stem cell

HC

Hemorrhagic cystitis

HtrA3

HtrA serine peptidase 3

IL-1Ra

Interleukin-1 receptor antagonist

HSCT

Hematopoietic stem cell transplantation

GVHD

Graft-versus-host disease

qPCR

Quantitative polymerase chain reaction

Edu

5-Ethynyl-2′-deoxyuridine

ELISA

Enzyme-linked immunosorbent assay

HE

Hematoxylin and eosin

IHC

Immunohistochemical

siRNA

Small-interfering RNA

hUVEC

Human Umbilical Vein Endothelial Cells

p-c-Jun

Phosphorylated c-Jun

ERK

Extracellular signal-related kinase

ChIP

Chromatin immunoprecipitation

Author contributions

CYZ and YJ were responsible for the conceptualization of the study. JLS performed the experiments. YXH, YYC provided methodological help. JLS, YXH, LC analyzed the data and JLS wrote the manuscript. CYZ and YJ revised the manuscript.

Funding

This study was supported by the Key Research and Development Program of Shandong Province (No. 2021 CXGC011101).

Availability of data and materials

Cell sequencing results have been uploaded as a supplementary file, all additional files are included in the manuscript. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Materials availability

This study did not generate new unique reagents.

Declarations

Ethics approval and consent to participate

The umbilical cord was obtained from the Department of Obstetrics at the Second Hospital of Shandong University. The source of human umbilical cord and animal experiments were approved by the Ethics Committee of the Second Hospital of Shandong University. Project title: Efficacy and mechanism of overexpression of IL-1Ra mesenchymal stem cells and their exosomes in the treatment of hemorrhagic cystitis; No. 2024SCR003; date of approval: 2024-08-12. All human umbilical cord tissues used in this study received written informed consent from the parturient prior to sample collection.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.