Polymorphic Distribution of Human Homeostatic Iron Regulator Gene H63D rs1799945 and Clinico‐Hematological Parameters of Sickle Cell Anemia Patients: A Case‐Control Study in Northern Ghana

ABSTRACT

Background and Aim

The study assessed the polymorphic distribution of H63D rs1799945 of HFE gene and clinico‐hematological parameters of SCA patients.

Methods

Sixty sickle cell anemia (SCA) patients and 30 healthy controls without sickle cell disease between the ages of 2–38 years were selected for this case‐control study from March to July, 2023 in the Northern Ghana. Ethylenediaminetetraacetic acid (EDTA)‐anticoagulated blood samples were used for complete blood count estimation using a 5‐part hematology autoanalyzer (URIT‐5250 China). Genomic DNA was extracted from whole blood using the spin‐column protocol for DNA (Qiagen Kit) and genotyping of H63D rs1799945 gene was performed using Agena MassARRAY with iPLEX PCR (Agena Biosciene, USA).

Results

The median age of the participants was 15.8 (2.0–38.0) years. All the study participants possess only the wild‐type allele (CC) of the H63D rs1799945 gene. The mutant variants (CG and GG) were not detected among the study population. There were significant reductions in the RBC (p < 0.001), Hb (p < 0.001), and HCT (p < 0.001), but higher levels of ferritin (p < 0.001), CRP (p < 0.001), MCV (p = 0.001), RDW‐CV% (p < 0.001), TWBC (p < 0.001) and platelet count (p = 0.002) in SCA participants than the controls. Incidence of vaso‐occlusive crisis (VOC) correlated with increased levels of ferritin (r = 0.458, p < 0.001), CRP (r = 0.461, p < 0.001), platelet (r = 0.537, p < 0.001) and WBC (r = 0.302, p = 0.019) counts but inversely correlated with Hb levels (r = −517, p < 0.001) of SCA patients. Also, levels of ferritin (p < 0.001), Hb (p = 0.001), TWBC (p = 0.018), platelet (p < 0.001), frequencies of VOC (p < 0.001) and number of hospitalization (p < 0.001), were significantly improved in participants on hydroxyurea therapy than the hydroxyurea naïve participants.

Conclusion

The mutant G allele is very rare among the study population. The study also observed severe hematological alterations in SCA participants compared to the controls group. Hydroxyurea was found to improve the clinico‐hematological parameters and the need to encourage its usage.

1. Introduction

Sickle cell anemia (SCA) is the most common autosomal recessive genetic disorder of hemoglobin characterized by chronic hemolytic anemia as a result of the inheritance of mutant hemoglobin genes from both parents. It is caused by a point mutation in codon 6 which causes the substitution of valine for glutamic acid, resulting in the production of a defective form of hemoglobin (hemoglobin S [HbS]), which induces polymerization under low oxygen stress [1, 2]. Globally, over 300,000 babies are born annually with the severe forms of sickle cell disease (SCD), with the major proportion occurring in low and middle‐income countries. An estimated 5% of the world's population are healthy carriers of the gene for SCD or thalassemia [3]. The prevalence of sickle cell disease among newborns in Ghana has been reported to be 2% (about 15,000) out of which 55% have SCA (HbSS) [2].

Iron is tightly controlled under the synergetic action of several proteins including homeostatic iron regulator (HFE), transferrin receptor 2 (TfR2), haemojuvelin (HJV), hepcidin (HAMP), and solute carrier family 40 member 1 (SLC40A1) [4]. The HFE gene on chromosome 6 encodes a protein similar to major histocompatibility complex 1 (MHC‐1) proteins that bind to β₂‐microglobulin and transferrin receptor (TfR) on the surface of cell. The HFE protein reduces the affinity of transferrin receptors for transferrin, which lowers iron absorption by the cell [5].

The clinical complications of SCA are influenced by multiple genetic and environmental factors, one of which is iron homeostasis. The HFE, particularly the H63D polymorphism (rs1799945), has drawn interest in research due to its potential impact on iron homeostasis, which is critical for the normal functioning of erythrocytes [6]. This polymorphism is a known variant of the HFE gene that may influence iron absorption and distribution within the body [7, 8, 9].

Through Fenton pathway, the excess iron produces reactive oxygen species (ROS), forming hydroxyl radicals from superoxide or hydrogen peroxide injurious to cells [10].

Polymorphic distribution rates of 20%, 10%, and 1% for H63D, C282Y, and S65C, respectively, have been documented in Caucasian European populations [6, 9, 11]. The H63D mutation is 17% high in Europeans, 12% high in American and is rare in East Asian (3%), South Asian (7%), and African (1%) populations. H63D mutation accounts for a mild form of hereditary haemochromatosis (HH) [4, 12].

The relationship between the H63D (rs1799945) mutation and the clinical manifestations of SCA has not been fully elucidated, although iron overload is a recognized concern in SCA patients due to chronic blood transfusions and ineffective erythropoiesis [7, 10]. Some studies suggest that H63D may modulate the severity of SCA by influencing iron‐related complications such as anemia and organ damage [13, 14]. Assessing the allelic frequency of the H63D (rs1799945) gene polymorphism and clinico‐hematological parameters could provide valuable insights into its potential role in the clinical management of SCA patients.

Again, there is a dearth of information regarding the distribution of the HFE H63D rs1799945 gene polymorphism in Ghana, since most of the studies were conducted in Western countries with different racial or ethnic populations and therefore, the need for this study.

2. Materials and Methods

2.1. Study Site/Design

This was a case‐control study conducted from March to July, 2023 at the Tamale Teaching Hospital (TTH) in the Northern part of Ghana. Tamale Teaching Hospital is a tertiary‐level referral facility located in Tamale, the capital of Northern Region. The facility has an inpatient capacity of 484 beds and serves the five Northern Regions. The population of Tamale is about 374,766, most of them are farmers, and is located at a longitude of 0.8235° W and a latitude of 9.3930° N. The digital address of the hospital is NT‐0101‐5777 [15].

2.2. Study Population

This study was performed on a total of 90 participants (60 SCA patients, and 30 apparently healthy controls) from northern Ghana, aged between 2 and 38 years. The controls were people without SCD (HbAA), of similar ethic group as the cases and reside in the same geographical area. Participants were diagnosed by hemoglobin electrophoresis. Participants with comorbidities including hypertension, diabetes mellitus, human immunodeficiency virus, hepatitis, and others were excluded from this study. Women who are pregnant or lactating and those who received transfusion in the past 3 months as well as those who refused to consent were all excluded from the study.

2.3. Sample Size Determination

Using Kelsey's formula: $N_{\mathit{cases}-\mathit{Kelsey}}=\left[\frac{r+1}{r}\right]\frac{P\left(1-P\right){\left(Z_{\frac{\alpha }{2}}+Z_{\beta }\right)}^2}{{\left(\mathrm{p}1-\mathrm{p}2\right)}^2}$, and $\mathrm{P}=\left[\frac{p1+\left(rXp2\right)}{r+1}\right]$

$N_{\mathit{cases}-\mathit{Kelsey}}$ represents sample size for cases (SCA group).

r represents ratio of cases to control in this study is 2:1.

$Z_{\frac{\alpha }{2}}$ is the critical value of the normal dispersion at α/2 (at 95% confidence level, α is 0.05 with critical value of 1.96).

$Z_{\beta }$ is the critical value of the normal distribution at β (using a power of 80%, β is 0.2 with critical value of 0.84).

p1 is the proportion of HFE H63D allele in SCA cases,13.8% [16].

p2 is the proportion of HFE H63D mutant allele in the control group, 4.4% [16]

p1 − p2 represents the difference in proportions that is clinically important.

The calculated minimum number of SCA cases was 18 with corresponding of 9.

To increase the statistical power, this study recruited 90 participants (60 SCA cases and 30 controls).

2.4. Ethical Consideration

The study received approval from the Institutional Review Board (IRB) of the University for Development Studies and Tamale Teaching Hospital, Ghana (UDS/RB/006/23). The purpose and the processes of the study were fully explained to the participants for their full approval and informed consent obtained. Participants ≥ 18 years provided written informed consent and those below 18 years were obtained from guardians/parents. The benefit of the study was also made known to the participants as well as any possible risk that may be involved. Participants were made to understand that they reserve the right to leave the study anytime they wanted.

2.5. Collection of Data

Demographic and clinical characteristics such as age, sex, number of blood transfusions received, number of vaso‐occlusive crisis per year, number of hospitalizations per year due to relapse or crisis that require medical attention, use of hydroxyurea (HU) and iron chelation therapy were obtained from the clinical records of recruited participants. Participants were also examined by a clinician at the day of recruitment for evidence of acute chest syndrome, osteomyelitis, renal failure, heart failure, avascular necrosis of the femoral head, anemia, gallstone and jaundice.

Categorization of blood cell transfusion was done as follows: multiple red cell transfusion (regular) when the participant received ≥ 3 units per year, rare transfusion when< 3 unit of blood were received per year and nil transfusion when no transfusion was received per year [17].

Severity scores were calculated using a modified method based on the above clinical data collected as proposed earlier by Hedo et al. [18]. The total score was classified as mild SCA (Score < 3), moderate SCA (Score > 3 and ≤ 7) and severe SCA (Score > 7) [19].

2.5.1. Sample Collection and Processing

About 5mls of venous blood samples was phlebotomized from each patient: 3 mL into ethylenediamintetraacetic acid (EDTA) and the remaining into a gel tube. The EDTA sample was used for the estimation of complete blood count using a five‐part hematology autoanalyzer (URIT‐5250, China), sickling and hemoglobin electrophoresis tests. The remaining EDTA whole blood was used for genomic extraction using the spin‐column protocol for DNA (Qiagen Kit, Germany), and segments of DNA encompassing H63D rs1799945 were sequenced using the Agena MassARRAY method (Agena Bioscience, USA). The gel tube clotted sample was centrifuged and the resulting serum stored at −70°C for ferritin estimation using the sandwich enzyme‐linked immunosorbent assay (ELISA) at University for Development Studies Laboratory.

2.6. DNA Extraction

In accordance with the manufacturer's instructions, genomic DNA was extracted from participants' whole blood using QIAGEN kits (QIAamp DNA Mini kit; QIAGEN, Germany) at the Kintampo Health Research Center. 200 µL of blood sample and 20 µL of protease K were mixed together in a 1.5 mL microcentrifuge tube. After adding 200 µL of AL buffer and vortexing for 15 s, the mixture was incubated at 56°C for 10 min. A quick centrifugation at 8000 rpm was used to remove the drips from the inside of the lid. 200 µL of ethanol was added after the material had been properly mixed for 15 s, followed by a quick centrifugation. 500 µL of AW 1 buffer was added to the mixture, centrifuged for 1 min at 8000 rpm, and the residue was disposed of after the mixture was placed in a QIAamp Mini spin column. The residue was removed by centrifuging 500 µL of AW2 buffer for 3 min at 14,000 rpm. 200 µL of AE buffer was added following dry centrifugation, and the mixture was incubated for 1 min at room temperature before being centrifuged for 1 min at 8000 rpm. Using a NanoDrop spectrophotometer, the amount of DNA (µg/µL) (OD 260 × 50 ng/µL) obtained from the isolation was assessed. Until they were analyzed, the DNA isolates were kept at −70°C [20].

2.7. Genotyping of HFE H63D rs1799945

Real‐time polymerase chain reaction was used for genotyping, with the Agena MassARRAY technology (Agena Bioscience, USA). Before single‐base extension employing mass‐modified dideoxy nucleotide terminators of an oligonucleotide primer (Table 1), which annealed immediately upstream of the polymorphic site of interest, the SNP genotyping technique used a locus‐specific PCR reaction. The SNP allele was identified by the unique mass of the extended primer using MALDI‐TOF mass spectrometry, as explained in the technical handbook [21].

Table 1.

H63D rs1799945 primers for the study.

HFE H63D rs1799945
rs1799945_W1_F	ACGTTGGATGGTTTGAAGCTTTGGGCTACG
rs1799945_W1_R	ACGTTGGATGTGGAAACCCATGGAGTTCG
rs1799945_W1_E	TGTTCGTGTTCTATGAT

2.8. Statistical Analysis

Statistical Package for the Social Sciences (SPSS) software, version 26.0 (Armonk, NY, USA) was used for the statistical analysis. Shapiro‐Wilk and one‐sample Kolmogorov‐Smirnov tests were used to test for the distribution of the continuous data. Categorical variables were presented as frequencies. RBC, HB, HCT, MCV and MCH were presented as mean ± standard deviation, whereas the remaining non‐normally distributed variables were presented as median and interquartile ranges (IQR). Student T‐test and Mann‐Whitney U‐Test were used to compare data with normal and non‐normal distributions, respectively. Pearson's Chi‐square was used to compare categorical data whereas Spearman rank tests was used to test for relationship between VOC incidence with levels of Ferritin, Hemoglobin, platelet and white blood cell count among the SCA patients. Statistical significance was set at p < 0.05.

3. Results

3.1. Demographic Characteristics of Study Participants

Of the 90 participants recruited into the study, 60 (66.7%) were sickle cell anemia subjects and 30 (33.3%) were apparently healthy individuals. Forty‐one 41 (45.6%) were males and 49 (54.4%) were females. Their ages ranged between 2 and 38 years with a median age of 16 years. Majority (52/57.8%) of the participants were within 13–24 years and the minority (6/6.7%) being 24 years and above (Table 2).

Table 2.

Demographics of the study participants.

Variables	Total (N = 90)	Participants		p value
		SCA cases N = (60/66.7%)	Controls (HbAA) N = (30/33.3%)
Age (Years)	16.0 (2.0–38.0)	15 (2.0–38.0)	18 (6.0–28.0)	0.220
Age category
2–12	32 (35.5)	24 (26.7)	8 (8.9)
13–24	52 (57.8)	31 (34.4)	21 (23.3)
> 24	6 (6.7)	5 (5.6)	1 (1.1)
Sex				0.295
Males	41 (45.6)	25 (61.0)	16 (39.0)
Females	49 (54.4)	35 (71.4)	14 (28.6)

3.2. Clinical Characteristics of the Study Participants

Of the 90 participants recruited into the study, 42 (70%) of cases had visited the hospital between 1 and 3 times per year, 38 (63.3%) had experienced vaso‐occlusive crises between 1 and 3 times per year and 25 (41.7%) had received one or two blood transfusions per annum. In terms of severity score, 34 (56.7%) of the subjects were mild, 22 (36.7%) were moderate and 4 (6.6%) were severe. None of the participants had previously undergone iron testing (Table 3).

Table 3.

Clinical characteristics of the study participants.

Variables	Category	Frequency (%)
Frequency of hospital visits per year	None	8 (13.3)
	1–3	42 (70)
	> 3	10 (16.7)
Number of blood transfusions per year	0	17 (28.3)
	1–2	25 (41.7)
	≥ 3	18 (30.0)
Vaso‐occlusive crises per year	None	6 (10)
	1–3	38 (63.3)
	> 3	16 (26.7)
Severity score category	Mild	34 (56.7)
	Moderate	22 (36.7)
	Severe	4 (6.6)

3.3. Distribution of HFE H63D (rs1799945) Gene Polymorphism

Table 4 shows the distribution of HFE H63D (rs1799945) gene polymorphism in the 90 participants. Only the CC genotype was identified among the cases (66.7%) and controls (33.7%) (Table 4).

Table 4.

Distribution of H63D (rs1799945) gene polymorphism in study participants.

Participants	No. of allele studied	Genotype frequency (%) of H63D gene
		Wild type allele (CC)	Mutant allele (GG)	Heterozygous allele (CG)
Control (HbAA)	30	33.3	0	0
Cases (HbSS)	60	66.7	0	0
Total	90	100.0	0	0

3.4. Serum Ferritin Levels of Study Participants Stratified by SCA Cases and Controls

The median serum ferritin level was significantly higher in SCA cases than in the controls (without SCA) [250.9 (201.4 – 307.5) ng/mL vs. 194.6 (154.7 – 224.0) ng/mL, p < 0.001] (Figure 1).

Figure 1.

Serum ferritin levels of the study participants stratified by the sickle cell anemia cases and controls.

3.5. Hematological Parameters of the Study Participants Stratified by Cases and Controls

Participants with SCA had significantly lower RBC (p < 0.001), Hb (p < 0.001) and HCT (p < 0.001) but higher MCV (p = 0.001), RDW‐CV (p < 0.001), TWBC (p < 0.001), absolute neutrophils (p < 0.001), absolute lymphocyte (p < 0.001), absolute monocytes (p < 0.001), absolute eosinophil (p = 0.039), absolute basophil (p < 0.001), platelet (p < 0.001) than the control group. MCH was higher in controls than the cases (p = 0.042). However, MCHC did not differ between SCA participants and the control group (Table 5).

Table 5.

Blood cell indices of study participants stratified by cases and controls.

Blood cell indices	Participants		p value
	SCA patients N = (60)	Controls N = (30)
RBC × 103/µL	3.0 ± 0.9	4.6 ± 0.6	< 0.001
Hb (g/dL)	8.4 ± 1.8	12.9 ± 1.3	< 0.001
HCT%	25.6 ± 5.4	39.9 ± 4.5	< 0.001
MCV (fL)	89.4 ± 13.4	80.3 ± 6.1	< 0.001
MCH (pg)	27.0 ± 2.9	28.3 ± 2.7	0.042
MCHC (g/dL)	32.2 (30.9–33.7)	32.7 (30.8–34.7)	0.152
RDW‐CV%	17.6 (15.4–21.3)	8.3 (7.8–8.7)	< 0.001
TWBC × 103/µL	10.0 (8.1–12.3)	5.2 (4.3–5.9)	< 0.001
Neut# × 103/µL	4.1 (2.9–6.5)	1.9 (1.5–2.3)	< 0.001
Lymph# × 103/µL	3.6 (2.3–5.0)	2.1 (1.5–3.0)	< 0.001
Mon# × 103/µL	0.8 (0.5–1.1)	0.3 (0.3–0.4)	< 0.001
Eos# × 103/µL	0.2 (0.1–0.4)	0.11 (0.06–0.19)	0.039
Baso# × 103/µL	0.06 (0.03–0.10)	0.006 (0.004–0.01)	< 0.001
PLT × 103/µL	344.0 (210.0–432.0)	241.0 (180.5–276.5)	< 0.001

3.6. Clinico‐Hematological Parameters of SCA Participants Stratified by Hydroxyurea Usage

Hemoglobin (p = 0.001) was significantly higher in participants on hydroxyurea than those without the drug. On the other hand, participants who had not initiated treatment with hydroxyurea had higher levels of ferritin (p < 0.001), TWBC: (p = 0.027), CRP (p < 0.001))] and Platelet: (p < 0.001) than participants on hydroxyurea therapy. Frequencies of VOC per year (p < 0.001), blood transfusion per year (p < 0.001) and hospitalization per year (p < 0.001) were significantly reduced in participants on hydroxyurea therapy compared to cases without therapy (Table 6).

Table 6.

Clinico‐hematological parameters of SCA participants stratified by Hydroxyurea Usage.

Clinico‐hematological parameters	Hydroxyurea Usage		p value
	Yes N = (26)	No N = (19)
Hb (g/dL)	9.2 ± 1.5	7.5 ± 1.7	< 0.001
TWBC × 103/uL	9.1 (7.6–10.9)	11.7 (8.9–13.0)	0.027
PLT × 103/uL	232.5 (184.8–346.0)	432.0 (357.0–526.8)	< 0.001
Ferritin (ng/mL)	194.6 (154.7–224.0)	250.9 (201.4–320)	< 0.001
CRP (µg/L)	345.0 (244.9–456.0)	543.0 (452.7–672.0)	< 0.001
Frequency of VOC per year	2.0 (1.0–2.0)	4.0 (3.0–5.0)	< 0.001
Frequency of hospitalization	1.0 (1.0–2.0)	3.0 (3.0–4.0)	< 0.001

3.7. Relationship of VOC Incidence With Levels of Ferritin, Hemoglobin, Platelet, and White Blood Cell Count Among the SCA Patients

Figure 2 illustrates the relationship of VOC incidence with levels of Ferritin, Hemoglobin, platelet and white blood cell count among the SCA patients. Incidence of VOC correlated with increased levels of ferritin (r = 0.458, p < 0.001) platelet (r = 0.537, p < 0.001) and WBC (r = 0.302, p = 0.019) counts but inversely correlated with hemoglobin levels (r = −517, p < 0.001) of SCA patients.

Figure 2.

Relationship of VOC Incidence with levels of Ferritin, Hemoglobin, Platelet and White blood cell count.

4. Discussion

Chronically transfused SCA participants are generally characterized by higher risk of developing iron overload, and the condition is exacerbated with coinheritance of H63D polymorphism [22]. In this study, we determined the polymorphic distribution of H63D rs1799945 of HFE gene and hematological indices in SCA participants.

According to this study, the participants were aged between 2 and 38 years with majority being females. Vaso‐occlusion crisisis a complex process characterized by hypoxia, ischemia, tissue damage and inflammation [23]. It can lead to discomfort, organ damage, acute chest syndrome, stroke, and ultimately death [24]. Vaso‐occlussive crisis is responsible for approximately 95% of hospitalizations and most of these hospitalizations end up with the patients receiving blood transfusions [25]. In this study, majority (90%) of the patients experienced a number of VOC out of which 86.7% had frequent visits to the hospital. These findings are in consonance with earlier studies [23, 26].

The study recorded only the presence of the homozygous wild type allele (CC) of the H63D rs1799945 gene in the study population. Both homozygous mutant allele (GG) and heterozygous (CG) carriers for H63D rs1799945 mutation were not found among the study population. This finding is in variance with a previous study conducted in American population where 20.3% of their study population (students) were carriers of the mutant allele (CG) and 2.9% were homozygous for the allele (GG) [4]. Another study conducted among healthy adult Greek population (Caucasians) for H63D rs1799945 gene also reported up to 25% carriers of the mutant allele (CG) with 2.2% having the homozygous form of the mutant gene for rs1799945 mutation [12]. Parallel to earlier literature, Abdel Rahman et al. (2014) assessed the frequency of the H63D (rs1799945) mutation and reported higher frequencies of 13.8% and 4.4% among SCA cases and healthy controls respectively. The finding of this study further highlighted that the distribution of the H63D polymorphism varies significantly among different ethnic and geographic groups. The absence of the rs1799945 mutant (G) gene found in the current study aligns with the findings from the Ferqueron et al. study [4] which reported a significant relationship of the mutant (G) gene rs1799945 with individuals of Northern European ancestry. No individuals of non‐Northern European descent were found to possess the mutant (G) gene [4]. The origin of the mutation, differences in study population and its infrequency among non‐Caucasians/black population as stated in literature might be some of the reasons for the absence of the G allele in this current study population [4].

The present study found significantly higher ferritin concentration in SCA patients than the apparently healthy controls. This finding was further highlighted by a strong positive relationship between ferritin and VOC incident. Similar results have been reported by previous studies [27, 28, 29]. Serum ferritin reflects the iron stores in the body which could be attributed to persistent hemolysis and transfusion burden triggered by VOCs [30]. Even though, ferritin levels may be influenced by inflammation, SCA patients who were in steady state over the last 2 months were recruited for this study. This result contradicts the conventional expectation that individuals with SCA are more prone to iron deficiency due to chronic hemolysis and increased iron excretion in the urine. It could also be linked to chronic inflammation experienced by SCA patients which affects iron metabolism as seen in anemia of chronic disease [28].

Previous studies have suggested that, changes in hematological indices may be implicated in the disease process and the severity of SCD [31, 32, 33]. This study observed a significant reduction in RBC, hemoglobin, and hematocrit, with concomitant elevated mean cell volume and RDW‐CV in SCA participants as compared to the control group. This hematological derangement may be useful and assist clinicians in the management of SCA patients. This finding is in consonance with earlier studies [14, 31]. Again, reduced hemoglobin levels observed in SCA patients were further highlighted by a strong negative correlation with frequency of VOC which is in consonance with study conducted in Ghana by Antwi Boasiako et al. and Saudi Arabia by Zakari and co. The decreased red cell parameters observed in SCA participants in this study could be attributed to the associated chronic hemolysis, shortened red cell survival, inflammation and a diminished erythropoietin response related to SCA [31, 34]. The elevated MCV and RDW‐CV is consistent with poikilocytosis, macrocytosis and reticulocytosis in SCA as a consequence of bone marrow compensatory mechanism in response to the stress anemia [35, 36].

Leukocytes and thrombocytes have both been reported to increase during chronic inflammatory conditions contributing to the pathophysiology of the SCA severity and morbidity [37, 38]. The significant leukocytosis observed in this study could be linked to the body's constant battle against infections and inflammation associated with sickle cell disease complications [39]. Leukocytosis in the absence of infection may be explained by the persistent, subclinical inflammation that results in cytokine release and boosts bone marrow leukocyte production or the functional hyposplenia [38]. It has been found that leukocytosis is associated with a poor prognosis while reducing leukocytes is associated with a good prognosis [37].

The high platelet counts seen among participants with SCA could be a reactive immune response to the inflammation associated with endothelial damage and activation. A prothrombotic state is also induced by SCD [40]. Platelet activation is a significant outcome of hemolysis because of the decrease in vascular nitric oxide, which inhibits platelet aggregation, erythrocyte‐derived adenosine diphosphate and heme release, and dense sickled RBC phosphatidylserine exposure, which increases the production of thrombin [41, 42]. Activated platelets attach themselves to the arterial wall with ease, take part in the creation of heterocellular aggregates, and help release the pro‐inflammatory milieu that initiates the vaso‐occlusive process [40]. Another factor contributing to thrombocytosis may be linked to the negative feedback effect of anemia on erythropoietin production. Because erythropoietin and thrombopoietin share structural similarities, thrombocytosis can accompany anemia of chronic diseases as well as other kinds of anemia [43].

The positive relationship of VOC incident with increased levels of platelet and white blood cell counts further buttress the role of these two parameters play in the pathophysiology of sickle cell anemia crisis [37, 38]. This study also highlighted the relationship between hydroxyurea therapy and disease outcomes. Sickle cell anemia participants who were on HU had higher hemoglobin concentration, reduced inflammatory markers (CRP, leukocytes and platelets), decreased frequencies of vaso‐occlusive crisis, and number of hospitalizations per year. These findings from the present study are similar to previous findings reported elsewhere [44, 45, 46, 47]. Hydroxyurea works by reversibly inhibiting ribonucleotide reductase (RR), an essential enzyme that changes ribonucleosides into deoxyribonucleosides, which are needed for DNA synthesis and repair. Strong RR inhibition reduces intracellular deoxyribonucleotide triphosphate pools and prevents cell division from progressing through S phase, thus giving a selective advantage to the expansion of the fetal hemoglobin. Again, the cytotoxic effects of HU in the bone marrow lowers the amounts of platelets, reticulocytes and neutrophils [48]. Lowering platelet counts decreases inflammation as evident by the observed CRP levels, while lowering neutrophil and reticulocyte counts decreases adhesion receptor surface expression and modifies red blood cell adherence to the endothelium which decreases rate of hemolysis and improves hemoglobin levels, limit dependence on blood transfusions, reduces frequencies of VOC and hospitalization due to relapse or crisis [49, 50, 51]. The study is limited by the inability to detect the mutant variants of H63D rs1799945 gene in either the SCA group or the control group and therefore, association studies with clinical parameters could not be performed.

Large multicentre study is recommended to assess other polymorphisms associated with HFE gene and the impact on the severity of sickle cell disease.

5. Conclusion

Th mutant G allele of the H63D rs1799945 gene is very rare in the study population of Ghana. Sickle cell anemia patients have very severe hematological alterations in relation to control group. Serum ferritin and CRP levels were significantly higher in SCA patients than the controls group. The incident of VOC was found to correlate with increased levels of ferritin, CRP, platelet and WBC counts but inversely correlated with hemoglobin levels highlighting the role of these parameters in the pathophysiology SCA crisis.

Author Contributions

Samuel Kwasi Appiah: conceptualization, investigation, methodology, validation, writing – review and editing, project administration, data curation, supervision, resources. Charles Nkansah: writing – review and editing, formal analysis, software. Gabriel Abbam: investigation, formal analysis, writing – review and editing. Samira Daud: methodology, validation, resources. Felix Osei‐Boakye: formal analysis, software, writing – review and editing, validation. Charles A. Derigubah: visualization, Validation, writing – review and editing. Larry Adom: data curation, resources, writing – original draft, investigation. Rekhiatu Oboirien Abdul Rauf: data curation, resources, investigation and writing – original draft. Godfred Takyi Addae: investigation and data curation. Lydia Sarpong: methodology and writing – review and editing. Godfred Amoah Appiah: Investigation and writing – review and editing. Jennifer Obeng Mensah: data curation and investigation. Onwuka Chima Kalu: writing – original draft and validation. Victor U. Usanga: supervision, writing – review andediting. Boniface N. Ukwah: supervision, writing – review and editing. Ejike Felix Chukwurah: supervision, writing – review and editing.

Conflicts of Interest

The authors declare no conflicts of interest.

Transparency Statement

The lead author Samuel Kwasi Appiah affirms that this manuscript is an honest, accurate, and transparent account of the study being reported; that no important aspects of the study have been omitted; and that any discrepancies from the study as planned (and, if relevant, registered) have been explained.

Data Availability Statement

All relevant data are within the article. The original data used to support the findings of the study are available from the corresponding author upon reasonable request.