Skip to main content
Physiology and Molecular Biology of Plants logoLink to Physiology and Molecular Biology of Plants
. 2023 Aug 24;29(10):1371–1394. doi: 10.1007/s12298-023-01336-2

miRNA mediated regulation of nitrogen response and nitrogen use efficiency of plants: the case of wheat

Samrat Das 1,#, Lekshmy Sathee 1,✉,#
PMCID: PMC10709294  PMID: 38076770

Abstract

Nitrogen (N) is needed for plant growth and development and is the major limiting nutrient due to its higher demand in agricultural production globally. The use of N fertilizers has increased considerably in recent years to achieve higher cereal yields. High N inputs coupled with declining N use efficiency (NUE) result in the degradation of the environment. Plants have developed multidimensional strategies in response to changes in N availability in soil. These strategies include N stress-induced responses such as changes in gene expression patterns. Several N stress-induced genes and other regulatory factors, such as microRNAs (miRNAs), have been identified in different plant species, opening a new avenue of research in plant biology. This review presents a general overview of miRNA-mediated regulation of N response and NUE. Further, the in-silico target predictions and the predicted miRNA-gene network for nutrient metabolism/homeostasis in wheat provide novel insights. The information on N-regulated miRNAs and the differentially expressed target transcripts are necessary resources for genetic improvement of NUE by genome editing.

Keywords: miRNA, NUE, Nitrogen, Nitrogen starvation response, Wheat, CRISPR/CAS

Introduction

Plants require 17 essential elements to reach their full growth potential, of which 14 mineral elements are absorbed from the soil. Nitrogen (N) is considered to be one of the most crucial nutrient (contributing 2% of plant dry matter) that plants absorb in higher amounts compared to other elements (Miller and Cramer 2005). Hence, N is one of the limiting factors for the growth of plants in terms of availability (Ueda et al. 2017). Nitrogen is a constituent of important macromolecules such as proteins, nucleic acids, pigments and secondary metabolites (Oijen and Levy 2004). The atmospheric concentration of gaseous N is approximately 78%, however, plants only use it if fixed by N-fixing microorganisms (Erisman et al. 2008) or by industrial fixation. The quantity of N fixed annually through biological fixation accounts for more than 2 × 1013 g, while atmospheric N fixation through lightning and thunder accounts for 1012 to 1013 g annually (Raymond et al. 2004). The contribution of natural fixation of N has become minimal due to the advances in biological N fixation (BNF) mechanisms in plants (Silver and Postgate 1973). Since the introduction of the Haber–Bosch ammonia synthesis process, synthetic N fertilizers are now significant contributors to crop productivity worldwide (Hirel et al. 2007). According to Zhang et al. (2015), around 50% of the global population has benefitted from food security since the introduction of industrial N fixation. Currently, 170 million tonnes of ammonia are produced annually worldwide, consuming large amounts of non-renewable fossil fuels and the accompanying carbon footprint (Soloveichik 2019). Nitrogenous fertilizers are prone to leaching, volatilization and denitrification losses leading to environmental pollution (Kubota et al. 2018). Plants have developed adaptive strategies to tolerate low N stress, such as retardation in vegetative growth, reduction in photosynthesis, remobilization of N reserves to younger tissues, senescence of older leaves, early progression to the reproductive phase and anthocyanin accumulation (Liang and He 2018). It has been reported further that N use efficiency (NUE) of cereals is as low as 33% throughout the world, meaning more than 60% of applied N is lost and unavailable to plants (Hawkesford 2017). To make farming cost-effective and eco-friendly, the improvement of NUE is essential Hawkesford and Griffiths (2019).

MicroRNAs (miRNAs) are a group of small RNAs, single-stranded, non-coding and play an array of regulatory roles (Kidner and Martienssen 2005). Most plant miRNAs are 21 nt in length; some are 20 or 22 nt, long while, and 23- or 24-nt miRNAs are rare (Zhan and Meyers 2023). miRNAs regulate developmental and metabolic processes, including response to nutrients (Meng et al. 2010). miRNAs regulate adaptation to N limitation conditions, including alterations in N uptake, growth, development, phenology, crop architecture and secondary metabolite production (Nguyen et al. 2015; Jagadhesan et al. 2022). miRNAs have become novel targets to improve plants’ tolerance to abiotic stresses in the recent past (Zhang and Wang 2015). miRNA156, one of the well-characterized plant miRNAs, regulates plant morphology and phase changes. Studies showed that overexpression of miR156 imparts heat stress tolerance to plants (Matthews et al. 2019; Stief et al. 2014). Among plants’ largest miRNA families conserved, miR169 is another potential target for abiotic stress tolerance. When miR169 is overexpressed in transgenic plants, water loss is significantly reduced, giving better drought tolerance (Zhang et al. 2011). miR169overexpression in Arabidopsis resulted in sensitivity to N stress (Zhao et al. 2011). Constitutive expression of miR319 increased drought and salinity stress tolerance in creeping bentgrass (Zhou et al. 2013). Another study showed that overexpression of miR319 confers cold stress tolerance in rice (Yang et al. 2013). miR395 confers tolerance to heavy metals like cadmium in rapeseed (Zhang et al. 2013). Genomics and transcriptomics studies have identified several candidate genes and transcripts, including miRNAs related to N stress and NUE (Meyer et al. 2019; Zuluaga and Sonnante 2019). Although most of these studies were confined to model plants in the past, the advancement of technologies and wheat NGS data widened the scope of characterization and application of NUE aspects in the genetic improvement of wheat. In this review, we describe various aspects of NUE and N stress-related responses in plants with a detailed description of N stress-responsive plant miRNAs in different tissues and developmental stages. In silico analysis was conducted to predict miRNAs targeting NUE-associated genes in wheat. A miRNA-mRNA network has also been established to gain insight into their relationship in a tissue-specific manner. This will encourage further research about the expression and regulatory pathways related to such networks.

Crop responses to N and nitrogen use efficiency (NUE)

According to Moll et al. (1982), NUE is the ratio between grain dry weight and available N from different sources of plants. NUE has two major components: N uptake efficiency (NUpE) and N utilization efficiency (NUtE). Besides, Craswell and Godwin (1984) gave another three aspects of NUE, including agronomic efficiency (AE), apparent nitrogen recovery (AR) and physiological efficiency (PE). The different NUE parameters were described by Good et al. (2004). Since the approximate N recovery of the crops is 25–50% (Kubota et al. 2018), reducing the use of N fertilizers to maintain good yield is a worldwide challenge (Foulkes et al. 2009; Hirel et al. 2007). Plants show two-way responses under N deficiency. Firstly, plants decrease leaf elongation in the initial phase under low N, resulting in less shoot growth without altering the photosynthetic rate. The photosynthate is preferentially transported to root parts, boosting root growth (Werf and Nagel 1996). Plants remobilize the N reserves and increase nitrate uptake from soil. In the second phase, cellular macromolecules (nucleic acids and enzymes) start degrading, resulting in cell death and leaf senescence (Brandner et al. 1996, 1998). Plants depict changes in root architecture and increase in root-shoot ratio when exposed to prolonged N deficit. Nitrate, the predominant N form in agricultural soils, regulates primary and lateral root growth. There is an intrinsic relationship between auxin signalling pathways and nitrate supply for lateral root (LR) initiation. Auxin receptor Auxin signalling F-box 3 (AFB3) is induced by nitrate. LR initiation, induced by nitrate supply, is significantly reduced in auxin receptor afb3 mutant (Vidal et al. 2014). NAC4 transcription factor is an essential regulator in the downstream network of AFB3 in response to nitrate such that in nac4 mutant, LR initiation is reduced under nitrate supply (Vidal et al. 2013). NPF6.3 (CHL1/AtNRT1.1) and ANR1 MADS-box transcription factor induces meristem growth at the LR tip under nitrate treatment (Remans et al. 2006; Zhang and Forde 1998). Overexpression of ANR1 improves nitrate-responsive LR elongation without affecting primary root growth (Gan et al. 2005). At low external nitrate conditions, NPF6.3 helps in the basipetal transport of auxin at the LR tip, which reduces auxin concentration at the LR meristem reducing LR growth. Under N stress, all the root-related traits are observed to increase, but at extreme N deficiency, the root growth ceases (Gruber et al. 2013). CLAVATA3 (CLV3)/ENDOSPERM SURROUNDING REGION (ESR)-related peptides (CLE) and CLAVATA1 (CLV1) leucine-rich repeat receptor-like kinase (LRR-RLK) network regulates root development under N deficiency. At low nitrate, 4 CLE genes were up-regulated (Araya et al. 2014). Only CLV1 was found to increase LR growth when mutated among the receptors of CLE. Hence, it was concluded that CLV1 mediated pathway negatively regulates LR growth under N stress (Forde 2014). Development of LR at an early stage is positively regulated by the auxin biosynthetic gene TAR2 (Tryptophan Aminotransferase Related 2) under N deprivation due to increased auxin content at LR (Ma et al. 2014). Primary root (PR) growth is almost insensitive to nitrate concentration (Jiang et al. 2017), but at high nitrate concentration, it is inhibited (Vidal et al. 2010, 2013). In afb3 mutant and miR393 overexpressed lines, the negative effect on PR growth in the presence of nitrate was not found (Vidal et al. 2014). Although NAC3 was not found to be involved in PR growth, in the nac3 mutant, the growth was still suppressed by nitrate (Vidal et al. 2013). Therefore, there are two pathways: NAC3 dependent and NAC3 independent in terms of LR and PR growth regulated by AFB3 (Forde 2014).

miRNAs associated with nitrogen stress adaptation in plants

A limited amount of N causes a reduction in photosynthetic capability. Under N deprivation, the number of thylakoids per unit of chloroplast was reduced in spinach without changing the thylakoid membrane characteristics. N being an essential component of chlorophyll and proteins, Rubisco and chlorophyll content per unit of leaf area and Rubisco per unit of chlorophyll decreases at reduced N level (Sathee et al. 2021). Degradation of RUBISCO reduces the photosynthetic rate (Hörtensteiner and Feller 2002). Although a low N supply reduces chlorophyll content, reports also showed that with increased N supply, chlorophyll a/b and carotenoid content decreases due to profuse leaf growth and shading effects of leaves (Gallé and Feller 2007; Tóth et al. 2002). At low N, plants adapt some responses to maintain yield, which include remobilization of N reserves to growing parts, retardation of growth and anthocyanin pigmentation (Scott 1999; Diaz et al. 2006; Ding et al. 2005; Kant et al. 2011; Peng et al. 2007). Recently, Das et al. (2023) reported a reprogramming of N assimilation, N remobilisation and flavonoid biosynthesis associated miRNome in wheat. Anthocyanin is a secondary metabolite pigment with diverse colours and functions. It is found in petals, fruit skins and seed coats and can attract pollinators and animals for seed dispersal (Shirley 2001). Due to the lack of amide N for the synthesis of amino acids, the excess photosynthates are directed towards synthesizing anthocyanin and non-structural carbohydrates. During continuous episodes of N deficiency, the plant C/N ratio increases due to the accumulation of sugars, which reduces photosynthesis and induces leaf senescence (Wingler et al. 2004). Anthocyanin protects photosynthetic machinery from photo-oxidative damage and helps in N remobilization from senescing leaves (Smillie and Hetherington 1999). Anthocyanin also acts as an antioxidant (Gould et al. 2002) and scavenges reactive oxygen species (ROS). The biosynthesis of anthocyanin follows the phenylpropanoid pathway, where phenylalanine is converted into cinnamic acid by phenylalanine ammonia-lyase (PAL) and helps in anthocyanin formation through the flavonoid pathway. In Arabidopsis, a transcription factor- protein complex is involved in anthocyanin biosynthesis, which includes R2R3-MYB proteins (PAP1, PAP2, MYB61, TT2), bHLH protein (GL3, EGL3, TT8), and WD-40 protein (TTG1). Plants under N‐deficit accumulate anthocyanins in different tissues by inducing the expression of PAP2 and GL3 (Feyissa et al. 2014). Among these different families of transcription factors (TF), MYB is considered to be the most important TF. Overexpression of MYB75 (PAP1) leads to over-accumulation of anthocyanin (Tohge et al. 2005). PAP1 loss of function mutant (pap1-1) survival rate was significantly lower under N deficiency due to reduced adaptability (Liang and He 2018). Anthocyanin biosynthesis genes are found to be induced by N stress (Scott 1999; Peng et al. 2007; Das et al. 2023). Anthocyanin accumulation and purple colouration phenotype are also observed under sulphur (S) and phosphorus (P) stresses (Stewart et al. 2001). NITROGEN LIMITATION ADAPTATION (NLA), a RING-type ubiquitin ligase, plays a crucial part in N stress adaptation (Zhao et al. 2011). Peng et al. (2008) reported that the nla mutant of Arabidopsis showed susceptibility to N deficiency with a lack of anthocyanin accumulation but accumulated plenty of anthocyanin under combined N and P stress, probably because there are two pathways of anthocyanin biosynthesis induced by N and P deficiencies separately and this mutation disrupts N deficiency-induced pathway only. miR156 targeting SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) transcription factor (TF) gene (Wang et al. 2012) has been reported to regulate anthocyanin accumulation. High anthocyanin concentration at stem nodes in Arabidopsis was observed due to higher expression of miR156 and down-regulation of SPL, but in growing plants, SPL level rises with down-regulation of miR156 (Wu et al. 2009). As a result, anthocyanin biosynthesis is repressed, and flavonol synthesis is promoted. TAS4 RNA regulated by miR828 regulates MYB TFs in Arabidopsis and apple (Xia et al. 2012). TasiRNA derived from TAS4 is found to target RNAs encoding MYB75 and MYB113 in Arabidopsis and MYB90 and MYB113 in potatoes regulating anthocyanin accumulation (Liu et al. 2016). MYB11, MYB12 and MYB113 are found to be targeted by miR156 (Gou et al. 2011), whereas MYB111 is targeted by miR858 (Sharma et al. 2016), which regulates anthocyanin synthesis. The transgenic overexpressor line of miR828 in Arabidopsis showed a decrease in the expression of MYB75, MYB90 and MYB113, as well as anthocyanin biosynthesis (Yang et al. 2013).

miRNAs associated with N deficiency have been reported in recent studies. N responsive miRNAs, e.g. miR167 and miR393, were found to control root system architecture (RSA) (Gifford et al. 2008; Vidal et al. 2010). Another study showed that miR169 helps to cope with N stress (Zhao et al. 2011). ARF6 and ARF8, the two targets of miR167, were induced, as miR167 was down-regulated by nitrate treatment in Arabidopsis (Gifford et al. 2008). The information on N-responsive miRNAs and their responses to N deficiency and the general effects of overexpression are listed in Table 1. N stress leads to carbon accumulation in roots resulting in a higher root-to-shoot ratio for better forage of nitrate (Paul and Driscoll 1997; Scheible 2004; Scheible et al. 1997). N deficiency enhances primary root growth and lateral root elongation except for lateral root initiation up to a certain extent (Gruber et al. 2013; Bucio et al. 2003). Under extreme N deficiency, no lateral root elongation occurs (Krouk and Kiba 2020). miR399, which regulates phosphate homeostasis (Pant et al. 2009), is found to be up-regulated in maize (Xu et al. 2011) and down-regulated in Arabidopsis (Liang et al. 2012) in root under N deficiency. Root system architechture is reported to be regulated by several phytohormone-linked pathways (Osmont et al. 2007). Root tissues develop from root apical meristem (RAM) and have different tissue layers, epidermis, cortex, endodermis and pericycle surrounding the central xylem and phloem tissues in a concentric. The interaction between auxin recptors TRANSPORT INHIBITOR RESPONSE 1 (TIR1) or Auxin signalling F-box (AFB) proteins and Aux/IAA proteins results in ubiquitination and 26S proteasome-mediated degradation of Aux/IAA (Dharmasiri et al. 2005; Maraschin et al. 2009). This releases AUXIN RESPONSE FACTORS (ARFs) which are transcription factors that regulate the activation and repression of auxin-responsive genes (Guilfoyle 2015). miR165/166 targets PHABULOSA (PHB) and PHAVOLUTA (PHV), which are homeodomain leucine zipper class-III (HD-ZIP III) transcription factor genes involved in shoot apical meristem development and vascular tissue differentiation (Zhou et al. 2007). Khan et al. (2011) reported that loss of function of miR165/166 with higher expression of PHB and PHV resulted in lethal embryo and aberrant root development, confirming the role of miR165/166 mediated repression of PHB and PHV in embryonic root development. miR160 regulates gravitropism and root development and targets ARF10, ARF16 and ARF17. Overexpression of miR160 leads to agravitropic and shorter roots with tumour-like growth due to uncontrolled cell division in RAM and failure in columella cell differentiation (Wang et al. 2005). In Arabidopsis, miR396, which targets GROWTH REGULATION FACTORS (GRFs) genes that help in cell multiplication in leaves (Rodriguez et al. 2010), is also found to regulate root growth by restricting cell multiplication at RAM. SHORTROOT (SHR), a GRAS transcription factor produced in central vascular layers of root tissue, regulates cell differentiation in roots and transports to endodermis, where it activates SCARECROW (SCR) transcription factor (Gallagher et al. 2004). In endodermis, SHR and SCR activate miR165/166, which prevents PHB expression and ensures proper xylem differentiation (Carlsbecker et al. 2010). But overexpression of miR166 leads to a disordered vascular system of the root. Hence, regulating miR165/166 and its targets is essential for root vascular differentiation.

Table 1.

List of nitrogen (N) responsive miRNAs and their responses to N deficiency and general effects of overexpression

Family Target genes Potential function under N deficiency Plant Response to overexpression
miR156 Squamosa Promoter Binding Protein Like (SPL) family of transcription factors Anthocyanin accumulation, Modification of flowering time Liang et al. (2012)

Increased production of anthocyanin

Gou et al. (2011),

prolonged juvenile phase,

improved biomass production

Xie et al. (2012)

miR160 Auxin response factors (ARF10ARF16 and ARF17) Root and nodule organogenesis, morphogenesis, signaling Xu et al. (2011) Defects in root growth and nodulation Bustos-Sanmamed et al. (2013)
miR162 Dicer-like proteins Flower development, miRNA biogenesis Liu et al. (2014) Induction of defense- genes and accumulation of hydrogen peroxide Li et al. (2020)
miR164 NAC transcription factors Lateral root development and senescence Xu et al. (2011) Altered phenology and morphology Rosas Cárdenas et al. (2017)
miR166 HD-ZIP transcription factors family (REVOLUTA (REV), PHABULOSA (PHB), PHAVOLUTA (PHV), CORONA (CNA) and ATHB8) Development and stress signaling Zhang et al. (2014) Increase in root length and sensitivity to plant hormones Singh et al. (2017)
miR167 ARF transcription factors (ARF6 and ARF8) Adventitious and lateral rooting Gifford et al. (2008) suppression of auxin response and biotic stress resistance Caruana et al. (2020)
miR168 Peptide transporter, Argonaute (AGO) miRNA biogenesis, Nitrogen uptake Nischal et al. (2012) and Vaucheret et al. (2006) Developmental defects Vaucheret et al. (2006)
miR169 Nuclear factor YA (NFYA) Nitrogen homeostasis, stress response Zhao et al. (2011) Sensitivity to N deficiency, low N accumulation Zhao et al. (2011)
miR171 Scarecrow-Like (SCL) transcription factors Root morphogenesis Liang et al. (2012) Altered phenology and developmental defects Curaba et al. (2013)
miR172 AP2 transcription factors (TOE1 and TOE2) Flower development, nodulation Jung et al. (2011), Yan et al. (2013) Promotion of flowering Zhu et al. (2009)
miR319 TCP transcription factors Jasmonate biosynthesis and thus leaf growth and senescence Schommer et al. (2008, 2014) Altered leaf development, cold tolerance Fang et al. (2020), Yang et al. (2013) and Zhou et al. (2013)
miR393 Auxin receptors TIR1, AFB1, AFB2, and AFB3 Root morphogenesis Vidal et al. (2010) Increase in tillering Li et al. (2016)
miR396 GRF transcription factors Yield and N assimilation Rodriguez et al. (2010) and Zhang et al. (2020) Improved yield, altered leaf proliferation Rodriguez et al. (2010), and Zhang et al. (2020)
miR398 CSD; COX5b-1; CCS1 Oxidative stress defence under N deficiency Sunkar et al. (2006)
miR399 UBC24/PHO2 Nitrate dependent Phosphate metabolism
miR408 Laccases; plantacyanin Copper metabolism, lignin biosynthesis Liang et al. (2015)
miR826/miR5090 2‐oxoglutarate‐dependent dioxygenase ALKENYL HYDROXALKYL PRODUCING 2 (AOP2) involved in the synthesis of glucosinolates, N‐containing metabolites Glucosinolate biosynthesis Liang et al. (2012)
miR827 SPX (SYG1/ Pho81/ XPR1) Nitrogen/phosphorus homeostasis Kant et al. (2011) Impaired phosphorus homeostasis Wang et al. (2012)

The plant root system develops lateral roots (LR) that arise from pericycle cells for better water and nutrient uptake and good anchorage to the soil. Auxin is reported to promote LR initiation by inducing pericycle cell division (Fukaki et al. 2007). miR164 is found to negatively regulate LR initiation through repression of its target NAC1 expression (Guo et al. 2005), whereas miR160 is found to positively regulate LR initiation limiting ARF16 (Wang et al. 2005). Another set of non-coding RNAs called TAS RNAs is cleaved by miRNAs and processed to dsRNAs which are further cleaved by DCL4 into small 21nt long dsRNAs called trans-acting small interfering RNAs (siRNAs). These siRNAs were reported to regulate LR growth. TAS3 RNAs are cleaved by miR390, and tasiRNAs are generated (Fahlgren et al. 2006). miR390 generates tasiARFs that repress different ARFs to promote LR growth. It was reported in Arabidopsis that miR160 positively regulates adventitious root formation through ARF17 repression, and miR167 negatively regulates adventitious root formation targeting ARF6 and ARF8. This crosstalk between miR160 and miR167 is regulated by light and transcription-related processes (Gutierrez et al. 2009). But in rice, miR167 is a positive regulator of adventitious root formation (Meng et al. 2009). Hence, these auxin-mediated miRNA pathways in phylogenetically distant species are not completely conserved.

Nitrogen stress-responsive miRNAs in wheat, Structural prediction of precursor miRNAs and identification of nitrogen stress-responsive miRNA-mRNA network in wheat

Although wheat has a relatively complex genome with a larger genome size (~ 17 Gb) compared to other crops, recent advances in sequencing technologies have led to the discovery of some conserved and novel miRNAs in wheat. Similar to the other crops, N-responsive miRNAs have also been studied in wheat (Das et al. 2023). Zhao et al. (2015) identified that seven miRNA families were differentially expressed under low N stress in wheat. Gao et al. (2016) mentioned another N-responsive miRNA (miR444a) in wheat. Expression levels of N-responsive ttu-miRNAs have been studied under chronic and transient stress in durum wheat (Zuluaga et al. 2018). In another study, Zuluaga et al. (2017) focused on the the-miRNAs expressed only at the grain-filling stage in durum wheat. Similarly, several investigations have successfully identified a number of N stress-responsive miRNAs along with their putative target genes, responses under N deficiency, tissue, and developmental stage-specific expressions in bread wheat (Triticum aestivum L.), durum wheat (Triticum turgidum ssp. durum) and spherococcum wheat (T. spheococcum), respectively (Table 2).

Table 2.

List of nitrogen (N) stress responsive miRNAs in wheat. Responses of miRNAs are designated as U for up-regulated and D for down-regulated expressions

miRNA family Validated/putative target genes Potential function under N deficiency Response Developmental stage Tissue References Treatments
tae-miR156 SPL, TGA1, glycosyl/glycerophosphate transferase, CYPs, Cob(I)alamin adenolsyl transferase Shoot development, phase change, seed germination U Seedling Roots Zhao et al. (2015) Transient stress
ttu-miR156a, b, j SPL, TGA1, glycosyl/glycerophosphate transferase, CYPs, Cob(I)alamin adenolsyl transferase Shoot development, phase change, seed germination U Seedling Leaves Zuluaga et al. (2018) Chronic stress
tae-miR159a, b MYB, TCP Plant morphogenesis D Seedling Roots Sinha et al. (2015) Both
tae-miR160 Auxin Response Factor (ARF22) Root development, signal transduction, phase change D Seedling Roots Sinha et al. (2015) Both
ttu-miR160 Auxin Response Factor (ARF22) Root development, signal transduction, phase change U Seedling Leaves (Zuluaga et al. (2018) Chronic stress
ttu-miR160 Auxin Response Factor (ARF22) Root development, signal transduction, phase change U Seedling Roots Zuluaga et al. (2018) Transient stress
tae-miR164 NAC7 Root development B Seedling Roots Sinha et al. (2015) Both
ttu-miR164d NAC7 Root development U Seedling Roots Zuluaga et al. (2018) Chronic stress
ttu-miR164d NAC7 Root development D Seedling Roots Zuluaga et al. (2018) Transient stress
ttu-miR164d NAC7 Root development U Grain filling Roots (Zuluaga et al. (2017) Chronic stress
ttu-miR166k HD-ZIP TF Shoot development D Seedling Roots Zuluaga et al. (2018) Transient stress
ttu-miR166q HD-ZIP TF Shoot development U Seedling Leaves Zuluaga et al. (2018) Chronic stress
ttu-miR167h Auxin Response Factor (ARF8) Root development, signal transduction U Seedling Leaves, roots Zuluaga et al. (2018) Chronic stress
ttu-miR167h Auxin Response Factor (ARF8) Root development, signal transduction D Grain filling Roots Zuluaga et al. (2017) Chronic stress
ttu-miR167h Auxin Response Factor (ARF8) Root development, signal transduction U Grain filling Leaves, stems Zuluaga et al. (2017) Chronic stress
ttu-miR167i Auxin Response Factor (ARF8) Root development, signal transduction U Seedling Leaves Zuluaga et al. (2018) Chronic stress
ttu-miR168b, c Argonaute (AGO1) Signal transduction U Seedling Leaves Zuluaga et al. (2018) Chronic stress
tae-miR169a, b, d, e, f, h, m, n CCAAT-box TF WHAP6, NFYAs Nitrogen homeostasis, stress response D Seedling Roots, shoots Qu et al. (2015) Chronic stress
ttu-miR169b CCAAT-box TF WHAP6, NFYAs Nitrogen homeostasis, stress response U Seedling Leaves Zuluaga et al. (2018) Chronic stress
ttu-miR169c CCAAT-box TF WHAP6, NFYAs Nitrogen homeostasis, stress response D Grain filling Roots Zuluaga et al. (2017) Chronic stress
ttu-miR169c CCAAT-box TF WHAP6, NFYAs Nitrogen homeostasis, stress response D Grain filling Leaves, stems Zuluaga et al. (2017) Chronic stress
ttu-miR169c CCAAT-box TF WHAP6, NFYAs Nitrogen homeostasis, stress response D Grain filling Flag leaf Zuluaga et al. (2017) Chronic stress
ttu-miR169c CCAAT-box TF WHAP6, NFYAs Nitrogen homeostasis, stress response D Grain filling Spikes Zuluaga et al. (2017) Chronic stress
ttu-miR319b MYB3, TCP Shoot development U Grain filling Leaves, stems Zuluaga et al. (2017) Chronic stress
ttu-miR319b MYB3, TCP Shoot development B Grain filling Flag leaf Zuluaga et al. (2017) Chronic stress
ttu-miR319d MYB3, TCP Shoot development U Seedling Roots Zuluaga et al. (2018) Chronic stress
ttu-miR393c Auxin signaling F-Box 2 (AFB2) Root development, defense response D Grain filling Roots Zuluaga et al. (2017) Chronic stress
ttu-miR393c Auxin signaling F-Box 2 (AFB2) Root development, defense response D Grain filling Leaves, stems Zuluaga et al. (2017) Chronic stress
ttu-miR396b, g GRF TF Leaf development U Seedling Roots Zuluaga et al. (2018) Chronic stress
tae-miR399 E2 ubiquitin conjugase PHOSPHATE 2 (PHO2) Phosphate metabolism D Seedling Roots Zhao et al. (2015) Transient stress
ttu-miR399b E2 ubiquitin conjugase PHOSPHATE 2 (PHO2) Phosphate metabolism D Seedling Leaves, roots Zuluaga et al. (2018) Chronic stress
ttu-miR399b E2 ubiquitin conjugase PHOSPHATE 2 (PHO2) Phosphate metabolism D Seedling Roots Zuluaga et al. (2018) Transient stress
ttu-miR399b E2 ubiquitin conjugase PHOSPHATE 2 (PHO2) Phosphate metabolism D Grain filling Roots Zuluaga et al. (2017) Chronic stress
ttu-miR399b E2 ubiquitin conjugase PHOSPHATE 2 (PHO2) Phosphate metabolism U Grain filling Leaves, stems Zuluaga et al. (2017) Chronic stress
ttu-miR399b E2 ubiquitin conjugase PHOSPHATE 2 (PHO2) Phosphate metabolism U Grain filling Spikes Zuluaga et al. (2017) Chronic stress
tae-miR444 MIKC-type MADS-box TF WM32B(MMW), GRAS family TF, maturase K Signal transduction, defense response U Seedling Roots Zhao et al. (2015) Transient stress
tae-miR444a MIKC-type MADS-box TF WM32B(MMW), GRAS family TF, maturase K Signal transduction, defense response U Seedling Leaves, roots Gao et al. (2016) Both
ttu-miR444a MIKC-type MADS-box TF WM32B(MMW), GRAS family TF, maturase K Signal transduction, defense response U Seedling Roots Zuluaga et al. (2018) Transient stress
ttu-miR444d MIKC-type MADS-box TF WM32B(MMW), GRAS family TF, maturase K Signal transduction, defense response U Grain filling Roots Zuluaga et al. (2017) Chronic stress
ttu-miR827a E3 ubiquitin ligase Nitrogen Limitation Adaptation (NLA), SPX, Caseinolytic protease (CLP) Nitrogen/phosphorus homeostasis D Seedling Leaves, roots Zuluaga et al. (2018) Chronic stress
ttu-miR827a E3 ubiquitin ligase Nitrogen Limitation Adaptation (NLA), SPX, Caseinolytic protease (CLP) Nitrogen/phosphorus homeostasis B Seedling Roots Zuluaga et al. (2018) Transient stress
ttu-miR827a E3 ubiquitin ligase Nitrogen Limitation Adaptation (NLA), SPX, Caseinolytic protease (CLP) Nitrogen/phosphorus homeostasis D Grain filling Roots Zuluaga et al. (2017) Chronic stress
ttu-miR827a E3 ubiquitin ligase Nitrogen Limitation Adaptation (NLA), SPX, Caseinolytic protease (CLP) Nitrogen/phosphorus homeostasis U Grain filling Leaves, stems Zuluaga et al. (2017) Chronic stress
tae-miR1117 Drought related aquaporin Stress response D Seedling Roots Sinha et al. (2015) Both
tae-miR1118 HVA22, TaCaM2, glutathione S-transferase 2, RUBISCO large subunit, P347, sugar transporters Stress response U Seedling Roots Zhao et al. (2015) Transient stress
tae-miR1120 D Seedling Roots Sinha et al. (2015) Both
tae-miR1129 Molybdenum cofactor sulfurase, major facilitator family transporter Stress response U Seedling Roots Zhao et al. (2015) Transient stress
tae-miR1133 Calmodulin-like, SET domain histone methyltransferases, early nodulin, NADH-ubiquinone/plastoquinone oxidoreductase chain 6 precursor Stress response D Seedling Roots Zhao et al. (2015) Transient stress
tae-miR1136 Endo-1,4-beta-glucanase Stress response U Seedling Roots Zhao et al. (2015) Transient stress
tae-miR2275 TaBDP, TaPRP, TaWRK, TaSPK, TaPP, TaAAT, TaNTA, TaIM Nitrogen homeostasis U Seedling Roots Qiao et al. (2018) Transient stress
ttu-miR9778 U Seedling Roots Zuluaga et al. (2018) Chronic stress
ttu-novel-13 High-affinity nitrate transporter-activating protein 2.1 (NAR2.1) D Seedling Leaves Zuluaga et al. (2018) Chronic stress
ttu-novel-13 High-affinity nitrate transporter-activating protein 2.1 (NAR2.1) U Grain filling Flag leaf Zuluaga et al. (2017) Chronic stress
ttu-novel-61 CCAAT-box TF WHAP6 D Seedling Leaves, roots Zuluaga et al. (2018) Chronic stress
ttu-novel-61 CCAAT-box TF WHAP6 D Seedling Roots Zuluaga et al. (2018) Transient stress
ttu-novel-61 CCAAT-box TF WHAP6 D Grain filling Leaves, roots, stems, flag leaf, spikes Zuluaga et al. (2017) Chronic stress
ttu-novel-72 D Seedling Roots Zuluaga et al. (2018) Transient stress
ttu-novel-74 Glutathione transferase F5 U Seedling Roots Zuluaga et al. (2018) Transient stress
ttu-novel-85 Auxin Response Factor (ARF22) U Seedling Roots Zuluaga et al. (2018) Transient stress
ttu-novel-87 NAC7 U Seedling Roots Zuluaga et al. (2018) Chronic stress
ttu-novel-103 U Grain filling Flag leaf Zuluaga et al. (2017) Chronic stress
ttu-novel-106 MYB-A U Seedling Leaves Zuluaga et al. (2018) Chronic stress
ttu-novel-106 MYB-A D Seedling Roots Zuluaga et al. (2018) Transient stress

Based on literature (Gao et al. 2016; Qiao et al. 2018; Qu et al. 2015; Sinha et al. 2015; Zuluaga et al. 2017, 2018), a number of tae-miRNA and tte-miRNA members have been enlisted in Table 2 showing their differential tissue-specific and developmental stage-specific expressions under chronic and transient N stresses or both. We have shown precursor miRNA (pre-miRNA) structures of 5 miRNAs (tae-miR156, tae-miR160, tae-miR169, tae-miR399 and the-miR160) from the list (Table 2). To deduce the two-dimensional (2D) secondary structures (Fig. 1), pre-miRNA sequences were retrieved from the updated wheat miRNA library available on miRBase 22.0 (http://www.mirbase.org/) and the obtained sequences were used as a query in UNAFold server (http://www.unafold.org/). Based on free energy methods and computational programming, the secondary structures are predicted by this server (Markham and Zuker 2008).

Fig. 1.

Fig. 1

2D secondary structure prediction of nitrogen stress responsive precursor miRNAs using UNAFold. a tae-miR156, b tae-miR160, c tae-miR169, d tae-miR399, e ttu-miR160

To deduce the three-dimensional (3D) structures of pre-miRNAs (tae-miR156, tae-miR160, tae-miR169, tae-miR399 and ttu-miR160), the sequences obtained from miRBase 22.0 (http://www.mirbase.org/) were used as query in TamiRPred server (http://webtom.cabgrid.res.in/tamirpred/) and dot-bracket notations of pre-miRNA secondary structures were obtained which were further used as query in RNAComposer (http://rnacomposer.cs.put.poznan.pl/) to get the structure files (Antczak et al. 2016; Popenda et al. 2012). Finally, the 3D structures were retrieved using UCSF Chimera software (https://www.rbvi.ucsf.edu/chimera/) (Pettersen et al. 2004) (Fig. 2).

Fig. 2.

Fig. 2

3D secondary structure prediction of nitrogen stress responsive precursor miRNAs using RNAComposer. a tae-miR156, b tae-miR160, c tae-miR169, d tae-miR399, e ttu-miR160

An interactive network of miRNAs, target genes and gene functions based on Table 2 has been devised using Cytoscape (Fig. 3). The candidate genes related to N stress response, N uptake, assimilation, remobilization and NUE were identified by Islam et al. (2021) and Zuluaga and Sonnante (2019). The identified candidates were searched against Triticum species and sub-species in the Ensembl Plants database (https://plants.ensembl.org/), and the whole gene, cDNA, exon, and intron sequences were retrieved for further analysis. Full-length genomic sequences of genes were used as a query against the updated wheat miRNA library available on miRBase 22.0 (http://www.mirbase.org/). The genomic sequences were pasted in FASTA format in the search box to retrieve the miRNAs of wheat based on sequence homology. The potential miRNAs targeting the candidate genes were predicted by aligning the miRNAs to target mRNA sequences by homology search-based psRNATarget (http://plantgrn.noble.org/psRNATarget/) server (Table 3). Based on in silico target prediction, it was found that the-miR160 targets ARFs, whereas nitrate reductase is targeted by the-miR1120c-5p, tae-miR1137b-5p, tae-miR1128 and tae-miR1130a. tae-miR9666b-3p and tae-miR9670-3p targets nitrite reductase, chalcone synthase bytae-miR1120b-3p and glutamine synthetase by tae-miR1137b-5p. tae-miR1120c-5p, tae-miR1130a and tae-miR9782 were having probability to target nitrate transporters (NRT1/ NPF). miRNAs targeting wheat N signalling genes were also identified. Increase in anthocyanin production under low N stress in wheat is well documented (Das et al. 2023), Low N induced changes in crop phenology and accelerated flowering (Padhan et al. 2023) is seen in rice, which could be due to modulation of associated miRNas. Low N content also resulted in increased formation of hydrogen peroxide and accumulation of thiobarbituric acid reactive substances (TBARS) in wheat (Jain et al. 2011; Padhan et al. 2020). Recently, we (Das et al. 2023) have reported a reprogramming of N assimilation, N remobilisation, and flavonoid biosynthesis associated miRNome in wheat.

Fig. 3.

Fig. 3

Visualization of nitrogen stress responsive miRNA-miRNA and associated gene functions network using Cytoscape. The miRNAs, target genes and potential functions under nitrogen stress are represented in rounded rectangle, circle and hexagon shapes, respectively. The interaction is shown as nodes and edges to depict expressions of miRNAs in leaves (green), roots (orange), stem (blue), spikes (red) and flag leaf (pink) (Color figure online)

Table 3.

In silico analysis of miRNAs and the target genes associated with for nitrogen metabolism and nutrient use efficiency in wheat

Target name miRNA Acc Target Acc Expectation miRNA length Target start Target end miRNA aligned_fragment Alignment Target
Nitrate reductase tae-miR1120c-5p TraesCS6A02G017500.1 1 21 1531 1551 UAAUAUAAGAACGUUUUUGAC ::::::::::::::::::: DNA
tae-miR1120c-5p TraesCS6A02G017500.1 1 21 194 214 UAAUAUAAGAACGUUUUUGAC ::::::::::::::::::: intron
tae-miR1120c-5p TraesCS6A02G017500.2 1 21 194 214 UAAUAUAAGAACGUUUUUGAC ::::::::::::::::::: intron
tae-miR1120c-5p TraesCS6A02G017500.3 1 21 1531 1551 UAAUAUAAGAACGUUUUUGAC ::::::::::::::::::: DNA
tae-miR1137b-5p TraesCS6B02G024900.1 0.5 21 3283 3303 UCCGUUCCAGAAUAGAUGACC ::::::::::.::::::::: cDNA
tae-miR1137b-5p TraesCS6B02G024900.2 0.5 21 6007 6027 UCCGUUCCAGAAUAGAUGACC ::::::::::.::::::::: DNA
tae-miR1137b-5p TraesCS6B02G024900.1 0.5 21 1904 1924 UCCGUUCCAGAAUAGAUGACC ::::::::::.::::::::: exon
tae-miR1128 TraesCS6B02G024900.1 1 21 822 842 UACUACUCCCUCCGUCCGAAA ::::::::::::::::::: intron
tae-miR1128 TraesCS6B02G024900.2 1 21 2201 2221 UACUACUCCCUCCGUCCGAAA ::::::::::::::::::: DNA
tae-miR1130a TraesCS6B02G024900.3 1.5 23 2191 2213 CCUCCGUCUCGUAAUGUAAGACG :::::.::::.:.:::::::: DNA
tae-miR1130a TraesCS6B02G024900.1 1.5 23 812 834 CCUCCGUCUCGUAAUGUAAGACG :::::.::::.:.:::::::: intron
Glutamine synthetase tae-miR1137b-5p TraesCS2D02G500600.1 0.5 21 213 233 UCCGUUCCAGAAUAGAUGACC ::::::::::.::::::::: intron
tae-miR1137b-5p TraesCS2D02G500600.2 0.5 21 3911 3931 UCCGUUCCAGAAUAGAUGACC ::::::::::.::::::::: DNA
Nitrite reductase tae-miR9666b-3p TraesCS4B02G373400.1 2 22 2462 2483 CGGUUGGGCUGUAUGAUGGCGA :..::::::.::::::::.: DNA
tae-miR9666b-3p TraesCS4B02G373400.1 2 22 1422 1443 CGGUUGGGCUGUAUGAUGGCGA :..::::::.::::::::.: cDNA
tae-miR9666b-3p TraesCS4B02G373400.1 2 22 405 426 CGGUUGGGCUGUAUGAUGGCGA :..::::::.::::::::.: exon
tae-miR9670-3p TraesCS4D02G045800.1 2 21 1022 1042 AGGUGGAAUACUUGAAGAAGA :::::..::::::::::: cDNA
tae-miR9670-3p TraesCS4D02G045800.1 2 21 319 339 AGGUGGAAUACUUGAAGAAGA :::::..::::::::::: exon
tae-miR9670-3p TraesCS4D02G045800.2 2 21 2166 2186 AGGUGGAAUACUUGAAGAAGA :::::..::::::::::: DNA
tae-miR9666b-3p TraesCS4D02G045800.3 2 22 2412 2433 CGGUUGGGCUGUAUGAUGGCGA :..::::::.::::::::.: DNA
tae-miR9666b-3p TraesCS4D02G363900.1 2 22 1293 1314 CGGUUGGGCUGUAUGAUGGCGA :..::::::.::::::::.: cDNA
tae-miR9666b-3p TraesCS4D02G363900.1 2 22 405 426 CGGUUGGGCUGUAUGAUGGCGA :..::::::.::::::::.: exon
tae-miR9666b-3p TraesCS4D02G363900.2 2 22 2382 2403 CGGUUGGGCUGUAUGAUGGCGA :..::::::.::::::::.: DNA
tae-miR9666b-3p TraesCS4D02G363900.2 2 22 1491 1512 CGGUUGGGCUGUAUGAUGGCGA :..::::::.::::::::.: cDNA
tae-miR9666b-3p TraesCS4D02G363900.2 2 22 405 426 CGGUUGGGCUGUAUGAUGGCGA :..::::::.::::::::.: Exon
tae-miR9660-5p TraesCS1A02G091300.1 4.5 20 1632 1651 UUGCGAGCAACGGAUGAAUC ::::::::::::::: cDNA
tae-miR5384-3p TraesCS1A02G091300.1 5 21 1681 1701 UGAGCGCGCCGCCGUCGAAUG :::::.:::::.::::: cDNA
AFB3 tae-miR9664-3p TraesCS1A02G091300.1 5 21 648 668 UUGCAGUCCUCGAUGUCGUAG ::::::.:::::.:: cDNA
tae-miR9674b-5p TraesCS1A02G091300.1 5 21 1895 1914 AUAGCAUCAUCCAUCCUACCC :::::::::::::::.: cDNA
Chalcone synthase tae-miR1120b-3p TraesCS2B02G038700.1 2 21 75 95 UUCUUAUAUUGUGGGACAGAG :::::..:::::::::::: intron
tae-miR1120b-3p TraesCS2B02G038700.2 2 21 355 375 UUCUUAUAUUGUGGGACAGAG :::::..:::::::::::: DNA
Auxin response factors tae-miR160 TraesCS2A02G567300.1 0.5 21 4271 4291 UGCCUGGCUCCCUGUAUGCCA ::::::.:::::::::::::: DNA
tae-miR160 TraesCS2A02G567300.1 0.5 21 1296 1316 UGCCUGGCUCCCUGUAUGCCA ::::::.:::::::::::::: cDNA
tae-miR160 TraesCS2A02G567300.1 0.5 21 216 236 UGCCUGGCUCCCUGUAUGCCA ::::::.:::::::::::::: exon
tae-miR160 TraesCS2D02G577800.1 0.5 21 1255 1275 UGCCUGGCUCCCUGUAUGCCA ::::::.:::::::::::::: cDNA
tae-miR160 TraesCS2D02G577800.1 0.5 21 216 236 UGCCUGGCUCCCUGUAUGCCA ::::::.:::::::::::::: exon
tae-miR160 TraesCS2D02G577800.2 0.5 21 4345 4365 UGCCUGGCUCCCUGUAUGCCA ::::::.:::::::::::::: DNA
tae-miR160 TraesCS7D02G436800.1 0 21 2263 2283 UGCCUGGCUCCCUGUAUGCCA :::::::::::::::::::: DNA
tae-miR160 TraesCS7D02G436800.1 0 21 246 266 UGCCUGGCUCCCUGUAUGCCA :::::::::::::::::::: Exon
tae-miR160 TraesCS7D02G436800.1 0 21 1910 1930 UGCCUGGCUCCCUGUAUGCCA :::::::::::::::::::: cDNA
Nitrate transporter tae-miR1120c-5p TraesCS7B02G328700.1 0.5 21 181 201 UAAUAUAAGAACGUUUUUGAC ::::::::::::.:::::::: intron
tae-miR1120c-5p TraesCS7B02G328700.2 0.5 21 1512 1532 UAAUAUAAGAACGUUUUUGAC ::::::::::::.:::::::: DNA
tae-miR1130a TraesCS3A02G418700.1 1.5 23 506 528 CCUCCGUCUCGUAAUGUAAGACG :::::.::::.:.:::::::: DNA
tae-miR1130a TraesCS3A02G418700.1 1.5 23 379 401 CCUCCGUCUCGUAAUGUAAGACG :::::.::::.:.:::::::: intron
tae-miR9782 TraesCS7A02G301700.1 0 24 2687 2710 GUAUUAGGUUGGUCAAAUUGACGA :.::::::::::::::::::::: intron
tae-miR9782 TraesCS7A02G301700.2 0 24 4349 4372 GUAUUAGGUUGGUCAAAUUGACGA :.::::::::::::::::::::: DNA
SPL9 tae-miR156 TraesCS2A02G232400.1 1 21 786 806 UGACAGAAGAGAGUGAGCACA :::::::::::::::::: cDNA
tae-miR9780 TraesCS2A02G232400.1 5 21 460 480 CGGGUCGGCGCUGCACGCGGC ::::.::::::::: cDNA
PAP1 tae-miR9658-3p TraesCS1A02G021500.1 4 21 901 921 AUCGUUCUGGGUGAAUAGGCC ::::.:..:::::::.::: cDNA
NLP7 tae-miR444a TraesCS3D02G166900.2 5 21 1003 1023 UUGCUGCCUCAAGCUUGCUGC :::.::::::::::.:: cDNA
TCP20 tae-miR444b TraesCS3D02G166900.2 5 21 1003 1023 UUGCUGCCUCAAGCUUGCUGC :::.::::::::::.:: cDNA
tae-miR9666a-3p TraesCS2A02G376000.1 4 22 116 137 CGGUAGGGCUGUAUGAUGGCGA :::::::::::.:::::: cDNA
tae-miR397-5p TraesCS2A02G376000.1 5 21 222 241 UCACCGGCGCUGCACACAAUG :.::::::.:.::::::: cDNA
NLA tae-miR9652-5p TraesCS2A02G112800.1 5 22 945 966 CCUGUUUGUCAUUAAGUUUCUU ::.::.:::::.:::: cDNA
tae-miR9776 TraesCS2A02G112800.1 5 21 1270 1290 UUGGACGAGGAUGUGCAACUG :::::::.:.:::::… cDNA
tae-miR9780 TraesCS2A02G112800.1 5 21 113 133 CGGGUCGGCGCUGCACGCGGC :::.:::::::::.::: cDNA
ALBD37 tae-miR156 NM_126142.5 5 21 957 977 UGACAGAAGAGAGUGAGCACA ::.::::.:.::.:::: cDNA
tae-miR9657b-5p NM_126142.5 5 21 1607 1627 UUCGUCGGAGAAGCAUGUUGC :::::::::::::: cDNA

Most miRNAs in plant cells cleave their target mature mRNAs in the cytoplasm. A recent study in rice, however, revealed that some of the 24-nt miRNAs linked to AGO4 complexes may be able to mediate DNA methylation in the rice nucleus (Wu et al. 2010). This suggests that a unique method of gene regulation may include certain AGO1-associated miRNAs cleaving nuclear-localized, intron-containing pre-mRNAs (Meng et al. 2013). MiRNAs (like tae-miR1120c-5p) that target intron may be involved in the regulation of miRNAs and long noncoding RNAs that are found there. It has been reported that some miRNAs and long noncoding RNAs are transcribed from the intron via sharing of the promoters with their host genes. It is still unclear how miRNAs and genomic DNA work together to control gene expression (Xun et al. 2019).

CRISPR/Cas editing of MIR genes and miRNA targets for crop trait improvement and NUE

Gene editing tools like CRISPR/Cas9 and other editing tools are important resources for gene knockout. The precise editing of repressor binding sites, sequences responsible for posttranscriptional regulation, editing of upstream ORFs (uORFS) and, most importantly, editing of miRNA target sites are promising strategies for crop improvement (Ferreira and Reis 2023; Sathee et al. 2022). Targeted editing of miRNA binding sites of target genes offers the advantage of non-specific derepression of unintended targets. Genome editing mediated knocking out of miRNAs (Deng et al. 2022) enhances target transcript abundance and associated phenotypic effects. As this strategy will de-repress all the targets of the knocked-out miRNA, the pleiotropic phenotypes are quite probable. In rice, another strategy was used by (Lin et al. 2021), editing of miR396 binding site of GROWTH REGULATING FACTOR 4 (OsGRF4) and OsGRF8 could enhance enhanced transcript abundance. In another attempt, the miR156 binding site at the 3ʹ-UTR of TaSPL13 in wheat was edited successfully, improving the gene expression (Gupta et al. 2023).

Conclusions

Nitrogen (N) is one of the major essential elements required for plant growth and development. Besides being a nutrient, N also acts as a signal regulating plant growth and metabolism. The green revolution and its effect maintained a balance between the overall supply and demand of foods globally. But during the last 2 decades, the increment in yield of crops has not shown considerable results to meet up food demand required by 2050. Hence improvement in nutrient uptake and assimilation capacity of plants remains in focus to date. However, with the advancement in genomics and transcriptomics, researchers have discovered regulatory components and their underlying pathways related to NUE and low N response in different plants. NUE being a complex trait, a simple transgenic approach cannot lead to better genotypes with desirable NUE. A comprehensive study of the gene pool across different species should be conducted. Major QTLs related to NUE are yet to be discovered to facilitate successful marker-assisted breeding. N metabolism-associated genes such as GS, GOGAT, NR, and NIR; transporter genes NRTs; N signalling genes such as NLA, PAP1, TCP, and NLP; auxin signalling-associated genes such as AFB, ARFs; anthocyanin biosynthetic genes such as CS-in wheat can be contributing factors for NUE QTL identification. We have identified and discussed miRNAs targeting this set of genes. The modulation of the expression of miRNAs resulting in the regulation of their target genes involved in plant adaptive responses to low N has already been studied. For example, the overexpression of miR169a results in the downregulation of nitrate transporters, NPF6.3 and NRT2.1 by down-regulating NFYA transcription factors, and plants accumulate less N. Similarly, another N-regulated miRNA, miR167 targets Auxin Response Factors ARF6 and ARF8 regulates lateral root growth in response to N. miR164 also regulates root growth by cleaving NAC1 transcripts. The identification of several N-responsive miRNAs has opened a parallel avenue of research in deciphering their regulatory roles, resulting in the potential to find target genes which were previously not known for their involvement in N response and NUE. The information on N-regulated miRNAs and the differentially expressed target transcripts are important resources for genetic improvement of NUE by genome editing.

Acknowledgements

Authors are thankful to the ICAR-Indian Agricultural Research Institute (Project-CRSCIARISIL20144047279) and SERB DST (Project: ECR/2017/002982) for funding. SD acknowledges ICAR- Junior research fellowship received during the course of the study.

Author contributions

SD and Ls wrote the manuscript. SD did the bioinformatics analysis. LS conceived the idea.

Data availability

All the data are included in the manuscript.

Code availability

Not applicable.

Declarations

Conflict of interest

The author(s) declare no competing interests.

Ethics approval

Not applicable.

Consent to participate

Not applicable.

Consent for publication

Both authors have read and give consent for publication.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Samrat Das and Lekshmy Sathee have contributed equally to this work.

References

  1. Antczak M, Popenda M, Zok T, Sarzynska J, Ratajczak T, Tomczyk K, Adamiak RW, Szachniuk M. New functionality of RNAComposer: an application to shape the axis of miR160 precursor structure. Acta Biochim Polon. 2016;63(4):737–744. doi: 10.18388/abp.2016_1329. [DOI] [PubMed] [Google Scholar]
  2. Araya T, Miyamoto M, Wibowo J, Suzuki A, Kojima S, Tsuchiya YN, Sawa S, Fukuda H, von Wirén N, Takahashi H. CLE-CLAVATA1 peptide-receptor signalling module regulates the expansion of plant root systems in a nitrogen-dependent manner. Proc Natl Acad Sci. 2014;111(5):2029–2034. doi: 10.1073/pnas.1319953111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bustos-Sanmamed P, Mao G, Deng Y, Elouet M, Khan GA, Bazin J, Turner M, Subramanian S, Yu O, Crespi M, Lelandais-Brière C. Overexpression of miR160 affects root growth and nitrogen-fixing nodule number in Medicago truncatula. Funct Plant Biol. 2013;40(12):1208–1220. doi: 10.1071/FP13123. [DOI] [PubMed] [Google Scholar]
  4. Carlsbecker A, Lee J-Y, Roberts CJ, Dettmer J, Lehesranta S, Zhou J, Lindgren O, Moreno-Risueno MA, Vatén A, Thitamadee S, Campilho A, Sebastian J, Bowman JL, Helariutta Y, Benfey PN. Cell signalling by microRNA165/6 directs gene dose-dependent root cell fate. Nature. 2010;465(7296):316–321. doi: 10.1038/nature08977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Caruana JC, Dhar N, Raina R (2020) Overexpression of Arabidopsis microRNA167 induces salicylic aciddependent defense against Pseudomonas syringae through the regulation of its targets ARF6 and ARF8. Plant Direct 4(9):e00270. [DOI] [PMC free article] [PubMed]
  6. Chalker-Scott L (1999) Environmental significance of anthocyanins in plant stress responses. In: photochemistry and photobiology, American Society for Photobiology, Vol. 70, Issue 1, pp 1–9. 10.1111/j.1751-1097.1999.tb01944.x
  7. Crafts-Brandner SJ, Klein RR, Klein P, Hölzer R, Feller U. Coordination of protein and mRNA abundances of stromal enzymes and mRNA abundances of the Clp protease subunits during senescence of Phaseolus vulgaris (L.) leaves. Planta. 1996;200(3):312–318. doi: 10.1007/BF00200298. [DOI] [PubMed] [Google Scholar]
  8. Crafts-Brandner SJ, Hölzer R, Feller U. Influence of nitrogen deficiency on senescence and the amounts of RNA and proteins in wheat leaves. Physiol Plant. 1998;102(2):192–200. doi: 10.1034/j.1399-3054.1998.1020206.x. [DOI] [Google Scholar]
  9. Craswell ET, Godwin DC (1984) The efficiency of nitrogen fertilizers applied to cereals grown in different climates. No. REP-3326. CIMMYT
  10. Curaba J, Talbot M, Li Z, Helliwell C. Over-expression of microRNA171 affects phase transitions and floral meristem determinancy in barley. BMC plant biology. 2013;13(1):1–10. doi: 10.1186/1471-2229-13-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Das S, Singh D, Meena HS, et al. Long term nitrogen deficiency alters expression of miRNAs and alters nitrogen metabolism and root architecture in Indian dwarf wheat (Triticum sphaerococcum Perc.) genotypes. Sci Rep. 2023;13:5002. doi: 10.1038/s41598-023-31278-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Deng F, Zeng F, Shen Q, et al. Molecular evolution and functional modification of plant miRNAs with CRISPR. Trends Plant Sci. 2022;27:890–907. doi: 10.1016/j.tplants.2022.01.009. [DOI] [PubMed] [Google Scholar]
  13. Dharmasiri N, Dharmasiri S, Estelle M. The F-box protein TIR1 is an auxin receptor. Nature. 2005;435(7041):441–445. doi: 10.1038/nature03543. [DOI] [PubMed] [Google Scholar]
  14. Diaz C, Saliba-Colombani V, Loudet O, Belluomo P, Moreau L, Daniel-Vedele F, Morot-Gaudry JF, Masclaux-Daubresse C. Leaf yellowing and anthocyanin accumulation are two genetically independent strategies in response to nitrogen limitation in Arabidopsis thaliana. Plant Cell Physiol. 2006;47(1):74–83. doi: 10.1093/pcp/pci225. [DOI] [PubMed] [Google Scholar]
  15. Ding L, Wang KJ, Jiang GM, Biswas DK, Xu H, Li LF, Li YH. Effects of nitrogen deficiency on photosynthetic traits of maize hybrids released in different years. Ann Bot. 2005;96(5):925–930. doi: 10.1093/aob/mci244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dos Santos Maraschin F, Memelink J, Offringa R. Auxin-induced, SCFTIR1-mediated poly-ubiquitination marks AUX/IAA proteins for degradation. Plant J. 2009;59(1):100–109. doi: 10.1111/j.1365-313X.2009.03854.x. [DOI] [PubMed] [Google Scholar]
  17. Erisman JW, Sutton MA, Galloway J, Klimont Z, Winiwarter W. How a century of ammonia synthesis changed the world. Nat Geosci. 2008;1(10):636–639. doi: 10.1038/ngeo325. [DOI] [Google Scholar]
  18. Fahlgren N, Montgomery TA, Howell MD, Allen E, Dvorak SK, Alexander AL, Carrington JC. Regulation of AUXIN RESPONSE FACTOR3 by TAS3 ta-siRNA affects developmental timing and patterning in arabidopsis. Curr Biol. 2006;16(9):939–944. doi: 10.1016/j.cub.2006.03.065. [DOI] [PubMed] [Google Scholar]
  19. Ferreira SS, Reis RS. Using CRISPR/Cas to enhance gene expression for crop trait improvement by editing miRNA targets. J Exp Bot. 2023;74(7):2208–2212. doi: 10.1093/jxb/erad003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Forde BG. Nitrogen signalling pathways shaping root system architecture: an update. Curr Opin Plant Biol. 2014;21:30–36. doi: 10.1016/j.pbi.2014.06.004. [DOI] [PubMed] [Google Scholar]
  21. Foulkes MJ, Hawkesford MJ, Barraclough PB, Holdsworth MJ, Kerr S, Kightley S, Shewry PR. Identifying traits to improve the nitrogen economy of wheat: recent advances and future prospects. Field Crops Res. 2009;114(3):329–342. doi: 10.1016/j.fcr.2009.09.005. [DOI] [Google Scholar]
  22. Fukaki H, Okushima Y, Tasaka M. Auxin-mediated lateral root formation in higher plants. Int Rev Cytol. 2007;256:111–137. doi: 10.1016/S0074-7696(07)56004-3. [DOI] [PubMed] [Google Scholar]
  23. Gallagher KL, Paquette AJ, Nakajima K, Benfey PN. Mechanisms regulating SHORT-ROOT intercellular movement. Curr Biol. 2004;14(20):1847–1851. doi: 10.1016/j.cub.2004.09.081. [DOI] [PubMed] [Google Scholar]
  24. Gallé A, Feller U. Changes of photosynthetic traits in beech saplings (Fagus sylvatica) under severe drought stress and during recovery. Physiol Plant. 2007;131(3):412–421. doi: 10.1111/j.1399-3054.2007.00972.x. [DOI] [PubMed] [Google Scholar]
  25. Gan Y, Filleur S, Rahman A, Gotensparre S, Forde BG. Nutritional regulation of ANR1 and other root-expressed MADS-box genes in Arabidopsis thaliana. Planta. 2005;222(4):730–742. doi: 10.1007/s00425-005-0020-3. [DOI] [PubMed] [Google Scholar]
  26. Gao S, Guo C, Zhang Y, Zhang F, Du X, Gu J, Xiao K. Wheat microRNA member TaMIR444a is nitrogen deprivation-responsive and involves plant adaptation to the nitrogen-starvation stress. Plant Mol Biol Rep. 2016;34(5):931–946. doi: 10.1007/S11105-016-0973-3. [DOI] [Google Scholar]
  27. Gifford ML, Dean A, Gutierrez RA, Coruzzi GM, Birnbaum KD. Cell-specific nitrogen responses mediate developmental plasticity. Proc Natl Acad Sci USA. 2008;105(2):803–808. doi: 10.1073/pnas.0709559105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Good AG, Shrawat AK, Muench DG. Can less yield more? Is reducing nutrient input into the environment compatible with maintaining crop production? Trends Plant Sci. 2004;9(12):597–605. doi: 10.1016/j.tplants.2004.10.008. [DOI] [PubMed] [Google Scholar]
  29. Gou J-Y, Felippes FF, Liu C-J, Weigel D, Wang J-W. Negative regulation of anthocyanin biosynthesis in arabidopsis by a miR156-targeted SPL transcription factor. Plant Cell. 2011;23(4):1512 LP–1522. doi: 10.1105/tpc.111.084525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Gould KS, McKelvie J, Markham KR. Do anthocyanins function as antioxidants in leaves? Imaging of H2O2 in red and green leaves after mechanical injury. Plant Cell Environ. 2002;25(10):1261–1269. doi: 10.1046/j.1365-3040.2002.00905.x. [DOI] [Google Scholar]
  31. Gruber BD, Giehl RFH, Friedel S, von Wirén N. Plasticity of the arabidopsis root system under nutrient deficiencies. Plant Physiol. 2013;163(1):161–179. doi: 10.1104/pp.113.218453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Guilfoyle TJ. The PB1 domain in auxin response factor and Aux/IAA proteins: a versatile protein interaction module in the auxin response. Plant Cell. 2015;27(1):33–43. doi: 10.1105/tpc.114.132753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Guo HS, Xie Q, Fei JF, Chua NH. MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for Arabidopsis lateral root development. Plant Cell. 2005;17(5):1376–1386. doi: 10.1105/tpc.105.030841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Gupta A, Hua L, Zhang Z, Yang B, Li W. CRISPR-induced miRNA156-recognition element mutations in TaSPL13 improve multiple agronomic traits in wheat. Plant Biotechnol J. 2023 doi: 10.1111/pbi.13969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Gutierrez L, Bussell JD, Pǎcurar DI, Schwambach J, Pǎcurar M, Bellini C. The phenotypic plasticity of adventitious rooting in Arabidopsis is controlled by complex regulation of AUXIN RESPONSE FACTOR transcripts and microRNA abundance. Plant Cell. 2009;21(10):3119–3132. doi: 10.1105/tpc.108.064758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Hawkesford MJ. Genetic variation in traits for nitrogen use efficiency in wheat. J Exp Bot. 2017;68(10):2627–2632. doi: 10.1093/jxb/erx079. [DOI] [PubMed] [Google Scholar]
  37. Hawkesford M, Griffiths S. Exploiting genetic variation in nitrogen use efficiency for cereal crop improvement. Elsevier; 2019. pp. 35–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Hirel B, Le Gouis J, Ney B, Gallais A. The challenge of improving nitrogen use efficiency in crop plants: towards a more central role for genetic variability and quantitative genetics within integrated approaches. J Exp Bot. 2007;58(9):2369–2387. doi: 10.1093/jxb/erm097. [DOI] [PubMed] [Google Scholar]
  39. Hörtensteiner S, Feller U. Nitrogen metabolism and remobilization during senescence. J Exp Bot. 2002;53(370):927–937. doi: 10.1093/jexbot/53.370.927. [DOI] [PubMed] [Google Scholar]
  40. Islam S, Zhang J, Zhao Y, She M, Ma W. Genetic regulation of the traits contributing to wheat nitrogen use efficiency. Plant Sci. 2021;303:110759. doi: 10.1016/J.PLANTSCI.2020.110759. [DOI] [PubMed] [Google Scholar]
  41. Jagadhesan B, Das S, Singh D, et al. Micro RNA mediated regulation of nutrient response in plants: the case of nitrogen. Plant Physiol Rep. 2022;27:345–357. doi: 10.1007/s40502-022-00653-0. [DOI] [Google Scholar]
  42. Jain V, Pandey R, Sairam RK. Differential response of wheat genotypes to low nitrogen stress: variation in antioxidant capacity. Indian J Plant Physiol. 2011;16(3):237. [Google Scholar]
  43. Jiang S, Sun J, Tian Z, Hu H, Michel EJS, Gao J, Jiang D, Cao W, Dai T. Root extension and nitrate transporter up-regulation induced by nitrogen deficiency improves nitrogen status and plant growth at the seedling stage of winter wheat (Triticum aestivum L.) Environ Exp Bot. 2017;141(March):28–40. doi: 10.1016/j.envexpbot.2017.06.006. [DOI] [Google Scholar]
  44. Jung JH, Seo PJ, Kang SK, Park CM. miR172 signals are incorporated into the miR156 signaling pathway at the SPL3/4/5 genes in Arabidopsis developmental transitions. Plant molecular biology. 2011;76:35–45. doi: 10.1007/s11103-011-9759-z. [DOI] [PubMed] [Google Scholar]
  45. Kant S, Peng M, Rothstein SJ. Genetic regulation by NLA and microRNA827 for maintaining nitrate-dependent phosphate homeostasis in Arabidopsis. PLoS Genet. 2011;7(3):e1002021. doi: 10.1371/journal.pgen.1002021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Khan GA, Declerck M, Sorin C, Hartmann C, Crespi M, Lelandais-Brière C. MicroRNAs as regulators of root development and architecture. Plant Mol Biol. 2011;77(1–2):47–58. doi: 10.1007/s11103-011-9793-x. [DOI] [PubMed] [Google Scholar]
  47. Kidner CA, Martienssen RA. The developmental role of microRNA in plants. Curr Opin Plant Biol. 2005;8(1):38–44. doi: 10.1016/j.pbi.2004.11.008. [DOI] [PubMed] [Google Scholar]
  48. Krouk G, Kiba T. Nitrogen and Phosphorus interactions in plants: from agronomic to physiological and molecular insights. Curr Opin Plant Biol. 2020;57:104–109. doi: 10.1016/j.pbi.2020.07.002. [DOI] [PubMed] [Google Scholar]
  49. Kubota H, Iqbal M, Quideau S, Dyck M, Spaner D. Agronomic and physiological aspects of nitrogen use efficiency in conventional and organic cereal-based production systems. Renew Agric Food Syst. 2018;33(5):443–466. doi: 10.1017/S1742170517000163. [DOI] [Google Scholar]
  50. Li X, Xia K, Liang Z, Chen K, Gao C, Zhang M. MicroRNA393 is involved in nitrogen-promoted rice tillering through regulation of auxin signal transduction in axillary buds. Scientific Reports. 2016;6(1):32158. doi: 10.1038/srep32158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Li XP, Ma XC, Wang H, Zhu Y, Liu XX, Li TT, Zheng YP, Zhao JQ, Zhang JW, Huang YY, Pu M. Osa-miR162a fine-tunes rice resistance to Magnaporthe oryzae and yield. Rice. 2020;13:1–13. doi: 10.1186/s12284-020-00396-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Liang J, He J. Protective role of anthocyanins in plants under low nitrogen stress. Biochem Biophys Res Commun. 2018;498(4):946–953. doi: 10.1016/j.bbrc.2018.03.087. [DOI] [PubMed] [Google Scholar]
  53. Liang G, He H, Yu D. Identification of nitrogen starvation-responsive MicroRNAs in Arabidopsis thaliana. PLoS ONE. 2012 doi: 10.1371/journal.pone.0048951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Liang G, Ai Q, Yu D. Uncovering miRNAs involved in crosstalk between nutrient deficiencies in Arabidopsis. Sci Rep. 2015;5(1):11813. doi: 10.1038/srep11813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Lin Y, Zhu Y, Cui Y, et al. Derepression of specific miRNA-target genes in rice using CRISPR/Cas9. J Exp Bot. 2021;72:7067–7077. doi: 10.1093/jxb/erab336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Liu H, Qin C, Chen Z, Zuo T, Yang X, Zhou H, Xu M, Cao S, Shen Y, Lin H, He X. Identification of miRNAs and their target genes in developing maize ears by combined small RNA and degradome sequencing. BMC Genom. 2014;15(1):1–18. doi: 10.1186/1471-2164-15-25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Liu Y, Lin-Wang K, Espley RV, Wang L, Yang H, Yu B, Dare A, Varkonyi-Gasic E, Wang J, Zhang J, Wang D, Allan AC. Functional diversification of the potato R2R3 MYB anthocyanin activators AN1, MYBA1, and MYB113 and their interaction with basic helix-loop-helix cofactors. J Exp Bot. 2016;67(8):2159–2176. doi: 10.1093/jxb/erw014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. López-Bucio J, Cruz-Ramírez A, Herrera-Estrella L. The role of nutrient availability in regulating root architecture. Curr Opin Plant Biol. 2003;6(3):280–287. doi: 10.1016/S1369-5266(03)00035-9. [DOI] [PubMed] [Google Scholar]
  59. Ma W, Li J, Qu B, He X, Zhao X, Li B, Fu X, Tong Y. Auxin biosynthetic gene TAR2 is involved in low nitrogen-mediated reprogramming of root architecture in Arabidopsis. Plant J. 2014;78(1):70–79. doi: 10.1111/tpj.12448. [DOI] [PubMed] [Google Scholar]
  60. Markham NR, Zuker M. UNAFold: software for nucleic acid folding and hybridization. Meth Mol Biol. 2008;453:3–31. doi: 10.1007/978-1-60327-429-6_1. [DOI] [PubMed] [Google Scholar]
  61. Matthews C, Arshad M, Hannoufa A. Alfalfa's response to heat stress is modulated by microRNA156. Physiol Plant. 2019;165(4):830–842. doi: 10.1111/ppl.12787. [DOI] [PubMed] [Google Scholar]
  62. Meng Y, Huang F, Shi Q, Cao J, Chen D, Zhang J, Ni J, Wu P, Chen M. Genome-wide survey of rice microRNAs and microRNA-target pairs in the root of a novel auxin-resistant mutant. Planta. 2009;230(5):883–898. doi: 10.1007/s00425-009-0994-3. [DOI] [PubMed] [Google Scholar]
  63. Meng Y, Ma X, Chen D, Wu P, Chen M. MicroRNA-mediated signalling is involved in plant root development. Biochem Biophys Res Commun. 2010;393(3):345–349. doi: 10.1016/j.bbrc.2010.01.129. [DOI] [PubMed] [Google Scholar]
  64. Meng Y, Shao C, Ma X, Wang H. Introns targeted by plant microRNAs: a possible novel mechanism of gene regulation. Rice (n Y) 2013;6(1):8. doi: 10.1186/1939-8433-6-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Meyer RC, Gryczka C, Neitsch C, Müller M, Bräutigam A, Schlereth A, Schön H, Weigelt-Fischer K, Altmann T. Genetic diversity for nitrogen use efficiency in Arabidopsis thaliana. Planta. 2019;250(1):41–57. doi: 10.1007/s00425-019-03140-3. [DOI] [PubMed] [Google Scholar]
  66. Miller AJ, Cramer MD. Root nitrogen acquisition and assimilation. Plant Soil. 2005;274(1):1–36. doi: 10.1007/S11104-004-0965-1. [DOI] [Google Scholar]
  67. Moll RH, Kamprath EJ, Jackson WA. Analysis and interpretation of factors which contribute to efficiency of nitrogen utilization 1. Agron J. 1982;74(3):562–564. doi: 10.2134/agronj1982.00021962007400030037x. [DOI] [Google Scholar]
  68. Nemie-Feyissa D, Olafsdottir SM, Heidari B, Lillo C. Nitrogen depletion and small R3-MYB transcription factors affecting anthocyanin accumulation in Arabidopsis leaves. Phytochemistry. 2014;98:34–40. doi: 10.1016/j.phytochem.2013.12.006. [DOI] [PubMed] [Google Scholar]
  69. Nguyen GN, Rothstein SJ, Spangenberg G, Kant S. Role of microRNAs involved in plant response to nitrogen and phosphorous limiting conditions. Front Plant Sci. 2015 doi: 10.3389/fpls.2015.00629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Nischal L, Mohsin M, Khan I, Kardam H, Wadhwa A, Abrol YP, Iqbal M, Ahmad A. Identification and comparative analysis of microRNAs associated with low-N tolerance in rice genotypes. PLoS One. 2012;7(12):e50261. doi: 10.1371/journal.pone.0050261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. van Oijen M, Levy P (2004) Nitrogen metabolism and plant adaptation to the environment: the scope for process-based modelling. pp 133–147. 10.1007/978-1-4020-2728-4_5
  72. Osmont KS, Sibout R, Hardtke CS. Hidden branches: developments in root system architecture. Annu Rev Plant Biol. 2007;58(1):93–113. doi: 10.1146/annurev.arplant.58.032806.104006. [DOI] [PubMed] [Google Scholar]
  73. Padhan BK, Sathee L, Meena HS, Adavi SB, Jha SK, Chinnusamy V. CO2 elevation accelerates phenology and alters carbon/nitrogen metabolism vis-à-vis ROS abundance in bread wheat. Front Plant Sci. 2020;11:1–18. doi: 10.3389/fpls.2020.01061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Padhan BK, Sathee L, Kumar S, Chinnusamy V, Krishnan SG, Kumar A. Nitrogen dose dependent changes in leaf greenness, crop phenology, grain nitrogen content and yield in rice (Oryza sativa L.) sub-species. Indian J Genet Plant Breed. 2023;83(2):1–3. [Google Scholar]
  75. Pant BD, Musialak-Lange M, Nuc P, May P, Buhtz A, Kehr J, Walther D, Scheible WR. Identification of nutrient-responsive Arabidopsis and rapeseed microRNAs by comprehensive real-time polymerase chain reaction profiling and small RNA sequencing. Plant Physiol. 2009;150(3):1541–1555. doi: 10.1104/pp.109.139139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Paul MJ, Driscoll SP. Sugar repression of photosynthesis: the role of carbohydrates in signalling nitrogen deficiency through source:sink imbalance. Plant Cell Environ. 1997;20(1):110–116. doi: 10.1046/j.1365-3040.1997.d01-17.x. [DOI] [Google Scholar]
  77. Peng M, Bi YM, Zhu T, Rothstein SJ. Genome-wide analysis of Arabidopsis responsive transcriptome to nitrogen limitation and its regulation by the ubiquitin ligase gene NLA. Plant Mol Biol. 2007;65(6):775–797. doi: 10.1007/s11103-007-9241-0. [DOI] [PubMed] [Google Scholar]
  78. Peng M, Hudson D, Schofield A, Tsao R, Yang R, Gu H, Bi YM, Rothstein SJ. Adaptation of Arabidopsis to nitrogen limitation involves induction of anthocyanin synthesis, which is controlled by the NLA gene. J Exp Bot. 2008;59(11):2933–2944. doi: 10.1093/jxb/ern148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE. UCSF chimera: a visualization system for exploratory research and analysis. J Comput Chem. 2004;25(13):1605–1612. doi: 10.1002/jcc.20084. [DOI] [PubMed] [Google Scholar]
  80. Popenda M, Szachniuk M, Antczak M, Purzycka KJ, Lukasiak P, Bartol N, Blazewicz J, Adamiak RW. Automated 3D structure composition for large RNAs. Nucleic Acids Res. 2012;40(14):e112–e112. doi: 10.1093/nar/gks339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Qiao Q, Wang X, Yang M, Zhao Y, Gu J, Xiao K. Wheat miRNA member TaMIR2275 involves plant nitrogen starvation adaptation via enhancement of the N acquisition-associated process. Acta Physiol Plant. 2018 doi: 10.1007/s11738-018-2758-9. [DOI] [Google Scholar]
  82. Qu B, He X, Wang J, Zhao Y, Teng W, Shao A, Zhao X, Ma W, Wang J, Li B, Li Z. A wheat CCAAT box-binding transcription factor increases the grain yield of wheat with less fertilizer input. Plant Physiol. 2015;167(2):411–423. doi: 10.1104/pp.114.246959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Raymond J, Siefert JL, Staples CR, Blankenship RE. The natural history of nitrogen fixation. Mol Biol Evol. 2004;21(3):541–554. doi: 10.1093/MOLBEV/MSH047. [DOI] [PubMed] [Google Scholar]
  84. Remans T, Nacry P, Pervent M, Filleur S, Diatloff E, Mounier E, Tillard P, Forde BG, Gojon A. The Arabidopsis NRT1.1 transporter participates in the signalling pathway triggering root colonization of nitrate-rich patches. Proc Natl Acad Sci. 2006;103(50):19206–19211. doi: 10.1073/pnas.0605275103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Rodriguez RE, Mecchia MA, Debernardi JM, Schommer C, Weigel D, Palatnik JF. Control of cell proliferation in Arabidopsis thaliana by microRNA miR396. Development. 2010;137(1):103–112. doi: 10.1242/dev.043067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Rosas Cárdenas FDF, Ruiz Suárez Y, Cano Rangel RM, Luna Garcia V, González Aguilera KL, Marsch Martínez N, De Folter S (2017) Effect of constitutive miR164 expression on plant morphology and fruit development in Arabidopsis and tomato. Agronomy 7(3):48
  87. Sathee L, Krishna GK, Adavi SB, et al. Role of protein phosphatases in the regulation of nitrogen nutrition in plants. Physiol Mol Biol Plants. 2021;27:2911–2922. doi: 10.1007/s12298-021-01115-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. Sathee L, Jagadhesan B, Pandesha PH, Barman D, Adavi BS, Nagar S, Krishna GK, Tripathi S, Jha SK, Chinnusamy V. Genome editing targets for improving nutrient use efficiency and nutrient stress adaptation. Front Genet. 2022;13:900897. doi: 10.3389/fgene.2022.900897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Scheible W-R. Genome-wide reprogramming of primary and secondary metabolism, protein synthesis, cellular growth processes, and the regulatory infrastructure of arabidopsis in response to nitrogen. Plant Physiol. 2004;136(1):2483–2499. doi: 10.1104/pp.104.047019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  90. Scheible WR, Lauerer M, Schulze ED, Caboche M, Stitt M. Accumulation of nitrate in the shoot acts as a signal to regulate shoot-root allocation in tobacco. Plant J. 1997;11(4):671–691. doi: 10.1046/j.1365-313X.1997.11040671.x. [DOI] [Google Scholar]
  91. Schommer C, Palatnik JF, Aggarwal P, Chételat A, Cubas P, Farmer EE, Nath U, Weigel D. Control of jasmonate biosynthesis and senescence by miR319 targets. PLoS biology. 2008;6(9):e230. doi: 10.1371/journal.pbio.0060230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  92. Schommer C, Debernardi JM, Bresso EG, Rodriguez RE, Palatnik JF. Repression of cell proliferation by miR319-regulated TCP4. Molecular plant. 2014;7(10):1533–1544. doi: 10.1093/mp/ssu084. [DOI] [PubMed] [Google Scholar]
  93. Sharma D, Tiwari M, Pandey A, Bhatia C, Sharma A, Trivedi PK. MicroRNA858 is a potential regulator of phenylpropanoid pathway and plant development. Plant Physiol. 2016;171(2):944 LP–959. doi: 10.1104/pp.15.01831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  94. Silver WS, Postgate JR. Evolution of symbiotic nitrogen fixation. J Theor Biol. 1973;40(1):1–10. doi: 10.1016/0022-5193(73)90160-4. [DOI] [PubMed] [Google Scholar]
  95. Singh A, Roy S, Singh S, Das SS, Gautam V, Yadav S, Kumar A, Singh A, Samantha S, Sarkar AK. Phytohormonal crosstalk modulates the expression of miR166/165s, target Class III HD-ZIPs, and KANADI genes during root growth in Arabidopsis thaliana. Sci Rep. 2017;7(1):3408. doi: 10.1038/s41598-017-03632-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  96. Sinha SK, Rani M, Bansal N, Gayatri Venkatesh K, Mandal PK. Nitrate starvation induced changes in root system architecture, carbon: nitrogen metabolism, and miRNA expression in nitrogen-responsive wheat genotypes. Appl Biochem Biotechnol. 2015;177(6):1299–1312. doi: 10.1007/s12010-015-1815-8. [DOI] [PubMed] [Google Scholar]
  97. Smillie RM, Hetherington SE. Photoabatement by anthocyanin shields photosynthetic systems from light stress. Photosynthetica. 1999;36(3):451–463. doi: 10.1023/A:1007084321859. [DOI] [Google Scholar]
  98. Soloveichik G. Electrochemical synthesis of ammonia as a potential alternative to the Haber-Bosch process. Nat Catal. 2019;2(5):377–380. doi: 10.1038/s41929-019-0280-0. [DOI] [Google Scholar]
  99. Stewart AJ, Chapman W, Jenkins GI, Graham I, Martin T, Crozier A. The effect of nitrogen and phosphorus deficiency on flavonol accumulation in plant tissues. Plant Cell Environ. 2001;24(11):1189–1197. doi: 10.1046/j.1365-3040.2001.00768.x. [DOI] [Google Scholar]
  100. Stief A, Altmann S, Hoffmann K, Pant BD, Scheible WR, Bäurle I. Arabidopsis miR156 regulates tolerance to recurring environmental stress through SPL transcription factors. Plant Cell. 2014;26(4):1792–1807. doi: 10.1105/tpc.114.123851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  101. Sunkar R, Kapoor A, Zhu JK. Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance. The Plant Cell. 2006;18(8):2051–2065. doi: 10.1105/tpc.106.041673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  102. Tohge T, Nishiyama Y, Hirai MY, Yano M, Nakajima JI, Awazuhara M, Inoue E, Takahashi H, Goodenowe DB, Kitayama M, Noji M, Yamazaki M, Saito K. Functional genomics by integrated analysis of metabolome and transcriptome of Arabidopsis plants over-expressing an MYB transcription factor. Plant J. 2005;42(2):218–235. doi: 10.1111/j.1365-313X.2005.02371.x. [DOI] [PubMed] [Google Scholar]
  103. Tóth VR, Mészáros I, Veres S, Nagy J. Effects of the available nitrogen on the photosynthetic activity and xanthophyll cycle pool of maize in the field. J Plant Physiol. 2002;159(6):627–634. doi: 10.1078/0176-1617-0640. [DOI] [Google Scholar]
  104. Ueda Y, Konishi M, Yanagisawa S. Molecular basis of the nitrogen response in plants. Soil Sci Plant Nutr. 2017;63(4):329–341. doi: 10.1080/00380768.2017.1360128. [DOI] [Google Scholar]
  105. Van Der Werf A, Nagel OW. Carbon allocation to shoots and roots in relation to nitrogen supply is mediated by cytokinins and sucrose: opinion. Plant Soil. 1996;185(1):21–32. doi: 10.1007/BF02257562. [DOI] [Google Scholar]
  106. Vaucheret H. Post-transcriptional small RNA pathways in plants: mechanisms and regulations. Genes & development. 2006;20(7):759–771. doi: 10.1101/gad.1410506. [DOI] [PubMed] [Google Scholar]
  107. Vidal EA, Araus V, Lu C, Parry G, Green PJ, Coruzzi GM, Gutiérrez RA. Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in Arabidopsis thaliana. Proc Natl Acad Sci USA. 2010;107(9):4477–4482. doi: 10.1073/pnas.0909571107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  108. Vidal EA, Moyano TC, Riveras E, Contreras-López O, Gutiérrez RA. Systems approaches map regulatory networks downstream of the auxin receptor AFB3 in the nitrate response of Arabidopsis thaliana roots. Proc Natl Acad Sci USA. 2013;110(31):12840–12845. doi: 10.1073/pnas.1310937110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  109. Vidal EA, Álvarez JM, Gutiérrez RA. Nitrate regulation of AFB3 and NAC4 gene expression in Arabidopsis roots depends on NRT1.1 nitrate transport function. Plant Sign Beh. 2014;9(6):e28501. doi: 10.4161/psb.28501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  110. Wang JW, Wang LJ, Mao YB, Cai WJ, Xue HW, Chen XY. Control of root cap formation by MicroRNA-targeted auxin response factors in Arabidopsis. Plant Cell. 2005;17(8):2204–2216. doi: 10.1105/tpc.105.033076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  111. Wang YY, Hsu PK, Tsay YF. Uptake, allocation and signalling of nitrate. Trends Plant Sci. 2012 doi: 10.1016/j.tplants.2012.04.006. [DOI] [PubMed] [Google Scholar]
  112. Wingler A, Marès M, Pourtau N. Spatial patterns and metabolic regulation of photosynthetic parameters during leaf senescence. New Phytol. 2004;161(3):781–789. doi: 10.1111/j.1469-8137.2004.00996.x. [DOI] [PubMed] [Google Scholar]
  113. Winkel-Shirley B. Flavonoid biosynthesis. A colourful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 2001;126(2):485–493. doi: 10.1104/pp.126.2.485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  114. Wu G, Park MY, Conway SR, Wang J-W, Weigel D, Poethig RS. The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. Cell. 2009;138(4):750–759. doi: 10.1016/j.cell.2009.06.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  115. Wu L, Zhou H, Zhang Q, Zhang J, Ni F, Liu C, Qi Y. DNA methylation mediated by a microRNA pathway. Mol Cell. 2010;38:465–475. doi: 10.1016/j.molcel.2010.03.008. [DOI] [PubMed] [Google Scholar]
  116. Xia R, Zhu H, An Y, Beers EP, Liu Z. Apple miRNAs and siRNAs with novel regulatory networks. Genome Biol. 2012;13(6):R47. doi: 10.1186/gb-2012-13-6-r47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  117. Xu Z, Zhong S, Li X, Li W, Rothstein SJ, Zhang S, Bi Y, Xie C. Genome-wide identification of microRNAs in response to low nitrate availability in maize leaves and roots. PLoS ONE. 2011 doi: 10.1371/journal.pone.0028009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  118. Xun Y, Tang Y, Hu L, Xiao H, Long S, Gong M, Wei C, Wei K, Xiang S. Purification and identification of miRNA target sites in genome using DNA affinity precipitation. Front Genet. 2019;10:778. doi: 10.3389/fgene.2019.00778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  119. Yan Z, Hossain MS, Wang J, Valdés-López O, Liang Y, Libault M, Qiu L, Stacey G. miR172 regulates soybean nodulation. Mol Plant Microbe Int. 2013;26(12):1371–1377. doi: 10.1094/MPMI-04-13-0111-R. [DOI] [PubMed] [Google Scholar]
  120. Yang F, Cai J, Yang Y, Liu Z. Overexpression of microRNA828 reduces anthocyanin accumulation in Arabidopsis. Plant Cell Tissue Organ Cult (PCTOC) 2013;115(2):159–167. doi: 10.1007/s11240-013-0349-4. [DOI] [Google Scholar]
  121. Zhan J, Meyers BC. Plant small RNAs: their biogenesis, regulatory roles, and functions. Annu Rev Plant Biol. 2023;74:21–51. doi: 10.1146/annurev-arplant-070122-035226. [DOI] [PubMed] [Google Scholar]
  122. Zhang H, Forde BG. An Arabidopsis MADS box gene that controls nutrient-induced changes in root architecture. Science. 1998;279(5349):407–409. doi: 10.1126/science.279.5349.407. [DOI] [PubMed] [Google Scholar]
  123. Zhang B, Wang Q. MicroRNA-based biotechnology for plant improvement. J Cell Physiol. 2015;230(1):1–15. doi: 10.1002/jcp.24685. [DOI] [PubMed] [Google Scholar]
  124. Zhang X, Zou Z, Gong P, Zhang J, Ziaf K, Li H, Xiao F, Ye Z. Over-expression of microRNA169 confers enhanced drought tolerance to tomato. Biotech Lett. 2011;33(2):403–409. doi: 10.1007/s10529-010-0436-0. [DOI] [PubMed] [Google Scholar]
  125. Zhang LW, Song JB, Shu XX, Zhang Y, Yang ZM. MiR395 is involved in the detoxification of cadmium in Brassica napus. J Hazard Mater. 2013;250–251:204–211. doi: 10.1016/j.jhazmat.2013.01.053. [DOI] [PubMed] [Google Scholar]
  126. Zhang X, Niu D, Carbonell A, Wang A, Lee A, Tun V, Wang Z, Carrington JC, Chang CEA, Jin H. ARGONAUTE PIWI domain and microRNA duplex structure regulate small RNA sorting in Arabidopsis. Nat Commun. 2014;5(1):5468. doi: 10.1038/ncomms6468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  127. Zhang X, Davidson EA, Mauzerall DL, Searchinger TD, Dumas P, Shen Y. Managing nitrogen for sustainable development. Nature. 2015;528(7580):51–59. doi: 10.1038/nature15743. [DOI] [PubMed] [Google Scholar]
  128. Zhang J, Zhou Z, Bai J, Tao X, Wang L, Zhang H, Zhu JK. Disruption of MIR396e and MIR396f improves rice yield under nitrogen-deficient conditions. Natl Sci Rev. 2020;7(1):102–112. doi: 10.1093/nsr/nwz142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  129. Zhao M, Ding H, Zhu JK, Zhang F, Li WX. Involvement of miR169 in the nitrogen-starvation responses in Arabidopsis. New Phytol. 2011;190(4):906–915. doi: 10.1111/j.1469-8137.2011.03647.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  130. Zhao Y, Guo L, Lu W, Li X, Chen H, Guo C, Xiao K. Expression pattern analysis of microRNAs in root tissue of wheat (Triticum aestivum L.) under normal nitrogen and low nitrogen conditions. J Plant Biochem Biotechnol. 2015;24(2):143–153. doi: 10.1007/s13562-013-0246-2. [DOI] [Google Scholar]
  131. Zhou GK, Kubo M, Zhong R, Demura T, Ye ZH. Overexpression of miR165 affects apical meristem formation, organ polarity establishment and vascular development in Arabidopsis. Plant Cell Physiol. 2007;48(3):391–404. doi: 10.1093/pcp/pcm008. [DOI] [PubMed] [Google Scholar]
  132. Zhou M, Li D, Li Z, Hu Q, Yang C, Zhu L, Luo H. Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. Plant Physiol. 2013;161(3):1375–1391. doi: 10.1104/pp.112.208702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  133. Zhu QH, Upadhyaya NM, Gubler F, Helliwell CA. Over-expression of miR172 causes loss of spikelet determinacy and floral organ abnormalities in rice (Oryza sativa) BMC Plant Biol. 2009;9(1):1–13. doi: 10.1186/1471-2229-9-149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  134. Zuluaga DL, Sonnante G. The use of nitrogen and its regulation in cereals: structural genes, transcription factors, and the role of miRNAs. Plants. 2019;8(8):294. doi: 10.3390/plants8080294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  135. Zuluaga DL, De Paola D, Janni M, Curci PL, Sonnante G. Durum wheat miRNAs in response to nitrogen starvation at the grain filling stage. PLoS ONE. 2017;12(8):e0183253. doi: 10.1371/journal.pone.0183253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  136. Zuluaga DL, Liuzzi V, Curci PL, Sonnante G. MicroRNAs in durum wheat seedlings under chronic and short-term nitrogen stress. Funct Integr Genom. 2018;18(6):645–657. doi: 10.1007/s10142-018-0619-7. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All the data are included in the manuscript.

Not applicable.


Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer

RESOURCES