The type-III effectors-based multiplex PCR for detection of Xanthomonas campestris pv. campestris causing black rot disease in crucifer crops

Abstract

The black rot disease in crucifer crops is caused by Xanthomonas campestris pv. campestris (Xcc) which drastically reduces the productivity of crops. Three Xcc races, such as races 1, 4, and 6, have been identified from India that possess nine avr genes, or type-III effectors (T3Es). Here, we used three T3Es—avrXccC, avrBs1, and avrGf1 to identify Xcc from bacterial DNA, bacterial suspensions, Xcc-infected seeds, and the sap of the infected leaves using multiplex PCR. The T3Es were amplified using gene-specific primers with gDNA of Xcc. Then, the multiplex PCR was optimized and amplified T3Es using the sap of black rot-infected cauliflower leaves. Further, this method amplified T3Es from artificially infected seeds (1–100%) of cauliflower and from Xcc colonies (0.1–100%) grown on nutrient agar medium. The primer specificity of T3E genes elucidates that these are specifically detected in all Indian Xcc strains and races, while no bands were observed with other unrelated bacteria, such as X. euvesicatoria, X. oryzae pv. oryzae, Pseudomonas fluorescens, Ralstonia solanacearum, Bacillus subtilis, and B. amyloliquefaciens. Further, this PCR possesses high sensitivity and amplifies T3E genes using up to 0.01 ng Xcc DNA. The high specificity and sensitivity of T3Es-based multiplex PCR make it a potential method and can be used to amplify Xcc from various templates, such as purified DNA, Xcc-infected seeds and leaves, crude extracts, etc., without the need to extract plant or bacterial DNA.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13205-023-03691-z.

Introduction

Cruciferous crops are vital in agriculture due to their beneficial use in food and oil-seed production. These plants are vulnerable to many plant-pathogenic microorganisms, including fungi, bacteria, viruses, and nematodes. The hemibiotrophic plant pathogenic bacteria, Xanthomonas campestris pv. campestris (Xcc), causes black rot disease in cruciferous crops worldwide (Vicente et al. 2001; Singh et al. 2016). It is a Gram-negative proteobacterium that infects the economically most important Brassica family crops, i.e., the Brassica oleracea group (Singh et al. 2016).

In India, Xcc infects various B. oleracea crops, including cauliflower (Brassica oleracea var. botrytis), cabbage (B. oleracea var. capitata), kohlrabi (B. oleracea var. gongylodes), broccoli (B. oleracea var. italica), Brussels sprouts (B. oleracea var. gemmifera), and kale (B. oleracea var. acephala). Furthermore, radish (Raphanus sativus), turnip (B. rapa var. rapa), Indian mustard (B. juncea), and black mustard (B. nigra). However, weeds and ornamentals can also be infected by Xcc (Janse 2006; Rathaur et al. 2015; Singh et al. 2016). Xcc generally invades and replicates vascular tissues in the crucifer host plants, producing typical black rot symptoms (Vicente et al. 2001). The entry of Xcc into the plant is accomplished via infected seeds, wounds, stomata, roots, and hydathodes. Initially, the symptoms of the black rot disease in crucifer crops are characterized by the development of ‘V’-shaped yellow lesions accompanied by blackened veins at the foliar margins of the leaf. Gradually, these lesions become enlarged, turn brown, and produce a necrotic and papery appearance covering the whole leaf (Cerutti et al. 2017; Vicente et al. 2001).

Pathovars of X. campestris were initially divided into five different races based on the gene-for-gene hypothesis, in which the inheritance of both resistances in the host and the pathogen’s ability to cause disease is controlled by pairs of matching genes (Kamoun et al. 1992; Vicente and Holub 2013). However, these races were revised and divided into three groups, i.e., races 1, 2, and 4, based on their host specificity and pathogenicity characteristics. Earlier, Vicente et al. (2001) postulated a gene-for-gene model to explain the relationship between crucifer cultivars and races of X. campestris. This model also provided a hypothesis based on observation during host–pathogen interactions (Vicente et al. 2006); later, 11 races of Xcc were characterized based on the interaction between host R genes and avirulence genes of the pathogen from different parts of the world (Fargier and Manceau 2007; Maiti et al. 2014; Singh et al. 2016; Cruz et al. 2017). In India, three races, i.e., 1, 4, and 6, were identified based on host specificity and pathogenicity characteristics in different crucifer crops. Race 1 is the most prominent as compared to races 4 and 6 (Rathaur et al. 2015; Singh et al. 2016, 2022; Kesharwani et al. 2022a, b).

The comparative genome analysis of Xanthomonas spp. recognized six types of secretion systems (SS), such as I, II, III, IV, V, and VI. These SS are imperative for the transportation of proteins or effectors into the host cell from bacteria (Buttner and Bonas 2010; Alvarez-Martinez et al. 2021; Kesharwani et al. 2022b; Singh et al. 2022). The Xcc possesses three types II, III, and IV that play an essential role in the development of disease symptoms in host plants (Vicente and Holub 2013). In Xcc, their virulence chiefly depends on the type-III secretion system (T3SS) that causes pathogenicity and disease in susceptible host plants, e.g., cauliflower and cabbage (Sun et al. 2011; Singh et al. 2022; Kesharwani et al. 2022a, b). During pathogenesis, the host defense mechanism recognizes microbe-associated molecular patterns (MAMPs) and/or effectors secreted by plasma membrane-bound receptors or intracellular receptors to protect itself. Thus, the pathogen secretes the type-III effector (T3E) proteins into the host cell, suppressing the plant immunity via intrusion of gene expression and RNA metabolism processes (Liu et al. 2017).

Advanced molecular techniques like PCR are sensitive and reliable for detecting and identifying microbes. Specific PCR primers have been employed to confirm the presence or absence of target microorganisms or specific features associated with them, such as antibiotic resistance and virulence factors. Many researchers have used the PCR technique to detect plant-pathogenic bacteria, fungi, and viruses (Alvarez 2004; Ward et al. 2004; Singh and dhar 2011; Singh et al. 2014, 2016; Kulshreshtha et al. 2020). Previously, the hrpF gene-specific primer-based detection of Xcc in seed and crucifers’ plants was established (Park et al. 2004; Singh et al. 2014). Leu et al. (2010) have standardized a multiplex PCR to simultaneously detect black rot and black spot pathogen-infected seeds or seedlings of crucifer crops, i.e., Xcc and X. c. pv. raphanin, respectively. Peer (2019) also developed a multiplex-PCR method for detecting Xanthomonas pathotypes in diseased citrus plants.

The present study was conducted to develop T3E gene-based multiplex PCR to detect Xanthomonas campestris pv. campestris in crucifer crops.

Materials and methods

Plant material, bacterial strain, and media

The infected leaf samples of cauliflower, cabbage, broccoli, radish, and vegetable mustard showing ‘V’-shaped lesions were collected from different regions of India. The Xcc race 1, 4, and 6 isolates were isolated on nutrient agar medium, pH 6.8 ± 0.2, and sub-cultured on YGCA medium, pH 6.8 ± 0.2 and incubated at 28 ± 1 °C in a BOD incubator for 72 h (Schaad et al. 2001). Although, the Xcc-infected plant tissues were collected from agricultural land contaminated with other microorganisms like saprophytic fungi and bacteria. Therefore, the NA medium was amended with 100 µg/ml of cycloheximide (inhibit fungal growth) and 10 µg/ml of cephalexin (effective in suppressing most Gram-positive bacteria) antibiotics to prevent the overgrowth of other phytopathogenic microorganisms (Mwangi et al. 2007; Tripathi et al. 2007). The bacterial cultures (X. euvesicatoria, X. oryzae pv. oryzae, X. citri pv. citri, Erwinia carotovora subsp. carotovora, Ralstonia solanacearum, Pseudomonas fluorescens DTPF-3, Bacillus subtilis DTBS-5, and B. amyloliquefaciens DSBA-11) were obtained from the Plant Bacteriology Laboratory, Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (ICAR-IARI), New Delhi, and grown on nutrient agar medium for 24–48 h at 28 ± 1 °C.

DNA extraction and molecular characterization of type-III effectors

The Indian Xcc races 1, 4, and 6 were grown in nutrient broth (SRL, India) medium supplemented with cycloheximide (100 µg/ml) and cephalexin (10 µg/ml) (Das et al. 2009) for 48 h at 28 °C on a rotatory shaker (MRC, UK). The genomic DNA (gDNA) from isolates of Xcc races was extracted using the CTAB method (Murray and Thompson 1980). The full-length gene-specific primers of T3E genes, such as avrXccC, avrBs1, and avrGf1 located at different regions, i.e., 2492436–2493431, 2481228–2482565, and 4294677–4296251 of Xcc ATCC33913 (AE008922) genome, with a product size of 996 bp, 1338 bp, and 1575 bp were designed by NCBI blast and oligocalc and amplified by conventional PCR, respectively (Kibbe 2007) (Table 2). The PCR reaction mixture contained 5.0 µl of 5 × Go-Taq buffer, 0.75 µl of 10 mM dNTPs, 0.50 µl each of 10 µm forward and reverse primers of T3E genes (avrXccC, avrBs1, avrGf1), 1 µl of 100 ng of Xcc DNA, 17.05 µl of nuclease-free water, and 0.2 µl (5 U/µl) of Go-Taq polymerase (Promega, USA) to detect avr genes. No template control was run with this PCR. The PCR (Gradient Thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: initial denaturation at 94 °C for 2 min followed by 35 cycles of 94 °C for 1 min, 53 °C for 30 s, and 72 °C for 1.5 min. and the reaction was terminated by final elongation at 72 °C for 5 min. The PCR products were visualized on a 1% agarose gel prepared in 1 × Tris–acetate–EDTA (TAE) buffer (pre-stained by ethidium bromide (0.5 µg/ml) through gel electrophoresis. The electrophoresis unit was run at 75 V for 2.5 h. Agarose gel was visualized on the gel documentation system (Gel Doc TMXR+, BIORAD). DNA sequencing of amplified type-III effector genes was carried out by outsourcing (Agrigenome, India).

Table 2.

Sequence of Xanthomonas campestris pv. campestris T3Es gene-specific primers

S. no.	Primers (5′- to -3′)		Name of gene	Gene locus	Product size (bp)	References
1.	DXccCF	ATGTGGTCTCAGCCCGTATG	avrXccC	2492436–2493431	1575	JX453111
2.	DXccCR	TTAAATTGGGGGGCGCTCAAAA
3.	DXBs1F	ATGTCCGACATGAAAGTTAATTTCTC	avrBs1	2481228–2482565	1338	AE008922
4.	DXBs1R	TTACGCTTCTCCTGCATTTGTAAC
5.	DXGf1F	ATGATTTCCGTCCTGCACTCTA	avrGf1	4294677–4296251	996	NC003902
6.	DXGf1R	CTAGGCGTTTCTGGTCATGG

F forward primer, R reverse primer, bp base pairs

Optimization of protocol for simultaneous detection of type-III effectors by multiplex PCR

The full-length gene-specific primers of the T3E genes of Xcc (Table 2) were used to standardize multiplex PCR assay protocol. The changes in different parameters were used for the simultaneous detection of type-III effectors (T3Es) by multiplex PCR, such as gradient temperature (50–60 °C), conc. of dNTPs (400–800 µM), primers (0.2–0.4 µM), and PCR conditions (data not shown). The PCR reaction mixture contained 5.0 µl of 5 × Taq buffer, 2.0 µl of 10 mM dNTPs, 0.50 µl each of 10 µm stock of forward and reverse primers of avrXccC, avrBs1, and avrGf1, 1.0 µl of—100 ng Xcc gDNA, 13.80 µl of nuclease-free water, and 0.2 µl (5 U/µl) of Taq polymerase (Promega, USA) for simultaneously detection of T3E. The PCR (Gradient Thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: 94 °C for 2 min. followed by 35 cycles of 94 °C for 1 min, 53 °C for 30 s, and 72 °C for 1.5 min, and the reaction was terminated by final elongation at 72 °C for 5 min. The PCR products were visualized on 1% agarose gel prepared in 1 × Tris–acetate–EDTA (TAE) buffer (pre-stained by ethidium bromide (0.5 µg ml⁻¹) through gel electrophoresis. The electrophoresis unit was run at 75 V for 2.5 h. Agarose gel was visualized on the gel documentation system (Gel Doc TMXR+, BIORAD).

Multiplex PCR for the detection of three type-III effectors

To improve the sensitivity of the primers, 100 mg naturally infected leaf of cauliflower showing ‘V’-shaped lesions were collected from the vegetable field of ICAR-IARI, New Delhi, and macerated by mortar and pestle in 1.0 ml of sterilized distilled water. The macerated leaf suspension was used for the simultaneous detection of three T3E genes, viz., avrXccC, avrBs1, and avrGf1 by multiplex PCR assay. The PCR reaction mixture contained 5.0 µl of 5 × Taq buffer, 2.0 µl of 10 mM dNTPs, 1.0 µl each of 10 µm forward and reverse primers of these T3E genes, 2.0 µl of leaf suspension, 9.80 µl of nuclease-free water, and 0.2 µl (5 U/µl) of Taq polymerase (Promega, USA). The PCR (Thermal Cycler, C1000TM, BIORAD) was carried out under the following conditions: 94 °C for 2 min. followed by 35 cycles of 94 °C for 1 min, 53 °C for 30 s, and 72 °C for 1.5 min, and the reaction was terminated by the final elongation at 72 °C for 5 min. The PCR products were visualized as described earlier on 1% agarose gel prepared in 1 × tris–acetate–EDTA (TAE) buffer (pre-stained by ethidium bromide (0.5 µg/ml) through gel electrophoresis. Further, the presence of Xcc in infected leaf samples of cauliflower was confirmed by the isolation of Xcc on NA medium plates incubated at 28 °C as described by Singh et al. (2016).

Specificity and sensitivity of type-III effector (T3E) genes primers in multiplex PCR

The specificity and sensitivity analysis were carried out using 7 isolates of three Indian races 1, 4, and 6 of Xcc causing black rot disease on crucifer crops and 8 strains of different bacterial species comprising 2 species of the Xanthomonas genus (Table 1). For specificity, three T3E gene-specific primers were tested in the same species and with strains belonging to different plant-pathogenic and non-pathogenic bacteria. The sensitivity of detection of the three T3E genes was analyzed by multiplex PCR with different concentrations of gDNA, i.e., 10² ng to 10^–4 ng. The PCR reaction and conditions were followed as described in the standardization of multiplex PCR. In this analysis, T3E gene-specific primers were simultaneously used for the specificity analysis of multiplex detection assay with other phytopathogenic microorganisms belonging to different genera and species. The multiplex PCR was repeated thrice to confirm the specificity (data not shown).

Table 1.

List of Xanthomonas campestris pv. campestris isolates and other plant bacterial species isolated from different hosts

S. no.	Species/isolate	Host/source	Race	Origin	Year of isolation	References
1.	Xcc-C1	Cauliflower	1	IARI, New Delhi	2006	Singh et al. (2014, 2016)
2.	Xcc-C4	Broccoli	1	IARI, New Delhi	2006	Singh et al. (2014, 2016)
3.	Xcc-C5	Cabbage	1	IARI, New Delhi	2006	Singh et al. (2014,2016)
4.	Xcc-C7	Cabbage	4	Bangalore, Karnataka	2006	Singh et al. (2014,2016)
5.	Xcc-C10	Radish	4	Ranchi, Jharkhand	2007	Singh et al. (2014,2016)
6.	Xcc-C17	Mustard	4	Laxmi Nagar, Delhi	2007	Singh et al. (2014,2016)
7.	Xcc-C278	Cabbage	6	Laxmi Nagar, Delhi	2014	Singh et al. (2014,2016)
8.	X. euvesicatoria	Tomato	–	Himachal Pradesh	2014	Bacteriology Laboratory, Division of Plant Pathology, ICAR-IARI, New Delhi
9.	X. oryzae pv. oryzae	Rice	–	Cuttack, Odisha	2008
10.	X. citri pv. citri	Grey fruit	–	IARI, New Delhi	2010
11.	Erwinia carotovora subsp. carotovora	Potato	–	Uttarakhand	2015
12.	Pseudomonas fluorescens	Potato	–	IARI, New Delhi	2010
13.	Ralstonia solanacearum	Chilli	–	Uttarakhand	2015
14.	Bacillus subtillis DTBS-5	Soil	–	New Delhi	2009
15.	Bacillus amyloliquefaciens DSBS-11	Tomato	–	IARI, New Delhi	2013

Detection of Xcc from artificially contaminated seeds of cauliflower by multiplex PCR

Cauliflower cv. Pusa Sharad seeds were obtained from the Division of Seed Science, ICAR-IARI, New Delhi, thoroughly washed with 0.1% mercuric chloride (HgCl₂) and subsequently washed with 70% ethanol, followed by rinsing three-to-four times with sterile distilled water to remove chemical residue. The excess amount of water from the seeds was absorbed by sterile Whatman No.1 filter paper. The sterile seeds were soaked in a 48 h-old culture of Xcc-C1 (1.5 × 10⁸ cfu/ml) and incubated for 24 h at 28 ± 1 °C on 200 rpm. The OD_600nm of Xcc culture was obtained using a UV spectrophotometer (ThermoFisher, USA). The culture was removed by pipetting, and the seeds were allowed to dry overnight. The inoculated and uninoculated seeds of Pusa Sharad were mixed in different proportions to get 100, 75, 50, 25, 10, 1, 0.1, 0.5, and 0.01% infected seeds. The 100 seeds were taken from 1 to 100%, 1000 seeds from 0.1 and 0.5%, and 10,000 seeds from 0.01% contaminated seeds. Each seed sample was ground with a pestle and mortar in 5.0–10.0 ml autoclaved nutrient broth (pH-7.0). The seed extract suspension was incubated for 24 h at 28 ± 1 °C, 200 rpm in a rotatory shaker (MRC). Then, 1.0 μl of bacterial broth culture from each treatment of seed extract was used for the PCR analysis.

Sequence and phylogenetic analysis of type-III effector (T3E) genes’ homologs

The T3Es nucleotide sequences from diverse strains of Xanthomonas spp. were obtained from the NCBI database (Tables 5, 6, 7). All these sequences were aligned with the MUSCLE algorithm. The evolutionary history was inferred through the neighbor-joining method with 1000 bootstrap replicates in Mega 6 software (Tamura et al. 2013).

Table 5.

Sequence identity matrix of AvrXccC (XopAH) gene of Xcc along with sequences of other bacterial species from NCBI GenBank database

Seq->	aXcc	bXcc	cXcc	dXcc	eXcc	fXcc	gXcc	hXh	iPs	jPsp	kXcp	lPcc	mXhp
aXcc	ID	1	1	1	1	1	1	0.940	0.241	0.242	0.264	0.237	0.263
bXcc		ID	1	1	1	1	1	0.940	0.241	0.242	0.264	0.237	0.263
cXcc			ID	1	1	1	1	0.940	0.241	0.242	0.264	0.237	0.263
dXcc				ID	1	1	1	0.940	0.241	0.242	0.264	0.237	0.263
eXcc					ID	1	1	0.940	0.241	0.242	0.264	0.237	0.263
fXcc						ID	1	0.940	0.241	0.242	0.264	0.237	0.263
gXcc							ID	0.940	0.241	0.242	0.264	0.237	0.263
hXh								ID	0.242	0.243	0.257	0.230	0.273
iPs									ID	0.997	0.254	0.281	0.246
jPsp										ID	0.254	0.280	0.246
kXcp											ID	0.284	0.265
lPcc												ID	0.257
mXhp													ID

^aX. campestris pv. campestris strain C1(MT191355)

^bX. campestris pv. campestris strain ATCC33913(AE008922)

^cX. campestris pv. campestris strain 8004 (CP000050)

^dX. campestris pv. campestris strain B100 (AM920689)

^eX. campestris pv. campestris strain CN03 (CP017308)

^fX. campestris pv. campestris strain WHRI-420A (HQ169635)

^gX. campestris pv. campestris strain 3811 (CP025750)

^hX. hyacinthi strain CFBP1156 (CP043476)

ⁱP. syringae (M22219)

^jP. savastanoi pv. phaseolicola 1448A (CP000059)

^kX. citri pv. punicae strain LMG7504 (CP030167)

^lP. coronafaciens pv. coronafaciens strain B19001 (CP046441)

^mX. hortorum pv. pelargonii strain CFBP 2533 (LR828261)

Table 6.

Sequence identity matrix of AvrBs1 gene of Xcc along with sequences of other bacterial species from NCBI GenBank database

Seq->	aXcc	bXcc	cXcc	dXcc	eXcc	fXcc	gXcc	hXv	iXcv	jXf	kXhg	lXg	mPst
aXcc	ID	0.995	0.995	0.291	0.291	0.995	0.726	0.279	0.243	0.256	0.245	0.247	0.258
bXcc		ID	0.999	0.294	0.294	1	0.728	0.280	0.245	0.260	0.245	0.247	0.258
cXcc			ID	0.294	0.293	0.998	0.730	0.28	0.245	0.259	0.244	0.246	0.257
dXcc				ID	0.999	0.294	0.268	0.251	0.224	0.287	0.260	0.261	0.256
eXcc					ID	0.294	0.267	0.251	0.224	0.287	0.260	0.262	0.256
fXcc						ID	0.728	0.28	0.245	0.260	0.245	0.247	0.258
gXcc							ID	0.268	0.269	0.255	0.253	0.236	0.257
hXv								ID	0.263	0.241	0.261	0.247	0.255
iXcv									ID	0.268	0.249	0.251	0.249
jXf										ID	0.242	0.211	0.211
kXhg											ID	0.258	0.256
lXg												ID	0.844
mPst													ID

^aX. campestris pv. campestris strain C1(MN117727)

^bX. campestris pv. campestris strain ATCC33913 (AE008922)

^cX. campestris pv. campestris strain B100 (AM920689)

^dX. campestris pv. campestris strain 8004 (CP000050)

^eX. campestris pv. campestris strain CN03 (CP017308)

^fX. campestris pv. campestris strain 17 (CP011946)

^gX. campestris pv. campestris strain 3811 (CP025750)

^hX. vesicatoria ATCC 35937 strain LMG911 (CP018725)

ⁱX. citri pv. Vignicola strain CFBP7111 (CP022263)

^jX. fragariae strain YL19 (CP071955)

^kX. hortorum pv. gardneri strain JS749-3 (CP018728)

^lX. gardneri strain CFBP 8129 (LR828253)

^mP. syringae pv. tomato strain B13-200 (CP019871)

Table 7.

Sequence identity matrix of AvrGf1 (XopAG) gene of Xcc along with sequences of other bacterial species from NCBI GenBank database

Seq->	aXcc	bXcc	cXcc	dXcc	eXcc	fXcv	gXad	hXcb	iXcc	jXac	kXv	lXcp	mAc
aXcc	ID	0.241	0.241	0.241	0.241	0.248	0.250	0.28	0.28	0.28	0.254	0.261	0.269
bXcc		ID	0.999	0.999	0.999	0.749	0.744	0.246	0.247	0.247	0.824	0.238	0.261
cXcc			ID	0.999	1	0.750	0.744	0.247	0.247	0.247	0.825	0.239	0.260
dXcc				ID	0.999	0.750	0.744	0.247	0.248	0.248	0.825	0.239	0.260
eXcc					ID	0.750	0.744	0.247	0.247	0.247	0.825	0.240	0.260
fXcv						ID	0.963	0.245	0.246	0.246	0.863	0.244	0.256
gXad							ID	0.251	0.251	0.251	0.856	0.244	0.262
hXcb								ID	0.999	0.999	0.236	0.257	0.292
iXcc									ID	0.999	0.237	0.257	0.293
jXac										ID	0.237	0.257	0.293
kXv											ID	0.238	0.254
lXcp												ID	0.276
mAc													ID

^aX. campestris pv. campestris strain C1(MT191356)

^bX. campestris pv. campestris strain ATCC33913 (AE008922)

^cX. campestris pv. campestris strain B100 (AM920689)

^dX. campestris pv. campestris strain 8004 (CP000050)

^eX. campestris pv. campestris strain MAFF302021 (AP019684)

^fX. citri pv. Vignicola strain CFBP7113 (CP022270)

^gX. axonopodis pv. Dieffenbachiae LMG 695 (CP014347)

^hX. citri pv. Bilvae strain NCPPB 3213 XopAG (JX556152)

ⁱX. citri pv. citri strain NCPPB 3608 XopAG (JX566667)

^jX. axonopodis pv. citri (DQ275469)

^kX. vesicatoria ATCC 35937 strain LMG911 (CP018725)

^lX. citri pv. Punicae strain LMG 859 (CP030178)

^mAcidovorax citrulli AAC00-1 (CP000512)

Sequence identity matrix

The pairwise sequence similarity of T3Es—AvrXccC, AvrBs1, AvrGf1 of Xcc—was calculated with other bacterial species by Sequence Identity and Similarity (SIAS) software (Spain).

In silico amplification of type-III effector (T3E) genes

Three T3E genes (AvrXccC, AvrBs1, and AvrGf1) of Xcc were amplified in silico (http://insilico.ehu.es/PCR/) to confirm the specificity of T3E genes primers of Xcc among another species of Xanthomonas such as X. albilineans, X. axonopodis Xac29-1, X. axonopodis pv. citri str. 306, X. axonopodis pv. citrumelo F1, X. campestris pv. campestris, X. campestris pv. campestris str. 8004, X. campestris pv. campestris str. ATCC 33913, X. campestris pv. raphani 756C, X. campestris pv. vesicatoria str. 85-10, X. citri subsp. citri Aw12879, X. oryzae pv. oryzae KACC10331, X. oryzae pv. oryzae MAFF 311018, X. oryzae pv. oryzae PXO99A, and X. oryzae pv. oryzicola BLS256 (Bikandi et al. 2004).

Results

Development of a protocol for the detection of Xcc

The individual detection of T3E genes (avrXccC, avrBs1, and avrGf1) was tested by the conventional PCR method. The gDNA of Xcc race 1 was used for the amplification of T3Es. The avrXccC, avrBs1, and avrGf1 amplified at 996 bp, 1338 bp, and 1575 bp at an annealing temperature of 53ºC. The individual T3E genes were visualized on 1% agarose gel (Fig. 1).

Fig. 1.

Detection of type-III effector genes (avrXccC, avrBs1, and avrGf1) using gDNA of X. campestris pv. campestris. Lanes 1: avrXccC (996 bp); 2: avrGf1 (1575 bp); 3: avrBs1 (1338 bp), and M—100 bp ladder (gene ruler)

Multiplex PCR

The simultaneous detection of the three T3E genes of Xcc for their identification was examined by gene-specific primer pairs of avrXccC F/R, avrBs1 F/R, and avrGf1 F/R with the gDNA of Xcc isolates as well as Xcc-infected leaf of cauliflower (Fig. 2). This method detected Xcc from naturally and artificially infected cauliflower plants using multiplex PCR.

Fig. 2.

Simultaneous detection of T3E genes of Xcc from infected field samples of cauliflower. Lane 1: amplified 3 avr genes avrXccC (996 bp), avrBs1 (1338 bp), and avrGf1 (1575 bp) from gDNA of Xcc; C: no template control; M—100 bp ladder (Gene Ruler)

Specificity and sensitivity of type-III effector (T3E) gene-specific primers in multiplex PCR

In multiplex PCR analysis, the three T3E gene-specific primer pairs were simultaneously amplified avrXccC, avrBs1, and avrGf1at 996 bp, 1338 bp, and 1575 bp, respectively, from Xcc. A total no. of 7 isolates of Xcc including 3 of race 1 (Xcc-C1, Xcc-C4, Xcc-C5); 3 of race 4 (Xcc-C7, Xcc-C10, Xcc-C17); race 6 (Xcc-C278), and other groups of bacteria, viz., X. euvesicatoria; X. oryzae pv. oryzae, X. citri subsp. citri, E. carotovora subsp. carotovora, P. fluorescens, R. solanacearum, B. subtilis, and B. amyloliquefaciens, did not amplify with these T3E gene-specific primers (Supplementary Table 1). The primers based on avr genes amplified Xcc isolates demonstrating specificity (Table 2, Fig. 3). However, the in silico simulation of PCR of T3E genes individually reveals that these are amplified in X. campestris pv. campestris strains except AvrBs1 was amplified in X. campestris pv. vesicatoria str. 85-10 (Supplementary figure S2, S3, S4) (San Millan et al. 2013).

Fig. 3.

Specificity of Xcc T3Es (avrXccC-996 bp; avrBs1-1338 bp; and avrGf1-1575 bp) gene-specific primers using gDNA as template by multiplex- PCR. Lanes 1–3: Xcc race 1; 4–6: Xcc race 4; 7: Xcc race 6; 8: X. euvesicatoria; 9: X. oryzae pv. oryzae; 10: X. citri subsp. citri; 11: E. carotovora subsp. carotovora; 12: P. fluorescens DTPF-3; 13: R. solanacearum UTT-25; 14: B. subtillis DTBS-5; 15: B. amyloliquefaciens DSBS-11; 16: no template control; M—100 bp ladder (gene ruler)

The sensitivity of type-III effectors (T3Es) primers in multiplex PCR

The sensitivity of T3E gene-specific primer pairs was tested with gDNA from Xcc isolates and the detection threshold obtained was 0.1 ng DNA (Table 3, Fig. 4).

Table 3.

Sensitivity of Xcc T3Es gene-specific primers using multiplex PCR

Xcc isolates	Concentration of gDNA (ng/µl)
	102	101	100	10–1	10–2	10–3	10–4
Xcc-C1	+	+	+	+	+	–	–
Xcc-C4	+	+	+	+	+	–	–
Xcc-C5	+	+	+	+	+	–	–
Xcc-C7	+	+	+	+	+	–	–
Xcc-C10	+	+	+	+	+	–	–
Xcc-C17	+	+	+	+	+	–	–
Xcc-C278	+	+	+	+	+	–	–
No template control	–	–	–	–	–	–	–

+ detection, – non-detection

Fig. 4.

Sensitivity of T3Es (avrXccC-996 bp; avrBs1-1338 bp; and avrGf1-1575 bp) gene-specific primers of Xcc-C1 (race 1) using gDNA by multiplex PCR. Dilutions of gDNA (100–0.001 ng), C—no template control. M—100 bp ladder (gene ruler)

Detection of Xcc from artificially infected seeds of cauliflower

Table 4 shows that Xcc colonies can be grown on NA plates from 1 to 100% of infected seeds as inoculum after 24 h. However, we could not get colonies from 0.01 to 0.5% after 24 h. While, the multiplex PCR was detected T3E genes such as AvrXccC (996 bp), avrBs1 (1338 bp), and avrGf1 (1575 bp) from 0.1 to 100% infected seed samples after 24 h (Fig. 5). Though, multiplex PCR could not amplify T3Es with 0.01% infected seeds after 24 h. No amplification was found in healthy seeds of cauliflower. Colonies of Xcc were also recovered from the respective plates of nutrient agar medium supplemented with the described antibiotics. However, the sample with 10% contaminated seeds had few colonies present on the medium plates.

Table 4.

Multiplex PCR-based detection of T3E genes of X. campestris pv. campestris in artificially infected seeds of cauliflower (Brassica oleracea cv. Pusa Sharad)

S. no.	Percentage of infected seeds	Detection of Xcc from seed extract grown on nutrient agar	Detection of Xcc by PCR
		24 h	24 h
1.	100	+	+
2.	75	+	+
3.	50	+	+
4.	25	+	+
5.	10	+	+
6.	5	+	+
7.	1	+	+
8.	0.5	–	+
9.	0.1	–	+
10.	0.01	–	–

The multiplex-PCR amplification of T3E genes with different percentage of infected seeds after 24 h incubation

+ detection, – non-detection

Fig. 5.

Simultaneous detection of T3Es genes (avrXccC-996 bp; avrBs1-1338 bp; and avrGf1-1575 bp) of Xcc using sap of artificially infected seeds of cauliflower (B. oleracea cv. Pusa Sharad) by multiplex PCR. The seed extract was grown in nutrient broth for 24 h at 28 °C, 200 rpm and used as a template. Lanes 1–10: 100, 75, 50, 25, 10, 1.0, 0.1, 0.5, 0.01, 0.001% (percentages of infected seeds); Lane 11: positive control (gDNA of Xcc-C1, race 1); lane 12: negative control; M: 1 kb DNA ladder

Phylogenetic analysis of avirulence genes of Xcc

The nucleotide sequences of avrXccC, avrBs1, and avrGf1 genes of Xcc—race 1 (Xcc-C1, Xcc-C4, Xcc-C5), race 4 (Xcc-C7, Xcc-C10, Xcc-C17), and race 6 (Xcc-C276)—were analyzed and submitted to NCBI GenBank (accession nos. avrXccC—MT191355, avrBs1—MN117727, and avrGf1—MT191356). Based on T3Es, all Indian isolates of race 1, 4, and 6 used in this study had more than 99% homology with accessions AE008922 of Xcc B100, race 1 (cauliflower, Italy); AM920689 of Xcc ATCC33913, race 3 (Brussels sprout, UK); CP000050 of Xcc 8004, and race 9 (cauliflower, UK) (Kesharwani et al. 2022a; Singh et al. 2022) (Fig. 6).

Fig. 6.

Phylogenetic relationship of three avr genes of Xcc (AvrXccC, AvrBs1, and AvrGf1) based on nucleotide sequences. The bootstrap values are shown at nodes. The abbreviation of various Xanthomonas and other bacterial species taken for analysis is depicted with their locus tag and Gen-Bank accession number in parenthesis

Sequence identity matrix

Table 5 shows that the AvrXccC (XopAH) gene has 100% sequence identity with other Xcc strains, such as Xcc strain ATCC33913 (AE008922), Xcc strain 8004 (CP000050), Xcc strain B100 (AM920689), Xcc strain CN03 (CP017308), Xcc strain WHRI-420A (HQ169635), and Xcc strain 3811 (CP025750), while the less than 30% sequence identity was found with X. hyacinthi strain CFBP1156 (CP043476), P. syringae (M22219), P. savastanoi pv. phaseolicola 1448A (CP000059), X. citri pv. punicae strain LMG7504 (CP030167), P. coronafaciens pv. coronafaciens strain B19001 (CP046441), and X. hortorum pv. pelargonii strain CFBP 2533 (LR828261). Table 6 shows that the AvrBs1 gene has more than 99% sequence identity with Xcc strain ATCC33913 (AE008922), Xcc strain B100 (AM920689), Xcc strain 17 (CP011946) while less than 30% sequence identity with X. vesicatoria ATCC 35937 strain LMG911 (CP018725), X. citri pv. Vignicola strain CFBP7111 (CP022263), X. fragariae strain YL19 (CP071955), X. hortorum pv. gardneri strain JS749-3 (CP018728), X. gardneri strain CFBP 8129 (LR828253), and P. syringae pv. tomato strain B13-200 (CP019871). Table 7 shows that the AvrGf1 (XopAG) gene has less than 30% sequence similarity with Xcc strain ATCC33913 (AE008922), Xcc strain B100 (AM920689), Xcc strain 8004 (CP000050), Xcc strain MAFF302021 (AP019684), X. citri pv. Vignicola strain CFBP7113 (CP022270), X. axonopodis pv. Dieffenbachiae LMG 695 (CP014347), X. citri pv. Bilvae strain NCPPB 3213 XopAG (JX556152), X. citri pv. citri strain NCPPB 3608 XopAG (JX566667), X. axonopodis pv. citri (DQ275469), X. vesicatoria ATCC 35937 strain LMG911 (CP018725), X. citri pv. Punicae strain LMG 859 (CP030178), and Acidovorax citrulli AAC00-1 (CP000512).

In silico amplification of type-III effector (T3E) genes

In silico amplification of type-III effector genes (AvrXccC, AvrBs1, and AvrGf1) of Xcc with another species of Xanthomonas reveals that out of them only AvrBs1 was amplified with X. campestris pv. vesicatoria str. 85–10 among all Xanthomonas species (Bikandi et al. 2004).

Discussion

Xcc is widely distributed in both India and rest of the world, spreading black rot disease in different agroclimatic regions (Singh et al. 2016). It can be easily transmitted from one host to another, leading to frequent production losses (Mehta et al. 2019). In India, no avirulence gene-based identification of Xcc isolates belonging to races 1, 4, and 6 from biological samples of crucifer crops has been previously reported. In this study, isolates of Xcc causing black rot disease in crucifers were identified by multiplex PCR of type-III effectors. These effector proteins are involved in the pathogenicity and host specificity against crucifer crops (Singh et al. 2014). However, the T3E gene-specific primers based on T3Es sequences could not differentiate races of Xcc. Also, the in silico analysis of T3E genes of Indian isolates of Xcc—race 1 (Xcc-C1, Xcc-C4, Xcc-C5), race 4 (Xcc-C7, Xcc-C10, Xcc-C17), and race 6 (Xcc-C276)—reveals 99% homology with Xcc B100 (AE008922) race 1, Xcc ATCC33913 (AM920689) race 3, and Xcc 8004 (CP000050) race 9. The rRNA gene sequence analysis elucidated that the isolates of Xcc used in this research were very close to B100 (Italy), 8004 and ATCC 33913 (UK). This indicates that the Indian strains may have migrated to other countries by dispersal of seeds. However, the finding elucidated by the T3Es sequence analysis provides a novel insight for identifying the bacterial pathogen at field level and helps to distinguish between a range of Xanthomonas species and pathovars. The 11 races of Xcc based on their interaction with differential crucifer cultivars have been recognized (Kamoun et al. 1992; Ignatov et al. 1999; Vicente et al. 2001; Taylor et al. 2002; Fargier and Manceau 2007; Jensen et al. 2010). Recently, Kesharwani et al. 2022a reported XccAK1 (ITCCBH_0014) strain from India. XccAK1 strain belongs to race 1 and infecting Brassica juncea cv. Pusa Bold in India. The three races of Xcc, i.e., races 1, 4, and 6, are known to infect B. oleracea crops in India (Rathaur et al. 2015; Singh et al. 2016; Kesharwani et al. 2022a, b). Races 1 and 4 were dominant in several climatic regions of India, indicating that the different climatic conditions did not affect the distribution of races. However, Race 6 was less virulent in Indian climatic conditions (Singh et al. 2016). According to Vicente et al. (2001), races 1 and 4 were predominant worldwide, with races 2, 3, 5, and 6 rarely identified. Although in this study, seven isolates of Xcc belonged to race 1 (Xcc-C1, Xcc-C4, Xcc-C5), race 4 (Xcc-C7, Xcc-C10, Xcc-C17), and race 6 (Xcc-C278) were isolated from different agroclimatic conditions and hosts in India. Race 6 was found on cabbage in the Trans-Gangetic Plains region of the Indian capital (Delhi).

The PCR technique has a wide application in detecting plant-pathogenic bacteria (Adachi and Oku 2000). Multiplex PCR is a method that amplifies more than one target gene sequence in a single reaction. Afrin et al. (2018, 2020) identify Xcc races 3, 5 and 6 using SCAR (specific sequence characterized amplified region) primers, i.e., XccR3-49, XccR5-89.2, XccR6-60, and XccR6-67. Rubel et al. 2017 detected Xcc races 1 and 4 using race-specific primers such as Xcc_47R1, Xcc1_46R4, and Xcc2_46R4, but these markers restricted with the detection of the specific Xcc races. Presently, an attempt has been made to develop a multiplex-PCR method to detect Xcc using three T3E genes from biological samples of cruciferous crops growing in different agroclimatic conditions in India. The developed multiplex PCR was specific at the species level of Xcc. The specificity analysis revealed that the multiplex PCR is restricted to amplifying these type-III effector genes in Indian isolates of Xcc. No amplification was detected with other groups of bacterial genomic DNA. Additionally, the sensitivity of this assay was tested using different concentrations of genomic DNA of Xcc isolates. The threshold value of T3E gene amplification by multiplex PCR was up to 0.01 ng gDNA. The molecular characterization of these T3Es detected from infected leaf tissues also proved this method’s reliability. It is revealed that this method is very sensitive and useful to detect black rot causal agent in crucifer crops. Although, this method amplifies Xcc from crucifer crops and not restricted with the Xcc races; therefore, it is very useful to identify and characterize the black rot disease in infected plants.

This study introduces an imperative method for identifying black rot pathogen (Xcc) and is also useful for screening type-III effectors in the population of Xcc. It has the potential to detect only Xcc among other plant-pathogenic microorganisms. This will also help to diagnose the black rot infection at the initial or later stages directly through biological samples collected from a different cultivated area of crucifer crops.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

AKK and DS conceptualized the manuscript. AKK wrote the manuscript. DS and ASA evaluated the manuscript. DS and AKK equally contributed in this manuscript.

Funding

The authors are thankful to the SERB (Grant no. EMR/2016/005238), Department of Science and Technology, Govt. of India, New Delhi for providing financial support under the project entitled ‘Identification of resistance against prominent races and functional characterization of avirulence genes of Xanthomonas campestris pv. campestris causing black rot disease in crucifer crops’.

Availability of data and materials

Not applicable.

Code availability

Not applicable.

Declarations

Conflict of interest

The authors have no conflict of interest.

Ethical approval

Not applicable.

Consent to participate

Not applicable.

Consent for publication

Not applicable.